Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc

Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells Shuhua Ma*, Rumpa B Bhattacharjee* and Jnanankur Bag Department of Molecular and Cellular Biology, University of Guelph, Canada Keywords eIF4G; HSP27; HSP70; mRNA translation; poly(A)-binding protein Correspondence J Bag, Department of Molecular & Cellular Biology, University of Guelph, Guelph, ON N1G2W1, Canada Fax: 519 837 2075 Tel: 519 824 4120 E-mail: jbag@uoguelph.ca *These authors contributed equally to this work (Received August 2008, revised 31 October 2008, accepted 14 November 2008) doi:10.1111/j.1742-4658.2008.06803.x Induction of heat shock proteins (HSPs) helps cells to survive severe hyperthermal stress and removes toxic unfolded proteins At the same time, the cap-dependent translation of global cellular mRNA is inhibited, due to the loss of function of eukaryotic initiation factor (eIF)4F complex It has been previously reported that, following heat shock, HSP27 binds to the insoluble granules of eIF4G and impedes its association with cytoplasmic poly(A)-binding protein (PABP) and eIF4E In the studies reported here, in addition to heat shock, we have included results of our investigation on the association between eIF4G, PABP1 and HSP27 during recovery from heat shock, when cap-dependent mRNA translation resumes We showed here that in the heat-shocked cells, the PABP1–eIF4G complex dissociated, and both polypeptides translocated with the HSP27 to the nucleus During recovery after heat shock, PABP1 and eIF4G were redistributed into the cytoplasm and colocalized with each other In addition, PABP1 expression was upregulated and its translation efficiency was increased during the recovery period, possibly to meet additional demands on the translation machinery HSP27 remained associated with the eIF4G–PABP1 complex during recovery from heat shock Therefore, our results raise the possibility that the association of HSP27 with eIF4G may not be sufficient to suppress cap-dependent translation during heat shock In addition, we provide evidence that the terminal oligopyrimidine cis-element of PABP1 mRNA is responsible for the preferential increase of PABP1 mRNA translation in cells undergoing recovery from heat shock In response to extracellular signals, cells regulate protein synthesis, and adapt to environmental changes such as the level of growth factors, temperature, and availability of nutrients [1] The regulation of protein synthesis is a complex process, as many factors are required for mRNA translation Translation initiation is believed to be the rate-limiting step in protein synthesis, and is usually regulated by several important initiation factors, including poly(A)-binding protein (PABP) and eukaryotic initiation factors (eIFs) 4E, 4G, 2a, and 4A eIF4E binds to the 5¢-cap of mRNA to facilitate initiation of translation eIF4A is a helicase enzyme that removes the secondary structure from the 5¢-UTR of mRNA, and eIF4G acts as a bridge protein to interact with eIF4E, PABP1, eIF4A and eukaryotic release factor [1,2] At the beginning of the translation initiation cycle, eIF2a forms a ternary complex with met-tRNAi and GTP [3] Fine tuning of these steps is achieved by regulating the interaction of these initiation factors with each other and the mRNA [1] PABP1 is an RNA-binding protein with a high affinity for the poly(A) tail of mRNA [4] It is mainly distributed in the cytoplasm, and may shuttle between the cytoplasm and the nucleus [5] By interacting with Abbreviations ARS, autoregulatory sequence; eIF, eukaryotic initiation factor; FITC, fluorescein isothiocyanate; b-gal, b-galactosidase; GFP, green fluorescent protein; HSP, heat shock protein; PABP, cytoplasmic poly(A)-binding protein; TOP, terminal oligopyrimidine tract 552 FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al eIF4G and the poly(A) tail simultaneously, PABP1 is believed to bring the 5¢-end and 3¢-end of mRNA into close proximity and stimulate the translation of mRNA by forming a closed-loop structure Circularization of mRNA is believed to promote the translation reinitiation by recycling 40S ribosomal subunit for the next round of translation [1] Interactions with additional regulatory proteins allow PABP1 to regulate the translation initiation step [6–11] For example, PAIP1 interacts with PABP1 through its ‘PABP1-interacting motif 1’, containing a stretch of acidic amino acids [8], and acts as a translational enhancer Overexpression of PAIP1 increases the rate of mRNA translation in COS cells [9] Another regulatory protein, PAIP2, disrupts the interaction of PABP1 with PAIP1, and suppresses PABP1-dependent mRNA translation [8,10] Both PAIP1 and PAIP2 have similar PABP1-binding motifs, and compete for binding with PABP1 [10] As such, PAIP2 works as an inhibitor of mRNA translation by competing with PAIP1 Eukaryotic release factor also interacts with PABP1, and facilitates termination of translation, and reinitiation by 40S ribosomal subunits, by maintaining the quasicircular structure of the translating mRNA [6] Furthermore, PABP1 is believed to protect mRNAs from degradation by binding to their poly(A) tract [12] Studies have shown that the interaction between PABP1 and the poly(A) tract may be regulated by PABP1-interacting partners For example, the AU-rich element-binding polypeptide AUF1 may control mRNA stability by binding to PABP1 [7] In light of the vital roles of PABP1 in mRNA metabolism, it is critical to control the expression of PABP1 Expression of PABP1 is regulated primarily at the translational level Two cis-elements; a terminal oligopyrimidine tract (TOP) and a unique A-rich autoregulatory sequence (ARS), are located in the 5¢-UTR of PABP1 mRNA [13,14] The ARS regulates the expression of PABP1 by a negative feedback mechanism In the presence of excess PABP1 in mammalian cells, PABP1 binds to the ARS element of its own mRNA and forms a heteromeric autoregulatory ribonucleoprotein complex by interacting with IMP1 and UNR [11] This process stalls the migration of 40S ribosomal subunits along the 5¢-UTR of the PABP1 mRNA and limits its expression [13] In comparison to the role of the ARS, the precise mechanism by which the TOP regulates PABP1 mRNA translation is not clear It appears that the TOP cis-element stimulates translation of PABP1 mRNA in a developmental- and growth-dependent manner [14] As such, the TOP may allow translation of PABP1 mRNA to be coordinately regulated with a number of other TOP-containing PABP expression during heat shock recovery mRNAs encoding polypeptides involved in mRNA translation, including elongation factors and and ribosomal protein S6 kinases [15] The PABP1 gene behaves like an early response gene, as its expression level responds quickly to a change in the cellular demand for protein synthesis [16] Under a variety of cellular stress conditions, such as heat shock, mRNA translation undergoes rapid changes In response to heat shock stress, cells induce the expression of a unique set of proteins called heat shock proteins (HSPs) [17,18] HSPs are also produced at a basal level in cells under normal conditions, and have important functions such as facilitating appropriate protein folding as molecular chaperones, and aiding in the assembly of protein complexes; they also participate in translocation of proteins across cellular membranes, as well as providing protection against cellular stresses [18] HSPs are also termed ‘stress proteins’, because they are overexpressed to improve cell survival under a variety of additional cell-damaging conditions, such as exposure to heavy metal ions, alcohol, and hypoxia, and glucose deprivation [3] There are several HSP families, including HSP90, HSP70, HSP60, HSP110, and the low molecular weight HSPs such as HSP10, HSP20, HSP27, HSP32, and HSP40 [18] The predominant HSPs, HSP70 and HSP27, have been well studied HSP70 and HSP27 have been found both in the cytoplasm and in the nucleus during heat shock, although they are constitutively localized in the cytoplasm at a low level [18] Expression of HSPs is induced at the transcriptional level by heat shock factors, which are activated during heat shock and bind to the heat shock elements located in the promoter regions of HSP genes [19] During heat shock, the general translation of capdependent cellular mRNAs is inhibited, whereas the synthesis of HSPs is increased [3,20] The mechanism that underlies this is not well understood It is believed that mRNAs encoding HSPs are translated in an internal ribosome entry site-dependent manner, which is enhanced by heat shock [3,20,21] It has also been reported that heat shock enhances the translation of BiP, and viral mRNAs, which are dependent on internal ribosome entry site-mediated translation [20] During heat shock, the inhibition of cap-dependent translation probably takes place through inactivation of the eIF4F complex and other initiation factors, and this is supported by the following changes observed in heat-shocked cells: decreased phosphorylation of eIF4E and eIF4B, increased phosphorylation of eIF2a, and insolubilization of eIF4G [20,22] The phosphorylation of eIF2a is an important FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 553 PABP expression during heat shock recovery S Ma et al mechanism for regulating global protein synthesis Primarily, eIF2a plays its role by forming the eIF2a– GTP complex, which is hydrolyzed to an inactive eIF2a–GDP complex at the end of the initiation cycle The GDP is then released from the eIF2a– GDP complex, and reactivates eIF2a for the next round of translation [3] When eIF2a is phosphorylated, the GDP cannot be released from it, and the global mRNA translation rate decreases It has been shown that eIF2a is increasingly phosphorylated from mild to