Báo cáo khoa học: Hemagglutinin-33 of type A botulinum neurotoxin complex binds with synaptotagmin II potx

... Hemanta Sarkar and Bal Ram SinghDepartment of Chemistry and Biochemistry, and the Botulinum Research Center, University of Massachusetts Dartmouth, MA, USA Botulinum neurotoxins (BoNTs) are among ... revealed that one65 kDa band from the 0.1 m NaCl eluate is synapto-tagmin, as indicated by comparison with a positivecontrol of rat brain tissue extract and synaptosomalprotein extract (data ... Similaranalysis of the 0.5 m NaCl eluate revealed four proteinbands with molecular masses of approximately 90, 55,50 and 45 kDa. Western blot analysis using anti-syn-aptotagmin as the primary antibody...

Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx

... was identiﬁed as aninteraction partner for ADAM10 that enhances a- sec-retase shedding of APP, probably by regulating matu-ration of the prodomain of ADAM10 [22].The catalytical domain of ADAM10 ... members of the ADAM family have been shownto act as a- secretase [8,36,37]: ADAM9, ADAM10 andADAM17 (TACE). Overexpression of ADAM9 hasbeen reported to increase the basal and protein kinaseC ... mice with a dominant negative mutant of ADAM10 hadlowered amounts of APPs -a, accompanied by anenhanced amount of plaques [10] and learning deﬁcien-cies in the Morris water maze test [12]. In summary,what...

Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

... PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaGTCGACaatgcAntisense ARS with PstI and SalI gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP ... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttggattttttCTGCAGCAGAGCTCGTTTAGTGAACCGTOP CcttctccccggcggttagtgctgagagtgcARS aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaS. Ma et al. PABP expression during heat ... that, due to the increasedcellular abundance of HSP27, there was an overallCMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’...

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAGReverse ompA105 5¢-GCCATGAATATCTCCAACGAGReverse ompA117 5¢-CATCCAAAATACGCCATGAATATCForward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCGReverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGACForward ... 5¢-GCTTCAGTACTTAGAGACForward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACCReverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGGForward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGAForward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTTReverse...

Tài liệu Báo cáo khoa học: Expression of an a-1,3-glucanase during mycoparasitic interaction of Trichoderma asperellum docx

... 67,5833–5839.26 Wiater A, Szczodrak J & Rogalski J (2001) Puriﬁcationand characterization of an extracellular mutanase fromTrichoderma harzianum. Mycol Res 105, 1357–1363.27 Hasegawa S & Nordin ... harzianum (Accession nos.AAF27911, CAC80439) [18,25]. Identical amino acids in two or more sequences are shaded. The alignment was carried out with DNASTARusing MEGALIGN (CLUSTAL) with a gap ... &Henrissat B (2000) Biochemical analysis of recombinantfungal mutanases. A new family of a- 1,3-glucanases with novel carbohydrate-binding domains. J Biol Chem275, 2009–2018.19 Matsuda...

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the speciﬁc motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

... Average Kd(nM)AAAGACATG + + 0.25 A GAGACATG ND –AAGGACATG ND –AAATACATG ––AAAGCCATG ––AAAGAGATG + + 1.5AAAGACCTG ND –AAAGACACG ND + 4AAAGACAT A ND –8p=0.01765Fold increase ... that A BCshifted123123456bandProbe1.00E+008AAAGAGATGAAGGACATGAAAGACCTGAAAGACATGKd=1.2 nMAAAGAGATGKd=0.29 nMAAAGACACGKd=4 nMAAAGACACGAAAGACATAAGAGACATGAAAGACATGAAAGCCATGAAATACATG8.00E+0076.00E+0074.00E+0072.00E+0070.00E+000141612108Fluoriscence340Fluoriscence340640.00 ... oligo-nucleotides, namely A GAGACATG (P2), AAGGACATG(P3), AAATACATG (P4), AAAGCCATG (P5), AAAGAGATG (P6), AAAGACCTG (P7), AAAGACACG(P8), and AAAGACAT A (P9), and their complementarysequences CATGTCTCT...

Báo cáo khoa học: Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions docx

... )153 A GAAATGGAAAGT AL353732Human IFN a 1 )166 GGAAAGCAAAAAA AL353732Human IFN a 4b )123 GAAAATGGAAATT X02955Human IFN a 4b )164 A GAAAGCAAAACA X02955Chicken IFN1-2 )121 A GGAAGGGAAAGA Y14968Chicken ... noSalmon IFNA1 )96 GGAAAGTGAAAAC DQ354152Salmon IFNA1 )149 GGAAAATGAAAGT DQ354152Zebraﬁsh IFN )115 GGAAAGGGAAAAC AJ544820Zebraﬁsh IFN )151 A GAAAGTGAAAGC AJ544820Fugu IFN )97 A GAAAACGAAATC ... A GAAAACGAAATC AJ583023Fugu IFN )146 TGAAAAGCAAAGG AJ583023Tetraodon IFN )148 TGAAATCCAAAAG AJ544889Human IFN b )164 GAAAACTGAAAGG X00973Human IFN a 1 )125 A GAAAGTGGAAAT AL353732Human IFN a 1 )153...

Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot

... formation of a larger amount of the ultimate mutagen DE2 than of DE1,which is far less carcinogenic. These data suggest thatmembrane properties such as negative charge and nonbi-layer phase ... Elsevier-Biosoft). Thedata presented a re the m eans and s tandard d eviations of three separate experiments. Statist ical signiﬁcance of results b etween lipid systems was analysed using one -wayANOVAsoftware ... °C) andhas been used to investigate the impact of the hexagonalphaseformingtendencybyYangandHwang[31].DatainFig. 1A and in Table 1 show that the activity of CYP 1A1 issigniﬁcantly enhanced...

Báo cáo khoa học: Structures of type B ribose 5-phosphate isomerase from Trypanosoma cruzi shed light on the determinants of sugar speciﬁcity in the structural family ppt

... (known also as Chagas dis-ease), has a functional pentose phosphate pathway(PPP) [1]. This pathway has been proposed to havecrucial roles in the protection of trypanosomatidsagainst oxidative ... derivatization [13]. Isomeriza-tion of this 6-carbon sugar could not be detected, evenwhen it was added at a concentration of 30 mm.The same preparation of TcRpiB had a kcat of 28 s)1and a ... phosphate binding (beta ⁄ alpha)8-barrels: D-allulose6-phosphate 3-epimerase from Escherichia coli K-12.Biochemistry 47, 9608–9617.27 Hossain MA, Wakabayashi H, Goda F, Kobayashi S,Maeba T &...

Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating ﬁmbrial adhesin expression in uropathogenic Escherichia coli pdf

... perframe.Native data were collected to a resolution of 1.4 A ˚. A total of 360 frames of data with an oscillation angle of 0.45° were collected. The exposure time was 0.5 s perframe. All datasets ... thed (A. T) base pairs of the DNA dodecamerd(CGCAAATTTGCG) and its complex with distamy-cin. Proc Natl Acad Sci USA 84, 8385–8389.36 Zimmer C & Wahnert U (1986) NonintercalatingDNA-binding ... coliand cause diarrhea in domestic animals. In manyrespects, the roles of the FaeB and FanB proteins intranscriptional regulation are similar to that of PapBin the regulation of the pap operon...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Chuong 2 nhận dạng rui ro Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP