Báo cáo khoa học: Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions docx

Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions Veronica Bergan, Silje Steinsvik, Hao Xu, Øyvind Kileng and Børre Robertsen Department of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromsø, Norway Keywords Atlantic salmon; interferon promoter; interferon regulatory factor; nuclear factor kappa B (NFjB); poly(I:C) Correspondence B Robertsen, Department of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromsø, N-9037 Tromsø, Norway Fax: +47 776 45110 Tel: +47 776 44487 E-mail: borre.robertsen@nfh.uit.no (Received 24 April 2006, revised June 2006, accepted 15 June 2006) doi:10.1111/j.1742-4658.2006.05382.x Recognition of viral nucleic acids by vertebrate host cells results in the synthesis and secretion of type I interferons (IFN-a ⁄ b), which induce an antiviral state in neighboring cells We have cloned the genes and promoters of two type I IFNs from Atlantic salmon Both genes have the potential to encode IFN transcripts with either a short or a long 5¢-untranslated region, apparently controlled by two distinct promoter regions, PR-I and PR-II, respectively PR-I is located within 116 nucleotides upstream of the short transcript and contains a TATA-box, two interferon regulatory factor (IRF)-binding motifs, and a putative nuclear factor kappa B (NFjB)-binding motif PR-II is located 469–677 nucleotides upstream of the short transcript and contains three or four IRF-binding motifs and a putative ATF-2 ⁄ c-Jun element Complete and truncated versions of the promoters were cloned in front of a luciferase reporter gene and analyzed for promoter activity in salmonid cells Constructs containing PR-I were highly induced after treatment with the dsRNA poly(I:C), and promoter activity appeared to be dependent on NFjB In contrast, constructs containing exclusively PR-II showed poor poly(I:C)-inducible activity PR-I is thus the main control region for IFN-a ⁄ b synthesis in salmon Two pathogenic RNA viruses, infectious pancreatic necrosis virus and infectious salmon anemia virus, were tested for their ability to stimulate the minimal PR-I, but only the latter was able to induce promoter activity The established IFN promoter-luciferase assay will be useful in studies of host–virus interactions in Atlantic salmon, as many viruses are known to encode proteins that prevent IFN synthesis by inhibition of promoter activation The type I interferon (IFN) system plays a critical role in the innate immune defense against viruses in vertebrates Virus-infected cells synthesize and secrete type I interferons (IFN-a ⁄ b), which circulate in the body and protect other cells from viral infection The antiviral action is caused by binding of IFN-a ⁄ b to the type I IFN receptor resulting in activation of transcription of several hundred IFN-stimulated genes, some of which encode proteins that inhibit viral replication The antiviral properties of at least three type I IFN- induced proteins are well established These comprise dsRNA-activated protein kinase R (PKR), 2¢,5¢-oligoadenylate synthetase and Mx proteins [1] Although the structures of the IFN-a and IFN-b promoters from human and mouse have been long known, the mechanisms involved in viral induction of type I IFNs have only recently been uncovered [2,3] Of great importance has been the discovery of IFN super-producing blood cells called plasmacytoid dendritic cells (pDCs) and the realization that the Abbreviations 2-AP, 2-aminopurine; EMEM, Eagle’s minimal essential medium; IFN, interferon; IPNV, infectious pancreatic necrosis virus; IRF, interferon regulatory factor; IRF-E, interferon regulatory factor binding element; ISAV, infectious salmon anemia virus; LPS, lipopolysaccharide; NFjB, nuclear factor kappa B; pDCs, plasmacytoid dendritic cells; PDTC, pyrrolidine dithiocarbamate; poly(I:C), polyinosinic polycytidylic acid; PKR, dsRNA-activated protein kinase; PR, promoter region; PRD, positive regulatory domain; TLR, toll-like receptor FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS 3893 Atlantic salmon interferon promoter V Bergan et al mechanism of virus-mediated induction of IFNs is different in pDCs and other body cells [4,5] Most nucleated cells of the body produce IFN-a ⁄ b in response to recognition of dsRNA intermediates produced during viral replication The main sensors of dsRNA are two intracellular RNA helicases (RIG-I and MDA5) [6–9], which, on binding of dsRNA, interact with the mitochondrial protein MAVS (also called IPS-1) [10,11] This interaction leads to transcriptional induction of the IFN-b gene through the co-ordinated activation of the transcription factors interferon regulatory factor (IRF-3), nuclear factor kappa B (NFjB) and ATF2 ⁄ c-Jun heterodimer [2] Infected cells secrete mainly IFN-b in the initial phase of infection, but switch to IFN-a as a result of induction of IRF-7 synthesis during the subsequent amplification phase of the IFN response [12,13] pDCs are specialized IFN producers and represent a major source of IFN-a in humans through activation of IRF-7 [14] In pDCs, the main sensors of viral infection are Toll-like receptors (TLRs) expressed on the surface or in endosomes that recognize viral RNA or DNA Human pDCs mostly express TLRs, which recognize ssRNA (TLR7 and TLR8) or dsCpG-rich DNA (TLR9) [15] Recognition of viral nucleic acids by TLRs activates IRF-7, which transcriptionally activates multiple IFN-a genes [16,17] A major difference between pDCs and other cell types is their capacity to constitutively produce relatively high concentrations of IRF-7 [18] Virus-induced expression of IFN-a and IFN-b genes is mediated by regulatory sequences located within 200 bp upstream of the transcription start site of their promoters [19] The IFN-b promoter contains four positive regulatory domains (PRDs), which bind IRFs: mainly IRF-3 and IRF-7 (PRDI and PRDIII), NFjB (PRDII) and ATF-2 ⁄ c-Jun (PRDIV) [20] The promoters of IFN-a genes all contain DNA elements binding IRF members, notably IRF-3, IRF-5 and IRF-7, but they not contain NFjB or ATF-2 ⁄ c-Jun binding sites [21] In mammals and birds, IFN-a ⁄ b genes are encoded by intron-lacking genes whereas IFN-k genes possess a 4-intron ⁄ 5-exon structure [22,23] Recently, type I IFN genes of teleost fish were shown to possess a gene structure similar to IFN-k genes, although their protein sequences are more similar to IFN-a than IFN-k [24–28] At present, little is known about the regulation of fish IFN genes, although the promoter of the zebrafish type I IFN gene was recently reported to contain one IRF-binding site and one NFjB-binding site [28] The present work shows that type I IFN genes of Atlantic salmon show a rather unique organization of the promoter in comparison with mammals, 3894 birds and zebrafish Atlantic salmon stimulated with the dsRNA polyinosinic polycytidylic acid [poly(I:C)] produces an IFN transcript with a short 5¢-UTR called SasaIFN-a1, and another IFN transcript with a long 5¢-UTR called SasaIFN-a2 In this work, we cloned two different Atlantic salmon IFN genes from genomic DNA that encode putative transcripts similar in sequence to SasaIFN-a1 and SasaIFN-a2 Surprisingly both genes apparently have the potential to produce both a short and long transcript because of the location of two separate promoter regions, one of which is present in the 5¢-UTR of the long transcript To perform functional analysis of the Atlantic salmon IFN promoter region, we fused the complete and truncated versions of the promoter region to a luciferase reporter gene and transfected it into Chinook salmon embryo (CHSE-214) or Atlantic salmon head kidney TO cells Promoter activity was measured after stimulation with poly(I:C) or virus infection Results Cloning of full-length type I IFN genes from genomic DNA A genome walking approach was used to clone a 1281nucleotide sequence upstream of the SasaIFN-a1 transcription start site This allowed design of primers that amplified genomic IFN sequences that expanded from )1281 of the promoter region (PR) to the polyA signal by PCR Two full-length IFN genes, designated SasaIFN-A1 (A1 for short) and SasaIFN-A2 (A2), were identified in two different BAC clones (GenBank accession nos DQ354152 and DQ354153) A summary of nucleotide data on the A1 and A2 gene is shown in Table Both genes possessed the five-exon ⁄ four-intron structure found previously in fish type