severe heat shock conditions as the cells are subjected to an increasing temperature, and protein synthesis is repressed by the presence of hyperphosphorylated eIF2a However, HeLa cells subjected to a mild heat shock (42 °C for 30 min) did not show increased eIF2a phosphorylation, even though protein synthesis was inhibited [3,20] Thus, it has been suggested that phosphorylation of eIF2a may not be the dominant mechanism of inhibition of translation of normal cellular mRNAs under heat shock, and therefore other regulatory mechanisms must exist The reduction in elF4F activity is probably also responsible for suppression of translation of most mRNAs during heat shock [22] During heat shock (44 °C, h) in 293T cells, eIF4G was shown to be trapped within the insoluble heat shock granules by HSP27, and dissociated from PABP1 It has been suggested that eIF4F-dependent mRNA translation is inhibited by heat-induced HSP27 during heat shock [22] In addition to eIF4G, the PABP1 gene as an early response gene may play a very important role in the regulation of gene expression in response to cellular stresses However, in mammalian cells, there is insufficient evidence regarding the molecular behavior of PABP1 under heat shock Therefore, in order to investigate how PABP1 responds to thermal stress and whether its expression is regulated to cope with the changing demand for mRNA translation during and after heat shock, we examined the status of PABP1 expression in HeLa cells subjected to heat shock We investigated the subcellular localization of PABP1 and its polypeptide partner eIF4G by using immunofluorescence confocal microscopy The results show that PABP1 and eIF4G become insoluble and are translocated into the nucleus from the cytoplasm in a time- and temperature-dependent manner We propose that the nuclear translocation of PABP1 and eIF4G is associated with the induction and nuclear translocation of HSP27 by heat shock, because both PABP1 and eIF4G were found to be colocalized with HSP27 around the perinuclear region before being translocated to the nucleus We also found that 554 PABP1 mRNA translation was upregulated during recovery after heat shock, and that this was controlled at the translational level by the 5¢-TOP element located in the 5¢-UTR of PABP1 mRNA We suggest that increased expression of PABP1 during the phase of recovery from heat shock may be necessary to meet the cellular demand for protein synthesis for complete recovery from stress Results PABP1 expression during recovery from heat shock As PABP1 is important for regulation of mRNA translation, we examined whether its cellular level is adjusted during heat shock and subsequent recovery periods The results of western blot analyses (Fig 1) show that there was a small reduction in the cellular abundance of PABP1 and its polypeptide partner eIF4G immediately after the heat shock treatment However, during the period of recovery from heat shock, when translation of normal cellular mRNA resumes, there was an approximately 2.5-fold increase in the cellular PABP1 level In contrast, the cellular level of eIF4G did not show a similar increase The increase of PABP1 abundance also correlated very well with the increased expression of HSP27 and HSP70 In order to assess whether the increased PABP1 level was due to an increase in the cognate mRNA level, we measured the PABP1 mRNA level by real time RT-PCR The results (Fig 2A) show that the PABP1 mRNA levels were not altered by exposure to heat shock or following the subsequent recovery phase As these results suggest translational control of PABP1 expression, we examined the distribution of PABP1 mRNA between the translationally active polysomes and repressed subpolysomal fractions by sucrose gradient fractionation, as previously described [23] The results (Fig 2B–D) show that in exponentially growing HeLa cells, approximately 30–40% of cytoplasmic PABP1 mRNA was present in the translated polysomal fractions (Fig 2D), and the remaining mRNA was present in the nontranslated subpolysomal fractions In contrast, almost 90–100% of the b-actin mRNA was present in the polysomal fractions There was a significant reduction in the translation of the b-actin mRNA in heat-shocked cells, as the majority of this mRNA was present in the nontranslated subpolysomal fractions However, during recovery from heat shock at 37 °C, the translation of PABP1 mRNA was enhanced, as nearly 80–90% of PABP1 mRNA was found in the polysomal fractions This represents an FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al A B Fig Changes in the cellular level of polypeptides following heat shock and recovery (A) Approximately · 105 HeLa cells grown on 35 mm dishes were subjected to heat shock at 44 °C for h (HS) Cells in some dishes were allowed to recover for either 12 h (Re12h) or 24 h (Re24h) at 37 °C The control cells (C) were not heat shocked and were maintained at 37 °C Cells were directly lysed on the plate using gel loading buffer, and lysates were analyzed by SDS ⁄ PAGE Individual polypeptides were detected by western blotting using appropriate antibodies as described in Experimental procedures The abundance of specific polypeptides was determined by scanning the images, and normalizing the values using the b-actin levels as loading controls The values below each lane represent the relative abundance of each polypeptide using an arbitrary scale where the level in control cells was considered to be 1.00 (B) The experiment described in (A) was repeated three times, and the averages are shown here as mean ± standard error (SE) The linear response of the western blotting experiments is shown in Fig S1 increased efficiency of PABP1 mRNA translation over the level normally found in exponentially growing cells This observation suggests that the increased abundance of PABP1 during recovery from heat shock is controlled at the mRNA translation level The increase of PABP1 mRNA translation was preferential, as the polysomal distribution profile of the b-actin mRNA in cells during the recovery from heat shock appeared to be similar to what was observed in the exponentially growing cells PABP expression during heat shock recovery Association between PABP1 and eIF4G following heat shock and recovery PABP1 is known to interact with eIF4G to enhance cap- and poly(A)-dependent mRNA translation Therefore, we examined the association between PABP1 and eIF4G in HeLa cells, immediately after the heat shock treatment, and during the recovery phase of cells, using both coimmunoprecipitation and immunofluorescence microscopy The results of coimmunoprecipitation studies (Fig 3A,C) show that although the cellular abundance of eIF4G was not affected significantly during heat shock and recovery, the level of its association with PABP1 was reduced As compared to untreated control cells, after a h heat shock treatment, approximately 40–50% less PABP1 coimmunoprecipitated with eIF4G This reduction, however, was a little higher than what was expected from the reduced abundance of both polypeptides in heat-shocked cells During the recovery period from heat shock, as compared to the non-heat-shocked control cells, almost a three-fold increase in the association of PABP1 with eIF4G was observed This increase occurred without a concomitant increase in the cellular level of eIF4G during recovery from the thermal stress As the cellular abundance of PABP1 in cells recovered from heat shock also increased approximately three-fold, our results suggest that the majority of excess PABP1 was associated with eIF4G during the recovery phase We also examined the association between PABP1 and eIF4G in RNase-treated cell extracts, and found that the coimmunoprecipitation of PABP1 by eIF4G antibody was independent of the presence of intact mRNA We used b-actin as a negative control, and did not detect this polypeptide in our immunoprecipitated samples with the eIF4G antibody In addition, as a loading control, we measured the level of b-actin in total cell extracts before they were subjected to immunoprecipitation As eIF4E is a known subunit of the multimeric complex with eIF4G, we also analyzed its coimmunoprecipitation as a positive control The results show that there was no significant change in the association between eIF4G and eIF4E following heat shock and during the recovery phase We also used nonimmunized rabbit sera for mock immunoprecipitation as additional negative controls, and the results (Fig 3B) show that both PABP and eIF4G were not detectable in the immunoprecipitated samples under our experimental conditions The average results of three independent immunoprecipitation studies using the eIF4G antibody are shown in Fig 3D as the percentages of total PABP1 and eIF4G in the immunoprecipitated samples In FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 555 PABP expression during heat shock recovery S Ma et al C A β-actin Relative mRNA level HS Re12 h 1.4 Re24 h -HS (control) 1.2 HS 1.0 Re24 h 0.8 PABP -HS (control) 0.6 0.4 HS 0.2 Re24 h Fractions: B D 100 90 A254nm % in polysome Fraction Number (6-11) 0.0 β-actin 0.4 Polysomes 40s 60s 0.2 10 11 PABP 80s PABP 80 β-actin 70 60 50 40 30 20 10 Fraction Number 11 -HS +HS Re24 Fig The abundance and polysomal distribution profiles of mRNA following heat shock and recovery Cells were subjected to heat shock and recovery as described in the legend to Fig Either the total cellular RNA was isolated and analyzed by real time RT-PCR (A) or the cytoplasmic extract was subjected to sucrose density gradient centrifugation as described in Experimental procedures (B) The gradient was fractionated, and RNA was isolated from individual fractions using Triazole (Roche) The abundance of PABP1 and b-actin mRNAs in each fraction was measured by RT-PCR as described in Experimental procedures For each sample, a different number of amplifications cycles was used to determine the linear range Twenty-two and 25 cycles were found to be optimum for b-actin and PABP1 mRNA, respectively Each RNA fraction was also subjected to the PCR step without the prior reverse transcription step to determine DNA contamination in our samples, and none was found The amplicons were analyzed by 1% agarose gel electrophoresis, and quantified by scanning the digital image Representative results of three separate experiments are shown in (C) The distribution of mRNA in the subpolysomal region (fraction numbers 1–5) and the polysomal region (fraction numbers 6–11) of the gradient was determined by quantifying the mRNA level in each fraction using an arbitrary scale The value of mean ± standard error was derived from three separate experiments and is presented in (D) non-heat-shocked control cells, approximately 50% of total cellular PABP1 was associated with eIF4G In heat-shocked cells, the level of eIF4G-associated PABP1 was reduced to approximately 25% of total cellular PABP1 However, following 12 or 24 h of recovery, the level was increased to approximately 75% of total cellular PABP1 In addition, as expected, all samples showed 90–100% of total eIF4G in the immunoprecipitates PABP1 is a phosphoprotein, and its interaction with poly(A) and eIF4G is enhanced by phosphorylation [24] Therefore, we investigated PABP1 phosphorylation by two-dimensional gel electrophoresis, followed by western blotting as previously described [25] In exponentially growing cells (Fig 3B), PABP1 was present in multiple phosphorylated states, as shown by its different isoelectric points Upon inhibition of phosphorylation by U0126, an inhibitor of the MKK2 kinase pathway [25,26], PABP1 migrated as a more basic protein with a higher isoelectric point, and 556 appeared as a single spot in two-dimensional gels Following 24 h of recovery from heat shock, the abundance of PABP1 increased, and nearly all of this polypeptide was found in hyperphosphorylated forms migrating with lower isoelectric points than what was observed for the nonphosphorylated polypeptide Thus, the increased PABP1 phosphorylation might explain the observed enhanced association of PABP1 with eIF4G in our coimmunoprecipitation studies during recovery from heat shock In order to observe the association of PABP1 with eIF4G in individual cells, confocal immunofluorescence microscopy was performed after heat shock and recovery of HeLa cells The results (Fig 4) show that in exponentially growing cells at 37 °C, PABP1 was colocalized with eIF4G However, a significant amount of PABP1 also appeared within distinct cytoplasmic locations that were not colocalized with eIF4G Both eIF4G and PABP1 showed diffuse distribution within the cytoplasm Following heat shock, both PABP1 and eIF4G FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al PABP expression during heat shock recovery HS 1.0 0.5 3.0 4.0 1.0 0.5 3.4 4.0 1.0 1.0 1.1 1.0 1.1 0.9 0.9 1.0 1.0 0.9 1.0 Re12 h Re24 h PABP (-RNase) PABP (+ RNase) eIF4G C Relative amount in co-immunoprecipitates Con A 4.5 3.5 2.5 1.5 0.5 HS Re12 h Re24 h eIF4G PABP eIF4E HS β-actin (Co-IP) β-actin total cell extract 0.9 PABP B Re12 h Re24 h 100 80 60 60 40 20 % of input D eIF4G PABP E eIF4G - PABP + Control Re24 h 20um U0126 β-actin Control Re24 h pH 11 Fig Coimmunoprecipitation of polypeptides with antibody to eIF4G and analyses of PABP1 phosphorylation (A) Approximately · 105 HeLa cells following heat shock and recovery were lysed in a lysis buffer and reacted with the eIF4G antibody as described in Experimental procedures The antigen–antibody complex was captured with protein A–Sepharose beads and eluted with SDS containing gel loading buffer The eluted samples were subjected to SDS ⁄ PAGE and western blotting using antibodies against PABP1, eIF4G, eIF4E and b-actin (Santa Cruz) to detect coimmunoprecipitated polypeptides, according to the method described in Experimental procedures Some samples were treated with lgỈlL)1 RNase A and T1 for 10 at 20 °C to degrade RNA before addition of the antibody The effectiveness of this treatment was determined by examining the absence of intact rRNA by gel electrophoresis of RNA samples prepared from the treated cell extracts (B) Mock immunoprecipitation was performed using 1.5 lg of preimmunized rabbit serum, and the eluted fractions from protein A–Sepharose beads were examined for the presence of PABP1 and eIF4G as described above (C) Western blots of three separate experiments were scanned and quantified to determine the value of mean ± standard error (SE) (D) Equivalent cellular levels of total cell lysate and immunoprecipitated fractions eluted from the protein A–Sepharose beads were examined for the presence of eIF4G and PABP1 by western blotting Total cell lysate and eluted fractions were analyzed together in the same blot, and quantified as described above The averages of three independent experiments are shown (E) Cells subjected to different treatments were lysed and subjected to two-dimensional gel electrophoresis as described in Experimental procedures The separated polypeptides were transferred to a nitrocellulose membrane for immunoblotting with either a PABP1 or b-actin antibody Control, cells before heat shock; Re24h, cells were heat shocked and allowed to recover for 24 h as previously described; U0126, cells were treated with the inhibitor of MKK1 ⁄ U0126 (20 lM) for the last 12 h of the 24 h recovery period of heat-shocked cells were translocated to the nucleus in a time- and temperature-dependent fashion After 1.5 h of heat shock at 44 °C, nearly all of the eIF4G and PABP1 was present at the perinuclear site and remained colocalized, although some granular structures were also visible The cytoplasmic b-actin also showed some aggregated granular structures and perinuclear localization in approximately 30–40% of cells In contrast, the perinuclear granular localization of eIF4G and PABP1 was more pronounced and noticeable in a much larger percentage (> 85%) of cells Following h of heat shock at 44 °C, almost complete translocation of both eIF4G and PABP1 within the cell nucleus as granules was observed During the same treatment, b-actin remained mostly cytoplasmic, with some granular aggregates Similar nuclear translocation was also observed within a shorter time period of 1–1.5 h when the cells were heat shocked at 46 °C (results not shown) Following nuclear translocation, we observed detectable dissociation of some eIF4G granules from PABP1 (Fig 4, enlarged inset) Furthermore, neither polypeptide was present within the nucleolus Interestingly, during the recovery period, FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 557 PABP expression during heat shock recovery S Ma et al Fig Colocalization of eIF4G and PABP1 HeLa cells, grown on coverslips placed in 35-mm tissue culture dishes, were subjected to heat shock and recovery or maintained at 37 °C as described in the legend to Fig Cells were fixed in methanol, and treated with the appropriate primary antibody followed by a secondary antibody: either FITC-labeled anti-goat (for eIF4G) IgG or Texas Red-labeled anti-mouse IgG (for PABP1) The b-actin signal was detected by using an FITC-labeled mouse secondary antibody Cells were examined by confocal microscopy using FITC- and Texas Red-specific filters Approximately 200 cells were examined in each of three separate experiments, and the results given here represent more than 80% of cellular images The inset shows the enlarged view of one nucleus marked with an arrowhead PABP1 and eIF4G were gradually redistributed to the cytoplasmic compartment In addition, the colocalization of PABP1 and eIF4G was re-established After 12 h of recovery at 37 °C, both eIF4G and PABP1 appeared in the perinuclear cytoplasmic space, with 558 some granules Both polypeptides showed a predominantly diffuse distribution almost throughout the cytoplasm after 24 h of recovery This cytoplasmic redistribution occurred in the absence of new protein synthesis In cycloheximide-treated cells during a 20 h FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al recovery period in the absence of protein synthesis, both eIF4G and PABP1 were able to relocate to the cytoplasm and were mostly colocalized This suggests that the pre-existing nuclear PABP1 and eIF4G in heatshocked cells could travel to the cytoplasm and reassociate during the recovery phase However, the cellular abundance of both polypeptides was reduced as a result of inhibition of new protein synthesis As mRNA translation was inhibited by cycloheximide treatment, we could not determine whether the relocated PABP1 and eIF4G were capable of participating in mRNA translation eIF4G and PABP1 appeared to be completely colocalized in cells that had recovered for 12 and 24 h As all of the PABP1 in exponentially growing cells was not colocalized with eIF4G, these observations support the coimmunoprecipitation results, which suggest an increased association between the two polypeptides during the recovery period It is possible that post-translational modifications of polypeptides during the recovery period might allow PABP1 to interact with eIF4G at a stoichiometry of more than : It should be noted here that, in addition to the C-terminal domain, PABP1 has another eIF4G-binding domain within its N-terminal RNA-binding domain [27] As a negative control, we also examined the colocalization of b-actin with eIF4G in exponentially growing cells As is evident from the confocal images, b-actin was not colocalized with eIF4G in exponentially growing cells Furthermore, following recovery from heat shock, the cytoplasmic distribution of b-actin returned to what was observed in exponentially growing cells It has been previously reported