I IFN genes, although the intron sizes were somewhat different from those originally found in DNA from Atlantic salmon [26] The joined exon sequences of A1 and SasaIFN-a1 cDNA are completely identical, and the joined exon sequences of A2 and SasaIFN-a2 cDNA have only three nucleotide differences, possibly because they represent different alleles (Table 2) In contrast, A1 diverges from SasaIFN-a2, with 10 mismatches, and A2 and SasaIFN-a1 diverge by 12 mismatches This strongly suggests that A1 encodes the SasaIFN-a1 transcript and A2 the SasaIFN-a2 transcript Overall differences in A1 and A2, including differences in promoter and intron regions (deletions, insertions and substitutions), confirm that they represent two different genes rather than allele variants (Table 1) Two pseudogenes were also identified in the screening of BAC FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS V Bergan et al Atlantic salmon interferon promoter Table Comparison of the Atlantic salmon genomic A1 and A2 IFN sequences Number of nucleotides Sequence compared with SasaIFN-a1 A1 A2 Differences Upstream region 5¢-UTR Exon Intron Exon Intron Exon Intron Exon Intron Exon 3¢-UTR 1281 34 135 294 75 130 150 1999 78 338 90 46b 1141 34a 135 294 75 130 150 2136 78 331 90 236 206 3 52 12 a Putative 5¢-UTR of A2 was 501 nucleotides based on similarities to SasaIFN-a2, but for comparison reasons the 5¢-UTR of A1 and A2 was set to the same b Only partial 3¢-UTR of A1 was cloned and compared Table Comparison of salmon IFN exon sequences to verify linkage between genomic and cDNA clones Percentage similarity is shown in the upper triangle, and number of nucleotide differences in the lower triangle The most likely match is highlighted Pairwise percentage identity SasaIFN-a1 SasaIFN-a2 Genomic A1 Genomic A2 Nucleotide differences SasaIFN-a1 SasaIFN-a2 10 Genomic A1 Genomic A2 12 98.2 10 100.0 98.2 98.0 99.5 98.0 12 clones, one having a premature stop codon (accession no DQ354154) and one that appeared to be interrupted by a transposase gene (accession no DQ354155) The pseudogenes were not investigated any further in this work Analysis of the promoter regions The alignment of the 765-bp sequence regions upstream of the ORFs are very similar in the two genes except for 10 nucleotide substitutions and two insertions ⁄ deletions (Fig 1) This was surprising because SasaIFN-a1 was originally identified as a short transcript (829 nucleotides) and SasaIFN-a2 as a long transcript (1290 nucleotides) We thus expected that the A1 gene would encode a short transcript and A2 a long transcript The present data indicate, however, that both genes have the potential to encode both transcripts A total of six (in A1) or seven (in A2) IRF-binding elements (IRF-E) were identified in the 765-nucleotide region upstream of the putative transcription start site of SasaIFN-a1 (Fig 1) The motifs conform to the GAAA(G/C)GAAA(T/C) consensus sequence [29] and were located at positions )63, )116, )376, )503, )545, )639, and )669 relative to the putative SasaIFN-a1 transcription start site Interestingly, the IRF-E sequences at positions )116 and )545 were identical and probably bind the same IRF(s) In addition, we found two potential NFjB-binding sites, one in close proximity to the SasaIFN-a1 transcriptional start site ()80) and one more distant ()720) that appeared to be truncated in the A2 promoter An ATF-2 ⁄ c-Jun element, which is essential for activity of the human IFN-b promoter, was found in the distal promoter region in close proximity to the IRF-E at position )557 Moreover, an atypical TATA-box was located at position )42 in both genes, and two CCAAT-boxes at positions )296 and )579 in the A1 gene In summary, both genes appear to possess two major regulatory regions: (a) promoter region I (PR-I) located within 116 nucleotides upstream of the short transcript, containing a noncanonical TATA-box, two IRF-binding motifs and a putative NFjB-binding motif; (b) promoter region II (PR-II), located 469–677 nucleotides upstream of the short transcript, containing three to four IRF-binding motifs and an ATF-2 ⁄ c-Jun element The putative salmon IFN promoters thus seem to have a unique feature, as PR-I controls the