that after heat shock, eIF4G is present in detergent-insoluble granules [22] Therefore, we examined whether PABP1 is also present in similar granules, and whether transition to the normal soluble form takes place for both PABP1 and eIF4G during recovery from heat shock Analyses of nonionic detergent-treated cells by immunofluorescence confocal microscopy (Fig 5) show that detergent treatment of normal cells removed almost all of their PABP1 and eIF4G content In heatshocked cells, prior to the recovery period the majority of nuclear-translocated PABP1 and eIF4G was present as detergent-insoluble granules During the recovery period, as shown in Fig 4, both PABP1 and eIF4G were redistributed to the cytoplasm, and following the nonionic detergent treatment, both polypeptides were extracted from the cells We also examined the detergent solubility of another nuclear protein, PABPN1 Cells were transfected with a PABPN1-A10–green fluorescent protein (GFP) fusion protein expression vector [28] before being subjected to the detergent treatment We show here that most of PABP expression during heat shock recovery the PABPN1–GFP was extracted from the control cells In untreated controls, approximately 80–90% of cells showed diffuse GFP signal throughout the nucleoplasm In detergent-treated samples, the diffuse GFP signal was lost from most of the cells Approximately 10–20% of cells showed the presence of some detergent-insoluble nuclear aggregates This was expected, as PABPN1 is known to form nuclear aggregates, especially at a very high expression level [28] Together, our results suggest that, following heat shock treatment, both eIF4G and PABP1 translocate to the cell nucleus as detergent-insoluble granular aggregates Cis-acting translational control element involved in regulating PABP1 mRNA translation during recovery from heat shock The mRNA encoding PABP1 consists of two wellknown translational control elements, the TOP and the ARS in the 5¢-UTR [13] To examine which of the two cis-elements are involved in upregulating translation of the PABP1 mRNA during recovery from heat shock, we introduced both cis-elements either individually or in combination at the 5¢-UTR of the reporter b-galactosidase (b-gal) mRNA Following transfection with different constructs, cells were subjected to h of heat shock and recovery for 12 and 24 h, and the level of b-gal polypeptide was measured by western blotting The results (Fig 6) show that the presence of the ARS had no stimulatory effect on the b-gal expression level during recovery from heat shock In contrast, the presence of the TOP element in the 5¢-UTR of the reporter construct resulted in an increase in b-gal abundance during recovery from heat shock Furthermore, the presence of the ARS with the TOP did not prevent the increase in b-gal level from occurring during recovery from heat shock However, as the ARS has an inhibitory effect on mRNA translation [23], its presence together with the TOP element in the reporter construct reduced the overall expression level of b-gal under all conditions examined Nevertheless, our results suggest that the TOP can exhibit its stimulatory function on mRNA translation in the presence of the ARS To further elucidate whether the effect on the b-gal level was due to changes in the abundance of the cognate mRNA, we measured its levels by real-time RT-PCR The reporter mRNA abundance was found to be similar in cells transfected with different constructs (Fig 6D) and under different experimental conditions of cellular stress and recovery Thus, these results suggest that the presence of the PABP1 mRNA TOP or ARS sequences in the reporter construct did FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 559 PABP expression during heat shock recovery S Ma et al A B Fig Solubility of eIF4G and PABP1 in nonionic detergent (A) HeLa cells grown on coverslips were subjected to heat shock and recovery or maintained at 37 °C as described previously The cells were treated with 0.5% Triton X-100 containing buffer for on ice before fixation in methanol The detergent-treated specimens were immunostained with eIF4G and PABP1 antibodies, and viewed by confocal microscopy as described in the legend to Fig The localization pattern of eIF4G and PABP1 representing more than 90% of the cells are presented here These results were reproducible in three separate experiments (B) Cells were transfected with lg of PABPN1–GFP expression vector [28] as described in Experimental procedures At 36 h following transfection, the cells were either fixed directly or pretreated with 0.5% Triton X-100 for and viewed by confocal microscopy Representative images of more than 90% of the cells are shown not affect the transcription and ⁄ or the stability of the reporter mRNA Although we did not directly measure the translation of the reporter mRNA, on the basis of 560 the enhancement of PABP1 mRNA translation during recovery from heat shock (Fig 2), it can be deduced that the increase in b-gal expression in cells recovering FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al (1) β-gal CMV Transcription start site C β-gal (2) ARS-β-gal CMV Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during heat shock recovery 2.5 Con 0.5 TOP CMV-β-gal (4) TOP-ARS-β-gal B ARS β-gal Transfection D β-gal β-actin CMV-β-gal 1.00 1.06 1.00 0.98 1.00 0.95 1.00 1.02 1.00 0.97 1.02 1.06 1.00 1.07 1.03 1.02 1.00 0.74 2.25 2.10 1.00 1.21 1.10 0.68 1.98 2.04 1.00 1.01 1.01 HS TOP-β-gal re12 h Top-ARS-β-gal re24 h 1.2 0.8 0.6 0.4 1.07 ARS-β-gal 0.2 CMV-β-gal TOP-β-gal Top-ARS-βgal 1.4 ARS-β-gal 1.15 1.00 Relative β-gal mRNA level Transcription start site TOP Re24 h 1.5 5’-ccttctccccggcggttagtgctgagagtgc-3’ CMV HS Re12 h ARS-β-gal TOP-β-gal Top-ARS-β-gal Fig Characterization of the translational control element of PABP1 mRNA responsible for upregulation of its translation during recovery from heat shock (A) Reporter b-gal constructs with different PABP1 mRNA cis-elements were prepared as described in Experimental procedures The cytomegalovirus (CMV) promoter was used to drive b-gal expression; TOP, ARS and TOP + ARS sequences were placed within the 5¢-UTR of the b-gal gene, and the parental construct pCMV-SPORT–b-gal (Invitrogen) was used as a control The nucleotide sequences of the TOP and ARS cis control elements of the PABP1 mRNA are shown (B) Approximately · 105 HeLa cells were transfected with different CMV–b-gal expression vectors, and 48 h after transfection, cells were heat shocked at 44 °C for h and allowed to recover at 37 °C for 0, 12 and 24 h as described in Experimental procedures The control cells were not heat shocked, and were harvested after 48 h of transfection For mock transfection, cells were treated with the transfection reagent without any plasmid DNA The cellular level of b-gal was measured by western blotting and quantified by scanning images The abundance of b-actin was measured as a loading control The numbers at the bottom of each lane represent cellular abundance relative to the transfected control cells maintained at 37 °C, after adjusting for the loading control (C) The values of mean ± standard error (SE) of three independent experiments are shown here (D) Transfected cells were treated as described in (B), total cellular RNA was isolated, and the abundance of different mRNAs was measured by real-time RT-PCR as outlined in Experimental procedures The average of three independent experiments is shown from heat shock was due to enhancement of TOP-containing reporter mRNA translation Association of HSPs with eIF4G and PABP1 The association of HSP27 with eIF4G following heat shock has been previously described as a possible mechanism for repression of translation of normal cellular mRNA [22] Therefore, to extend our knowledge further, we expanded our investigation to examine the association of both eIF4G and PABP1 with the two predominant HSPs, such as HSP27 and HSP70, following heat shock, as well as during the recovery period We used both coimmunoprecipitation and immunofluorescence confocal microscopy to study the interaction between the polypeptides The results of coimmunoprecipitation studies (Fig 7A,B) show that the antibodies to both eIF4G and PABP1 immunoprecipitated HSP27 from extracts of heat-shocked and recovered cells A small amount of HSP27 was also detected in the immunoprecipitated samples of exponentially growing cells By analyzing the percentage of total cellular HSP27 found in the coimmunoprecipitated samples, we found that approximately 25–30% of cellular HSP27 was associated with eIF4G in both control and heat-shocked cells However, owing to the induction of HSP expression following heat shock, the total amount of eIF4G-bound HSP27 was increased almost two-fold (Fig 7A) As there was very little change in the cellular eIF4G level in heat-shocked cells, our results suggest that, due to the increased cellular abundance of HSP27, there was an overall FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 561 PABP expression during heat shock recovery A -HS HS S Ma et al Re12h Re24h D 50 HS Re12 h Re24 h 40 1.0 10 17 25 2.5 20 2.0 1.0 1.7 0.7 0.9 0.9 % of input HSP 27 30 0.8 HSP70 20 10 eIF4G 1.0 HSP27 B HSP70 E 50 HSP 27 (2.2) 1.0 1.3 HSP70 HS Re12 h Re24 h 40 (2.5) % of input (0.6) 30 20 10 PABP 1.0 0.7 1.9 1.8 HSP27 C HSP70 HSP 27 HSP70 Fig Coimmunoprecipitation of HSP27and HSP70 with PABP1 and eIF4G Cells were subjected to heat shock and recovery as described in the legend to Fig 1, and the cell lysates were subjected to immunoprecipitation with either the eIF4G antibody (A) or the PABP1 antibody (B) The presence of HSP27, HSP70 and eIF4G or PABP in the eluted fractions from the protein A–Sepharose beads were analyzed by western blotting as described in Experimental procedures The individual bands were quantified using an arbitrary scale as described in the legend to Fig (C) Mock immunoprecipitation was performed using 1.5 lg of preimmunized rabbit serum, and the eluted fractions from protein A–Sepharose beads were examined for the presence of HSP27 and HSP70 by western blotting as described previously (D, E) Equivalent cellular levels of total cell lysate and eluted fractions from the protein A–Sepharose beads following immunoprecipitation with either eIF4G (D) or PABP1 (E) were examined for the presence of HSP27 and HSP70 by western blotting Total cell lysate and eluted fractions were analyzed together in the same blot, and quantified as described above The averages of three independent experiments are shown increase in the association of HSP27 with eIF4G in these cells During recovery from heat shock, the percentage of input HSP27 present in the immunoprecipitated samples remained almost unchanged (Fig 7D) The association of PABP1 with HSP27 appeared to change more significantly in heat-shocked and recovered cells than what was observed for eIF4G Approximately 7% of cellular HSP27 was coimmunoprecipitated by PABP1 antibody from extracts of heatshocked cells When cells were allowed to recover for 12 and 24 h, approximately 25–30% of cellular HSP27 was found in the immunoprecipitated samples Therefore, it appears that the association of PABP1 with HSP27 depends on whether or not PABP1 is bound to eIF4G In contrast to HSP27, only a small but reproducible level of HSP70 was detected in all samples tested in these studies (Fig 7A,B) As judged by analyzing the percentage of input HSP70 found in the samples immunoprecipitated with both eIF4G and PABP1 antibody, the majority of HSP70 (90–95%) was not associated with either eIF4G or PABP1 (Fig 7D,E) As a negative control, we also examined the association of b-actin with eIF4G and PABP1 by using the respective antibody; as shown in Fig 3, immunoprecipitation of b-actin by either antibody was not detected in our 562 experiments To further examine the specificity of the antibodies, we used nonimmunized rabbit serum in mock immunoprecipitation experiments (Fig 7C) Neither HSP27 nor HSP70 was immunoprecipitated under our experimental conditions To further confirm the association between HSP27 and eIF4G and PABP1 in individual cells, we used in situ double immunofluorescence confocal microscopy As very little HSP70 was immunoprecipitated by either the eIF4G or the PABP1 antibody, we did not further study the colocalization of HSP70 with eIF4G or PABP1 by this approach As expected, the results (Fig 8) show induction and nuclear translocation of HSP27 following heat shock In heat-shocked cells, fractions of both eIF4G and PABP1 were colocalized with HSP27 in the nucleus However, as compared to eIF4G, a much lower level of colocalization between PABP1 and HSP27 was visible in heat-shocked cells As a fraction of the nuclear PABP1 was still associated with eIF4G (Fig 3), this observation can be explained if PABP1 does not bind HSP27 directly but associates with it through eIF4G During recovery from heat shock, within 12 h, eIF4G, PABP1 and most of the HSP27 were found in the cytoplasm In addition, both eIF4G and PABP1 remained colocalized with HSP27 FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al PABP expression during heat shock recovery A B Fig Cellular colocalization of HSP27 with eIF4G and PABP1 following heat shock and recovery Cells were immunostained with appropriate antibodies and viewed by laser scanning confocal microscopy as described in the legend to Fig HSP27 was labeled using Texas Redconjugated secondary antibody, and eIF4G and PABP1 were labeled with an appropriate FITC-labeled secondary antibody Similar results were observed after 24 h of recovery Although most of the eIF4G and PABP1 was detected with the HSP27, a significant fraction of the HSP27 was also localized independently This was expected, as HSP27 also functions as a chaperone to properly fold cellular polypeptides [18] FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 563 PABP expression during heat shock recovery S Ma et al Our results suggest that eIF4G could associate with HSP27 in the cell nucleus and translocate to the cytoplasm as a complex with HSP27 during recovery from heat shock This process perhaps facilitates refolding of eIF4G into its native form during recovery from heat shock We propose that PABP1 associates with HSP27 by virtue of its interaction with eIF4G As capped mRNAs are translated during recovery from heat shock, it is likely that the association of eIF4G with HSP27 may not be the sole basis for the reduced translation of capped mRNA in heat-shocked HeLa cells, and therefore these results differ from what was reported previously for H293T cells [22] Discussion Translational control of PABP1 expression during recovery from heat shock PABP1 is considered to be a genuine translation initiation factor [29], and its activity and expression level are controlled by a multitude of regulatory networks [13,14,23,25] As such, the PABP1 gene behaves like an early response gene Its expression level is modulated by growth and developmental changes [14,30] In our studies, we showed that PABP1 abundance is upregulated during recovery of HeLa cells from heat shock This upregulation occurs without a concomitant change in the cellular level of its polypeptide partner eIF4G Previous studies have shown that the expression level and activity of factors involved in mRNA translation, including initiation factors, elongation factors, and ribosomal proteins, increase whenever global mRNA is reactivated for translation [1,2,31] We believe that the change in PABP1 abundance during recovery from heat shock is related to the renewal of translation of normal cellular mRNAs during the recovery phase from a thermal stress In a previously published study [22], it was shown that the expression of eIF4G remained unchanged in heat-shocked cells However, the solubility of eIF4G and its association with PABP1 was reduced in heat-shocked cells In our studies, eIF4G behaved similarly in heat-shocked cells but, as we extended our experiments to examine changes during the recovery phase, we detected a specific change in the abundance of PABP1 This change in PABP1 abundance was mediated at the level of mRNA translation, as no increase in PABP1 mRNA level was observed during recovery We also showed here that in exponentially growing cells, only 30–40% of cellular PABP1 mRNA was translated, as judged by its distribution with the polysomal fraction As such, the PABP1 mRNA is translated less efficiently than 564 the control b-actin mRNA, which was present predominantly (90%) in the polysomal fraction However, during recovery from heat shock, the efficiency of PABP1 mRNA translation reached the same level as that of the b-actin mRNA Similar preferential enhancement of PABP1 mRNA translation was also observed during liver regeneration and growth stimulation of cells following serum starvation [14,30] Thus, it appears that a preferential increase of PABP1 mRNA translation occurs whenever there is a demand for an increase in global mRNA translation The increase in the cellular PABP1 level may act as a cue for cells to stimulate global mRNA translation The PABP1 mRNA is generally inefficiently translated under normal growth conditions through feedback inhibition mediated by binding of PABP1 to its own ARS cis-element [23] It is not known how the TOP overrides the inhibition by the ARS during recovery from heat shock However, a small reduction of PABP1 abundance after heat shock could conceivably relieve the feedback control, and enhance PABP1 mRNA translation through its TOP cis-element Association between PABP1 and eIF4G during heat shock and recovery The function of PABP1 in mRNA translation depends on its interaction with eIF4G Earlier, it was suggested that this interaction is inhibited by sequestration of eIF4G into insoluble granules in a complex with HSP27; as a result, cap-dependent mRNA translation of normal cellular mRNA is suppressed in heatshocked cells [22] We have shown here that as the cap-dependent translation resumes after cells are transferred to the physiological temperature, PABP1 and eIF4G interaction is re-established In situ localization studies of these two polypeptides also show a dramatic change in the subcellular location of both polypeptides after heat shock Both eIF4G and PABP1 were found predominantly in the nucleus of heat-shocked cells as nonionic detergent-insoluble granules, and significant amounts of these polypeptides were not colocalized in the nucleus However, both coimmunoprecipitation and immunofluorescence studies showed detectable association of PABP1 and eIF4G in the nucleus of heat-shocked cells This observation can be explained if these two polypeptides enter the nucleus as a complex that later dissociates The presence of colocalized PABP1 and eIF4G in the perinuclear space after a shorter heat shock period also supports this possibility After recovery, PABP1 and eIF4G were not detectable in the cell nucleus, and were colocalized in the cytoplasm These changes took place while a large amount FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al of HSP27 was present in cells and remained colocalized with eIF4G during the recovery period Therefore, our studies suggest that the presence of HSP27 and its association with eIF4G is not responsible for altering the solubility and subcellular location of eIF4G Thus, our results presented here are different from those of a previous study, where eIF4G was not found in the nucleus of H293T cells following heat shock at 44 °C for h However, even in this previous report, most of the eIF4G accumulated as granules near the perinuclear site, which we also observed during a somewhat shorter heat