synthesis of a transcript with a short 5¢-UTR and PR-II controls the synthesis of a transcript with a long 5¢-UTR Accordingly, the 5¢-UTR of the long transcript in fact contains PR-I Activity of the A1 and A2 promoters on poly(I:C) induction To study the activity of the promoters, we cloned full-length and deleted versions of the promoters in front of a promoterless luciferase reporter gene (Fig 2A) From the A1 gene the following constructs were made: pA1()135), pA1()202) and pA1()333) containing only PR-I; and pA1()747) and pA1()1281) containing both PR-I and PR-II From the A2 gene, the construct pA2()275) containing only PR-II was made The constructs were transfected into CHSE-214 cells or Atlantic salmon TO cells along with a constitutively expressed b-gal standard (pJatLacZ) and then stimulated with poly(I:C) to induce IFN FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS 3895 Atlantic salmon interferon promoter V Bergan et al Fig Promoter regions of SasaIFN-a1 (A1) and SasaIFN-a2 (A2) genes Potential transcription factor binding sites and translation start codon are boxed The two putative transcription start sites are indicated by bent arrows Bold lowercase letters or dashes indicate nucleotides in A2 which are different from A1 IRF-core binding motifs that match the GAAANN consensus are highlighted with bold letters Putative promoter regions (PR-I and PR-II) are shaded in grey promoter activity Figure shows the luciferase activity from the different constructs relative to b-gal measurements for poly(I:C)-stimulated or untreated CHSE-214 (Fig 2B) or TO cells (Fig 2C) All constructs were induced by poly(I:C) in both cell types The overall higher promoter activity observed in CHSE-214 cells compared with TO cells is probably due to the fact that poly(I:C) was transfected into CHSE-214 cells, whereas it was applied extracellularly to TO cells In CHSE-214 cells, the level of induction was highest for pA1()1281), pA1()747) and pA1()202), and lowest for pA2()275) This indicates that PR-I is most important for poly(I:C) induction in these cells In TO cells, all constructs showed similar levels of relative luciferase activity after stimulation with poly(I:C) The main difference from CHSE-214 cells was that pA1()1281), pA1()747) and pA2()275) all showed relatively high basal luciferase activity Accordingly, the level of induction was highest for pA1()333), pA1()202) and 3896 pA1()135) The minimal promoter showing highest inducibility in TO cells was thus pA1()135), containing only PR-I The highly inducible minimal promoter construct, pA1()202), and the full-length construct, pA1()1281), were next compared for poly(I:C) induction in a time course study in CHSE-214 and TO cells (Fig 3) In CHSE-214 cells, both promoter constructs were hardly induced at all at 12 h, but showed increasing luciferase activity at 24 h and 48 h after poly(I:C) treatment (Fig 3) At 48 h, the minimal IFN promoter was induced more than 50-fold, whereas the full-length promoter was induced only 13-fold (Fig 3A) The minimal promoter construct showed similar time kinetics in TO cells, whereas the pA1()1281) construct showed hardly any induction at any of the time points (Fig 3B) A dose–response curve for poly(I:C) induction of the minimal promoter construct was established As little as 50 ngỈmL)1 was sufficient to induce the FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS V Bergan et al Atlantic salmon interferon promoter Fig Analysis of IFN promoter activity in CHSE-214 and TO cells (A) Salmon IFN promoter–luciferase constructs including the positions of IRF-E, NFjB, and ATF-2 ⁄ c-Jun sites relative to the transcription start site (+1) pA1 constructs are from the putative SasaIFN-a1 promoter, and pA2 is the putative SasaIFN-a2 promoter (B) CHSE-214 or (C) TO cells were transiently transfected with the promoter constructs plus a b-gal internal control vector in 24-well plates At 24 h after transfection, triplicate wells of cells were treated with lgỈmL)1 poly(I:C) (and Fugene) or left untreated Luciferase and b-gal activities were measured 48 h after the stimulus using the dual-light luciferase kit Luciferase activity is expressed relative to b-gal (mean ± SD from three