shock period The observed difference in the nuclear localization of eIF4G distribution between the two studies could be simply due to the use of different cell lines Cultured immortal cell lines may differ with respect to the time and temperature for the optimum stress response In our studies, we found that the nuclear localization of eIF4G and PABP1 was dependent on the length of exposure of cells as well as the temperature Therefore, under more stringent conditions, similar nuclear localization of those two polypeptides might also occur in H293T cells Under normal conditions, both PABP1 and eIF4G are predominantly localized in the cell cytoplasm; nevertheless, both polypeptides contain weak nuclear localization signals to facilitate nuclear entry under some circumstances [32,33] A small fraction of eIF4G has been previously shown to be present in the nuclear fraction, and to bind the cap-binding complex involved in splicing [34] It is believed that the nuclear eIF4G may associate with pre-mRNA through its interaction with the polypeptide partners of the cap-binding complex, such as CBP20 and CBP80, and accompany the mRNA to the cytoplasm, where partner switching occurs to form the eIF4F complex This process could conceivably couple mRNA translation with mRNA export [34] The possible mechanism of nuclear translocation of eIF4G in heat-shocked cells is uncertain, but it is possible that inhibition of cap-dependent translation after heat shock uncouples mRNA export and translation, and prevents the export of eIF4Gassociated mRNA from the nucleus, causing a nuclear build-up of this polypeptide A number of studies suggest that PABP1 also enters the nucleus and binds to the 3¢-poly(A) tract, and accompanies the mRNA to the cytoplasm [5,32] Thus, the nuclear accumulation of PABP1 in heat-shocked cells may result, at least in part, from uncoupling of translation and the export process after heat shock Interestingly, as significant amounts of nuclear PABP1 and eIF4G were not colocalized in heat-shocked cells in our experiments, it is likely that interaction between PABP1 and eIF4G occurs only in the cytoplasm Another related issue is PABP expression during heat shock recovery how the nuclear PABP1 and eIF4G exit the nucleus Whether or not a nuclear exit signal is present in PABP1 and eIF4G is not known Both polypeptides might help the mRNA to exit the nucleus, as the processing, transport and translation of normal cellular capped transcripts is resumed during recovery from heat shock Our studies have shown that the nuclear exit of both eIF4G and PABP1 occurs in the absence of new protein synthesis, and thus suggest that the pre-existing molecules can be exported to the cytoplasm Although the precise mechanism of this process is unknown, it is tempting to speculate that both polypeptides piggy-back the HSP27 as it translocates to the cytoplasm during the recovery period During the recovery period, we have also shown an increase in the association of PABP1 with eIF4G, and a concomitant increase in its phosphorylation during the recovery period Thus, it appears that the excess PABP1 produced during recovery is mostly utilized for mRNA translation Translational control elements of PABP1 mRNA The main function of the ARS element of PABP1 mRNA is to regulate the cellular PABP1 level under all circumstances [13] The TOP cis-element is involved in regulating PABP1 mRNA translation during growth stimulation [14] A number of mRNAs coding for factors involved in mRNA translation, such as ribosomal proteins and elongation factor eEF1a, contain a similar TOP element [14,15] It is believed that the presence of this common cis-element allows coordinated regulation of translation of mRNAs that participate in the same biochemical step, such as mRNA translation We have shown here that the TOP cis-element of PABP1 mRNA is involved in the upregulation of PABP1 mRNA translation during recovery from heat shock Previous studies have shown that translation of TOPcontaining mRNAs is stimulated during growth by changing the size of the polysomes [14] This could occur either by moving the 40S ribosomal subunit at a faster rate along the 5¢-UTR, or by increasing the rate of elongation However, these two mechanisms are not necessarily mutually exclusive We have previously shown that the presence of the ARS in the 5¢-UTR of an mRNA stalls the 40S ribosomal subunit before the ARS Therefore, the ARS-containing mRNA is arrested at the translation initiation step [13] As the TOP may increase the overall initiation rate during growth [14] and recovery from heat shock, more ribosomal subunits may be present at the 5¢-UTR at any given time; as a result of shear numbers, some of these ribosomes could escape the steric hindrance by the FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 565 PABP expression during heat shock recovery S Ma et al heterotrimeric complex of PABP1, IMP1 and UNR at the ARS [11] This will result in a shift of mRNA from the repressed nonpolysomal fraction to the translated polysomal fraction The precise mechanism by which the TOP promotes translation during growth stimulation is not clear Nevertheless, the P13 kinase and ⁄ or mTOR kinase pathways appear to be important for TOP function [31,35] In addition, whether or not one of the heat shock polypeptides, particularly the HSP70 or HSP27, which have been previously shown to bind mRNA [36,37], can bind to the TOP control element of the PABP1 mRNA and stimulate its translation remains to be investigated The TOP-mediated regulation of PABP1 mRNA translation is distinct from that mediated by the ARS The TOP appears to upregulate mRNA translation when the demand on the cellular translation machinery increases On the other hand, the ARS monitors and controls the overall cellular level of PABP1 and suppresses PABP1 mRNA translation through a feedback mechanism [13,23] In our studies, the stimulatory effect of the TOP on reporter mRNA translation was maintained even when the ARS was also present However, the overall cellular abundance of the reporter b-gal was less in cells transfected with both ARS- and TOP-containing construct than what was observed with the construct containing TOP alone This is in good agreement with previous observations that the ARS slows the rate of translation initiation of the endogenous PABP1 mRNA in the presence of the TOP control element [23] Association of HSPs with PABP1 and eIF4G during heat shock and recovery The HSPs function as molecular chaperones, and interact with many cellular proteins Previous studies have linked HSP27 with the eIF4G subunit of the eIF4F complex [22] Here we showed colocalization of HSP27 with both eIF4G and PABP1 in heat-shocked cells Following 24 h of recovery from heat shock, most of the HSP27 accumulated in the cytoplasm with eIF4G and PABP1, and possibly remained colocalized within a complex However, it is not known whether or not the HSP27-associated eIF4G participates in translation Thus, the previous observation regarding the sequestration of eIF4G by HSP27 may still explain, at least in part, the reduced cap-dependent translation of mRNA in heat-shocked cells [22] In our studies, we have shown that PABP1 also associates with HSP27, albeit at a much reduced level in heat-shocked cells than what was observed with eIF4G Perhaps HSP27 does not directly interact with PABP1 but was coimmunoprecipitated with the PABP1 antibody as a complex with eIF4G 566 Heat shock and translational control Cells respond to thermal stress by producing large amount of specific polypeptides (HSPs) designed to protect cellular proteins from stress-induced denaturation [17,18] Prior to the induction of HSPs, a multitude of changes take place that prepares the cell to synthesize HSPs while shutting down expression of normal cellular proteins This is achieved at least in part by preventing translation of normal cellular capped mRNAs [3] We have shown here that dissociation of PABP1 from the eIF4F complex and nuclear translocation of both PABP1 and eIF4G occur following heat shock, and suggest that sequestration of both PABP1 and eIF4G within the cell nucleus may be an important contributing factor in suppressing translation of normal cellular mRNA Our studies also show that during recovery, PABP1 and eIF4G functions are restored In addition, we propose that the observed increase in both PABP1 abundance and phosphorylation may be crucial in meeting the cellular demand to restore the normal level of translation during recovery from heat shock We have shown that the increase in PABP1 level was due to a preferential increase in TOP-mediated translation of PABP1 mRNA Collectively, our results show that a cascade of changes in the cellular translation machinery is involved in the suppression of translation in heat-shocked cells, and subsequent resumption of normal mRNA translation during recovery is accompanied by a preferential upregulation of PABP1 expression Experimental procedures Cell culture and heat shock treatment HeLa cells were grown at 37 °C in the DMEM supplemented with 10% fetal bovine serum for 2–3 days, until cells were fully spread and the desired degree of confluence was obtained Cells were subjected to heat shock at 44 °C for h, and incubated at 37 °C for 0, 12 and 24 h to allow them to recover The cells were washed and fixed for immunofluorescence analysis, or harvested for biochemical studies Transfection of cells Approximately 2–5 · 105 subconfluent HeLa cells grown on 35 mm dishes were transfected with lg of plasmid DNA using 10 lg of lipofectamine (Invitrogen, Burlington, Canada), according to protocols supplied by the manufacturer In short, the DNA was mixed with lipofectamine and FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al 100 lL of Opti-MEM (Invitrogen) for 30 before being added to the culture dish and incubated for h with an additional 0.9 mL of Opti-MEM After h, mL of growth medium containing 20% fetal bovine serum was added Following a total of 12 h of incubation, the medium was replaced with fresh DMEM containing 10% fetal bovine serum Cells were usually harvested after an additional 24–36 h of incubation at 37 °C Western blotting To prepare cell lysate, approximately · 105 cells were harvested into 150 lL of 2· Laemmli sample buffer (4% SDS, 20% glycerol, 120 mm Tris ⁄ HCl, pH 6.8, 200 mm dithiothreitol, and 0.1% bromophenol blue) and boiled for at 95 °C The level of expression of eIF4E, eIF4G, PABP1, HSP27 and HSP70 polypeptides was measured by immunoblot analysis as previously described [25] Cell lysates containing equal amounts of protein were separated by SDS ⁄ PAGE [38] The polypeptides were transferred to a nitrocellulose membrane and incubated with a primary antibody; this was followed by incubation with an appropriate horseradish peroxidase-conjugated secondary antibody The expression level of polypeptides was visualized by chemiluminescence using a Western lighting kit (Perkin Elmer, Boston, MA, USA), and quantified by scanning Antibodies for eIF4G, eIF4E, PABP1, HSP27, HSP70 and b-actin were obtained from Santa Cruz Biochemical (Santa Cruz, CA, USA) Coimmunoprecipitation Cells (1 · 106) were washed with NaCl ⁄ Pi three times, and harvested into 450 lL of chilled lysis buffer [50 mm Hepes ⁄ KOH, pH 7.4, 250 mm NaCl, 1% (v ⁄ v) NP-40, mm EDTA, 200 mL)1 aprotinin, 0.1 mm phenylmethanesulfonyl fluoride, and 10 lgỈmL)1 leupeptin] The cells were lysed by passing them through a 27G syringe The cell lysate was centrifuged at 5000 g for min, and the supernatant was used for analysis Immunoprecipitation was carried out by adding 1.5 lg of goat monoclonal antieIF4G or rabbit polyclonal PABP1 antibody (Santa Cruz) to the cell extract After overnight incubation at °C on a rotary mixer, 50 lL of protein A–Sepharose bead slurry (Amersham Biosciences, Piscataway, NJ, USA) was added, and the incubation was continued for h at °C After washing six times with mL of lysis buffer, resin-bound proteins were eluted from the beads by adding 30 lL of 2· Laemmli sample buffer (4% SDS, 20% glycerol, 120 mm Tris ⁄ HCl, pH 6.8, 200 mm dithiothreitol, and 0.1% bromophenol blue) and heating the mixture for at 95 °C The proteins were then resolved by 12% SDS ⁄ PAGE, and the presence of coimmunoprecipitated polypeptides was examined in the eluted samples by western blotting using the appropriate antibody PABP expression during heat shock recovery Immunofluorescence confocal microscopy HeLa cells plated on glass coverslips were used for examining the cellular localization of polypeptides by using immunofluorescence confocal microscopy Cells were washed with NaCl ⁄ Pi and fixed with methanol at )20 °C for 10 as described previously [28] The fixed cells were incubated with an appropriate antibody, and subsequently the specimens were treated with an appropriate secondary antibody conjugated with either fluorescein isothiocyanate (FITC) or Texas Red (Santa Cruz) Colocalization of two proteins was examined by simultaneously incubating the sample with primary antibodies against two different proteins, and then with two different FITC-labeled secondary antibodies at the same time The specimens were mounted in an NaCl ⁄ Pi buffer containing 70% glycerol (pH 7.5) for microscopy The localization of proteins was visualized and imaged with a Leica Microsystems Confocal Laser S Microscope (CLSM, Microsystems, Inc., Heidelberg, Germany) equipped with a Plan-Achromat 63· ⁄ NA1.4 objective In some experiments, cells were treated with a 0.5% Triton X100 containing buffer (0.5% Triton X-100, 10 mm Pipes,10 mm NaCl, 2.5 mm magnesium acetate, and 0.3 m sucrose) at 22 °C for before fixation to remove soluble proteins [31] Optical sections of representative cells were obtained by laser confocal fluorescence microscopy Two hundred cells in different fields of view were visualized, and representative images of the majority of cells were used for presentation Controls were performed by using nonimmunized serum FITC signals were obtained through a filter set with excitation at 488 nm (450–490 nm), a beam splitter of 510 nm, and an emission filter of > 520 nm (525–555 nm) Texas Red signals were detected through a filter set with excitation at 543 nm and emission at > 600 nm, and 63· objectives was used for all cells Images were recorded with a resolution of 512 · 512 pixels A series of optical slices that spanned the depth of the cell was obtained (normally eight slices, 0.5 lm apart) Other parameters were used with default settings In order to avoid cross-talk between FITC and Texas Red channels, the signals were scanned individually with one channel on and the other off The images for the same cells from two channels were merged with the overlap function To differentiate the autofluorescence, control cells without immunostaining were examined to set up the settings for the stained cells Measurement of mRNA levels Total cellular RNA was isolated using the High Pure RNA Isolation Kit (Roche Biochemical, Indianapolis, IN, USA) The quality and quantity of the RNA were determined by 1.5% agarose gel electrophoresis and spectrophotometry, respectively The levels of specific mRNAs, including PABP1, b-actin and b-gal, in the samples were determined either by quantitative real-time RT-PCR using FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 567 PABP expression during heat shock recovery S Ma et al Table Primers used for the real-time RT-PCR S, sense oligonucleotide; AS, antisense oligonucleotide mRNA Nucleotide sequence (5¢- to 3¢) GenBank ID Human b-actin (S) Human b-actin (AS) PABP1 (S) PABP1 (AS) b-gal (S) b-gal (AS) CTCTTCCAGCCTTCCTTCCT (780–799) BC013835 CACCTTCACCGTTCCAGTTT (963–982) GCACAGAAAGCTGTGGATG TTTGCGCTTAAGTTCCGTC (1341–1323) GCTGGATAACGACATTG (2435–2453) CAGCACCGCATCAGCAAG (2560–2577) a Rotor-gene 3000 (Corbett Research, NSW, Australia) or by RT-PCR An aliquot of total RNA (1 lg) was reverse transcribed at 42 °C for h in a total reaction volume of 25 lL using SuperScript II reverse transcriptase (Invitrogen, Burlington, Canada) and 150 ng of random primers After the reaction, lL of the cDNA sample was amplified by PCR in a total reaction volume of 25 lL, using the platinum SYBR green qPCR supermix-UDG kit (Invitrogen, Burlington, Canada) and 100 ng of primers specific for PABP1, b-actin and b-gal (Table 1) The amplification was performed using an initial denaturation step at 95 °C for min, followed by 40 cycles of denaturation at 95 °C for 20 s, annealing at 60 °C for 20 s and extension at 72 °C for 20 s Specificity of the PCR product was examined after the final cycle by generating a melting curve with a heating rate of °CỈs)1 between 72 and 99 °C The data were analyzed using Rotor-gene 3000 software and the 2)DDCt method [39] The relative expression values of all mRNAs were normalized by the b-actin mRNA level Reaction conditions for the RT-PCR were similar to those used for the real-time RT-PCR, except that each sample was analyzed at a different cycle number to remain within the linear range of amplification In all samples, this was found to be 20–25 cycles, depending on the cellular level of the individual mRNA Subcellular fractionation of polysomes and RNA isolation Samples corresponding to equal numbers of cells were used for analysis The cells were lysed in 200 lL of polysomal buffer (10 mm Mops, pH 7.2, 250 mm NaCl, 2.5 mm MgOAc, 0.5% Nonidet P-40, 0.1 mm phenylmethanesulfonyl fluoride, 200 lgỈmL)1 heparin, and 50 lgỈmL)1 cycloheximide) [23] After removal of the nuclei and cell debris by centrifugation at 12 000 g for 10 min, the supernatant fraction was centrifuged in a 12 mL 10–50% sucrose gradient, containing 25 mm Hepes (pH 7.0), 50 mm KCl, mm MgOAc, 50 lgỈmL)1 cycloheximide and 15 mm 2-mercaptoethanol at 100 000 g in a Beckman SW 41Ti rotor for h as previously described [23] Gradient fractions of approximately mL each were collected using an Auto Densi-Flow IIC apparatus (Buchler Instruments, Fort 568 NM_002568 U02451 Lee, NJ, USA) Total RNA from each fraction was isolated using the Triazole RNA isolation kit as described by the manufacturer (Roche), and precipitated with ethanol using lg of yeast tRNA as a carrier Plasmid construction A reporter b-gal construct containing the ARS region (nucleotides 71–131) of human PABP1 (GeneBank ID: Y00345) was generated by ligating double-stranded oligodeoxynucleotides with BamHI and NheI sticky ends into the site between BamHI and NheI of the pCMV-Sport–b-gal plasmid vector To generate the TOP–b-gal construct, the TOP region (nucleotides 1–31) of human PABP1 was inserted into the transcription start site of pCMV-Sport– b-gal by using a megaprimer-based method [40] A megaprimer was produced by PCR with primer containing an EcoRI site and primer (primer sequences are listed in Table 2) The PCR product was used as the megaprimer, and treated with exonuclease I to digest the remaining single-stranded primers The megaprimer was used as the upstream primer to amplify another region of the vector by PCR using primer carrying an NcoI site The final amplified fragment was gel purified and cloned into the site between EcoRI and NcoI in the pCMV-Sport–b-gal vector To construct the TOP–ARS–b-gal expression vector, sense ARS and antisense ARS oligomers with extra unrelated sequences were annealed to produce a double-stranded ARS oligodeoxynucleotide, and digested with PstI and SalI to produce sticky ends This double-stranded ARS was inserted at the PstI and SalI sites of our TOP–b-gal construct The restriction enzymes used in cloning were purchased from MBI Fermentas (Amherst, NY, USA), and the parent pCMV-Sport–b-gal