wells) A -1.281 kb Luc Luc Luc Luc Luc Luc A Luc I RF - E NFκB CHSE cells 70 60 ATF-2/c-Jun Fold Induction 50 B pA 1(-1 2k b) pA 1(-747) 40 12 h 24 h 30 48 h 20 10 pA 1(-333) pGL3basic pA 1(-202) B pA 1(-135) pA1(-202) pA1(1.2) TO cells 18 16 pA 2(-275) P oly I: C pG L 3b as i c 14 0 1 5 Relative luciferase activity (luc/β-gal) Fold Induction Unt reat ed 12 10 12 h 24 h 48 h C pA1(-1,2kb) pA1(-747) pGL3basic pA1(-333) pA1(-202) pA1(-135) pA2(-275) Poly I:C pGL3basic Untreated Relative luciferase activity (luc/β-gal) promoter significantly (14-fold), and 500 ngỈmL)1 poly(I:C) was sufficient to give maximal induction (50-fold) of the promoter (Fig 4) pA1(-202) pA1(1.2) Fig Induction of the minimal IFN promoter ()202) and the fulllength IFN promoter region ()1.2kb) over time in (A) CHSE-214 and (B) TO cells Reporter vectors: pGL3basic; absent promoter, pA1()202); minimal IFN promoter, pA1()1.2kb); full-length IFN upstream region Cells were transiently transfected with the reporter constructs plus a b-gal internal control vector in 24-well plates At 24 h after transfection, triplicate wells of cells were treated with lgỈmL)1 poly(I:C) (and Fugene) or left untreated (control) Luciferase and b-gal activities were measured 12, 24 and 48 h after the stimulus using the dual-light luciferase kit Fold induction is luciferase activity expressed relative to b-gal of poly(I:C)-treated cells divided by nontreated control cells (mean ± SD from three wells) The optimal conditions to study the salmon interferon promoter were to use CHSE-214 cells and transfect them with the minimal promoter construct, FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS 3897 Atlantic salmon interferon promoter V Bergan et al 80 35 70 30 Fold Induction Fold Induction 60 50 40 30 20 20 15 10 10 0 1000 500 100 50 ng/ml Poly(I:C) 10 Fig Dose–response of poly(I:C) induction on the minimal IFN promoter ()202) CHSE-214 cells were transiently transfected with the pA1()202) construct plus a b-gal internal control vector in 24 well plates At 24 h after transfection, triplicate wells of cells were treated with different concentrations (5000–0 ngỈmL)1) of poly(I:C) (and Fugene) or left untreated Luciferase and b-gal activities were measured 48 h after the stimulus using the dual-light luciferase kit Fold induction is luciferase activity expressed relative to b-gal of poly(I:C)-treated cells divided by nontreated control cells (mean ± SD from three wells) pA1()202), trigger the promoter with at least 500 ngỈmL)1 poly(I:C) (complexed with the Fugene transfection reagent), and read the luciferase values at 48 h after poly(I:C) treatment Effect of LPS and virus infection on the salmon IFN promoter As the salmon IFN promoter contained a putative NFjB-binding motif, we wanted to test if lipopolysaccharide (LPS) was able to induce the IFN promoter However, 50 lgỈmL)1 LPS did not increase luciferase activity from the minimal IFN promoter in neither CHSE-214 (Fig 5) or TO (not shown) cells The cells were also treated with poly(dG:dC) (complexed to Fugene), to study whether dsDNA triggered the minimal IFN promoter, but this was not the case (Fig 5) As viruses are known to induce IFN production through dsRNA intermediates, the effect of virus infection on the IFN promoter was examined For this purpose, we used the two most common viral pathogens of Atlantic salmon, the aquatic birnavirus infectious pancreatic necrosis virus (IPNV) and the orthomyxovirus infectious salmon anemia virus (ISAV) No increase in promoter activity was detected 48 h after treatment of CHSE-214 cells with multiplicity of infection (moi) of live IPNV (Fig 5) Strong cytopathic effects occurred in the cells 72 h after infection for IPNV As CHSE-214 cells are nonpermissive to most ISAV strains, we used TO cells to study the effect of Untreated Poly(I:C) Poly(dG:dC) LPS IPNV Fig Effect of different stimulants on the minimal IFN promoter in CHSE-214 cells Cells were transiently transfected with the pA1()202) construct plus a b-gal internal control vector in 24-well plates At 24 h after transfection, triplicate wells of cells were treated with lgỈmL)1 poly(I:C) (and Fugene), lgỈmL)1 poly(dG:dC) (and Fugene), 50 lgỈmL)1 LPS, moi of IPNV, or