was obtained from Invitrogen Two-dimensional gel electrophoresis Cellular proteins were analyzed by two-dimensional gel electrophoresis using immobilized pH 6–11 IEF dry strips as previously described [25] Sample preparation and electrophoresis conditions were according to the procedure provided by the supplier of the immobilized strips (Amersham Biosciences) FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS S Ma et al PABP expression during heat shock recovery Table Primers and sequences for cloning TOP–b-gal and TOP–ARS–b-gal Upper and lower case letters represent vector and PABP sequences respectively The Restriction enzymes’ recognition sequences are shown in italic Primer name Primer sequence (5¢- to 3¢) Primer with EcoRI site Primer containing TOP GACCCGGGAATTCCGGACCGG (nucleotides 4222–4242 of PCMV-Sport–b-gal plasmid) AAGCAGAGCTCGTTTAGTGAACCGCcttctccccggcggttagtgctgagagtgcTCAGATCG CCTGGAGACGCC (nucleotides 4403–4380 of PCMV-Sport–b-gal + TOP + nucleotides 4379–4360 of PCMV-Sport–b-gal plasmid) CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was supported by funds from a discovery grant from the Natural Science and engineering Research council (NSERC) of Canada References Gebauer F & Hentze MW (2004) Molecular mechanisms of translational control Nat Rev Mol Cell Biol 5, 827–835 Mendez R & Richter JD (2001) Translational control by CPEB: a means to the end Nat Rev Mol Cell Biol 2, 521–529 Panniers R (1994) Translational control during heat shock Biochimie 76, 737–747 Gorlach M, Burd CG & Dreyfuss G (1994) The mRNA poly (A)-binding protein: localization, abundance and RNA-binding specificity Exp Cell Res 211, 400–407 Afonina E, Stauber R & Pavlakis GN (1998) The human poly (A)-binding protein shuttles between the nucleus and the cytoplasm J Biol Chem 271, 13015–13024 Uchida N, Hoshino S, Imataka H, Sonenberg N & Katada T (2002) A novel role of the mammalian GSPT ⁄ eRF3 associating with poly(A)-binding protein in cap ⁄ poly(A)-dependent translation J Biol Chem 277, 50286–50292 Sagliocco F, Laloo B & Cosson B (2006) The ARE-associated factor AUF1 binds poly (A) in vitro in competition with PABP1 Biochem J 400, 337–347 Kozlov G, Crescenzo GD, Lim NS, Siddiqui N, Fantus D, Kahvejian A, Trempe JF, Elias D, Ekiel I, O’Connor-McCourt N et al (2004) Structural basis of ligand recognition by PABC, a highly specific peptidebinding domain found in poly(A)-binding protein and a HECT ubiquitin ligase EMBO J 23, 272–281 Craig A (1998) Interaction of polyadenylate-binding protein with the elF4G homologue PAIP enhances translation Nature 392, 520–529 10 Khaleghpour K, Kahvejian A, Crescenzo GD, Roy G, Svitkin YV, Imataka H, O’Connor-McCourt M & Sonenberg N (2001) Dual interactions of the translational repressor Paip2 with poly (A) binding protein Mol Cell Biol 21, 5200–5213 11 Patel GP & Bag J (2006) IMP1 interacts with poly(A)binding protein (PABP1) and the autoregulatory translational control element of PABP1-mRNA through the KH III–IV domain FEBS J 273, 5678–5690 12 Parker R & Song H (2004) The enzymes and control of mRNA turnover Nat Struct Mol Biol 11, 121–127 13 Bag J (2001) Feedback inhibition of poly (A)-binding protein mRNA translation: a possible mechanism of translation arrest by stalled 40 S ribosomal subunits J Biol Chem 276, 47352–47360 14 Hornstein E, Git A, Braunstein I, Avni D & Meyuhas O (1999) The expression of poly(A)-binding protein gene is translationally regulated in a growth-dependent fashion through a 5¢-terminal oligopyrimidine tract motif J Biol Chem 274, 1708–1714 15 Meyuhas O (2000) Synthesis of the translational apparatus is regulated at the translational level Eur J Biochem 267, 6321–6330 16 Mangus DA, Evans MC & Jacobson A (2003) Poly(A)binding proteins: multifunctional scaffolds for the posttranscriptional control of gene expression Genome Biol 24, 223, doi:10.1186/gb-2003-4-7-223 17 Santoro MG (2002) Heat shock factors and the control of stress response in inflammation Biochem Pharmacol 59, 55–63 18 Nollen E & Morimoto RI (2002) Chaperoning signaling pathways: molecular chaperones as stress-sensing ‘heat shock’ proteins J Cell Sci 115, 2809–2816 19 Trinklein ND, Murray JI, Hartman SJ, Botstein D & Myers RM (2004) The role of heat shock transcription factor in the genome-wide regulation of the mammalian heat shock response Mol Cell Biol 15, 254–1261 20 Sierra JM & Zapata JM (1994) Translational regulation of the heat shock response Mol Biol Rep 19, 211–220 FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS 569 PABP expression during heat shock recovery S Ma et al 21 Han B & Zhang JT (2002) Regulation of gene expression by internal ribosome entry sites or cryptic promoters: the eIF4G story Mol Cell Biol 22, 7372–7384 22 Cuesta R, Laroia G & Schneider RJ (2000) Chaperone hsp27 inhibits translation during heat shock by binding eIF4G and facilitating dissociation of cap-initiation complexes Genes Dev 14, 1460–1470 23 Wu J & Bag J (1998) Negative control of the poly (A)binding protein mRNA translation is mediated by the adenine-rich region of its 5¢-untranslated region J Biol Chem 273, 34535–34542 24 Le H, Browning KS & Gallie DR (2000) The phosphorylation state of poly (A)-binding protein specifies its binding to poly(A) RNA and its interaction with eukaryotic initiation factor (eIF) 4F, eIFiso4F, and eIF4B J Biol Chem 275, 17452–17462 25 Ma S, Musa T & Bag J (2006) Reduced stability of mitogen-activated protein kinase kinase-2 mRNA and phosphorylation of poly (A)-binding protein (PABP1) in cells overexpressing PABP1 J Biol Chem 281, 3145–3156 26 Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE, Pitts WJ, Earl RA, Hobbs F et al (1998) Identification of a novel inhibitor of mitogen-activated protein kinase kinase J Biol Chem 273, 18623–18632 27 Cheng S & Gallie DR (2007) eIF4G, eIFiso4G, and eIF4B bind the poly(A)-binding protein through overlapping sites within the RNA recognition motif domains J Biol Chem 282, 25247–25258 28 Wang Q, Mosser DD & Bag J (2005) Induction of HSP70 expression and recruitment of HSC70 and HSP70 in the nucleus reduce aggregation of a polyalanine expansion mutant of PABP1N1 in HeLa cells Hum Mol Genet 14, 3673–3684 29 Kahvejian A, Svitkin YV, Sukarieh R, M’Boutchou MN & Sonenberg N (2005) Mammalian poly (A)-binding protein is a eukaryotic translation initiation factor, which acts via multiple mechanisms Genes Dev 19, 104–113 30 Berger L, Bag J & Sells BH (1992) Translation of poly (A)-binding protein mRNA is regulated by growth conditions Biochem Cell Biol 70, 770–778 31 Stolovich M, Tang H, Hornstein E, Levy G, Cohen R, Bae SS, Birnbaum MJ & Meyuhas O (2002) Transduction of growth or mitogenic signals into translational activation of TOP mRNAs is fully reliant on the phosphatidylinositol 3-kinase-mediated pathway but requires neither S6K1 nor rpS6 phosphorylation Mol Cell Biol 22, 8101–8113 32 Brune C, Munchel SE, Fischer N, Podtelejnikov AV & Weis K (2005) Yeast poly (A)-binding protein Pab1 shuttles between the nucleus and the cytoplasm and functions in mRNA Export RNA 11, 517–531 570 33 Coldwell MJ, Hashemzadeh-Bonehi L, Hinton TM, Morley SJ & Pain VM (2004) Expression of fragments of translation initiation factor eIF4GI reveals a nuclear localisation signal within the N-terminal apoptotic cleavage fragment N-FAG J Cell Sci 171, 2545–2555 34 McKendrick L, Thompson E, Ferreira J, Morley SJ & Lewis JD (2001) Interaction of eukaryotic translation initiation factor 4G with the nuclear cap-binding complex provides a link between nuclear and cytoplasmic functions of the m(7) guanosine cap Mol Cell Biol 21, 3632–3641 35 Robert E & Dagger R (1999) Signal transduction pathways that regulate eukaryotic protein synthesis J Biol Chem 274, 30337–30347 36 Wilson GM, Sutphen K, Bolikal S, Chuang KY & Brewer G (2001) Thermodynamics and kinetics of Hsp70 association with A + U-rich mRNAdestabilizing sequences J Biol Chem 276, 44450–44456 37 Shchors K, Yehiely F, Kular RK, Kotlo KU, Brewer G & Deiss LP (2002) Cell death inhibiting RNA (CDIR) derived from a 3¢-untranslated region binds AUF1 and heat shock protein 27 J Biol Chem 277, 47061–47072 38 Dreyfuss G, Adam SA & Choi YD (1984) Physical change in cytoplasmic messenger ribonucleoproteins in cells treated with inhibitors of mRNA transcription Mol Cell Biol 4, 415–423 39 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method Methods 25, 402– 408 40 Tyagi R, Lai R & Duggleby RG (2004) A new approach to ‘megaprimer’ polymerase chain reaction mutagenesis without an intermediate gel purification step BMC Biotechnol 4, 2, doi:10.1186/1472-6750-4-2 Supporting information The following supplementary material is available: Fig S1 Dose response of western blotting HeLa cells were lysed in gel sample buffer as described in Experimental procedures and the indicated volume of cell lysate was used for western blotting using PABP, HSP70 and beta-actin antibodies to examine the linear response of the detection technique This supplementary material can be found in the online version of this article Please note: Wiley-Blackwell is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 276 (2009) 552–570 ª 2008 The Authors Journal compilation ª 2008 FEBS ... polysomal distribution profile of the b-actin mRNA in cells during the recovery from heat shock appeared to be similar to what was observed in the exponentially growing cells PABP expression during heat. .. expression of PABP1 during the phase of recovery from heat shock may be necessary to meet the cellular demand for protein synthesis for complete recovery from stress Results PABP1 expression during recovery. .. abundance of both polypeptides in heat- shocked cells During the recovery period from heat shock, as compared to the non -heat- shocked control cells, almost a three-fold increase in the association of