left untreated Luciferase and b-gal activities were measured 48 h after the stimulus using the dual-light luciferase kit Fold induction is luciferase activity expressed relative to b-gal of stimulated cells divided by nontreated control cells (mean ± SD from three wells) ISAV infection on the IFN promoter ISAV is strongly detectable in these cells 48 h after infection and produces cytopathic effects after a period of 4–7 days [30] ISAV (moi 5) was able to induce the minimal IFN promoter 4–5-fold at 48 and 72 h, and more than ninefold 96 h after infection in TO cells (Fig 6) Approximately 10–20% of the cells showed a cytopathic effect at 96 h These results show that, in nonimmune cells, ISAV is able to turn on the IFN promoter, although 14 12 10 Fold Induction 5000 3898 25 12 24 48 Time (h) 72 96 Fig Effect of ISAV infection on the minimal IFN promoter in TO cells Cells were transiently transfected with the pA1()202) construct plus a b-gal internal control vector in 24-well plates At 24 h after transfection, triplicate wells of cells were treated with moi of ISAV or left untreated Luciferase and b-gal activities were measured at 12, 24, 48, 72 and 96 h after the stimulus using the duallight luciferase kit Fold induction is mean luciferase activity expressed relative to b-gal of stimulated cells divided by nontreated control cells (mean ± SD from three wells) FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS V Bergan et al Atlantic salmon interferon promoter 140 A 1.20E+08 Total IFN 120 1.00E+08 80 Copy no/ng RNA Fold Induction 100 60 40 8.00E+07 6.00E+07 4.00E+07 20 2.00E+07 (-) None µM PDTC 0.1 µM PDTC 0.01 µM PDTC 0.1 mM 2-AP 0.01 mM 2-AP 0.001 mM 2-AP 0.00E+00 12 24 12 24 Time (h) B 7.00E+03 IFN2 6.00E+03 5.00E+03 Copy no/ng RNA Fig Effect of the kinase inhibitor 2-AP and the NFjB inhibitor PDTC on poly(I:C)-induced expression of the minimal IFN promoter CHSE-214 cells were transiently transfected with the pA1()202) construct and a b-gal internal control vector in 24-well plates At 24 h after transfection, triplicate wells of cells were treated with different concentrations of inhibitors followed by poly(I:C) (and Fugene) treatment or not (control) Luciferase and b-gal activities were measured 48 h after the stimulus using the dual-light luciferase kit Fold induction is luciferase activity expressed relative to b-gal of poly(I:C)-treated cells divided by nontreated control cells (mean ± SD from three wells) 4.00E+03 3.00E+03 2.00E+03 at a very late stage of infection, whereas IPNV is apparently unable to trigger the IFN promoter 1.00E+03 0.00E+00 Time (h) Effect of 2-aminopurine (2-AP) and pyrrolidine dithiocarbomate (PDTC) on the salmon IFN promoter The NFjB inhibitor, PDTC, and the kinase inhibitor, 2-AP, were used to study the involvement of NFjB in the poly(I:C)-induced activation of the IFN promoter As shown in Fig 7, PDTC produced  90% inhibition of poly(I:C)-induced promoter activity at lm and  70% inhibition at 0.01 lm, which suggests that NFjB is indeed involved in the poly(I:C)-induced activation of the salmon IFN promoter About 55% inhibition of promoter activity was observed with 0.01 and 0.1 mm 2-AP, which indicates that PKR or another 2-AP-sensitive kinase is involved in activation of salmon IFN promoter Long IFN transcripts are produced at very low levels in TO cells Northern blot studies have previously shown that transcripts with both short and long 5¢-UTRs are produced in head kidney of poly(I:C)-treated Atlantic salmon [26] To examine whether both transcripts were produced in cultured TO cells after poly(I:C) induction, a quantitative RT-PCR assay was designed Primers were designed from conserved regions within the ORF Fig Quantitative real-time PCR of total IFN transcripts (A) and long IFN2 transcripts (B) in TO cells at different time points (hours) after stimulation with poly(I:C) (and Fugene) to detect total IFN transcripts, and within the 5¢-UTR of SasaIFN-a2 to detect long IFN transcripts Total IFN transcripts were gradually increased over time in response to poly(I:C) stimulation, starting from basal levels of about · 104 transcript copies at h, and reaching almost 108 copies at 24 h (Fig 8A) Transcripts with a long 5¢-UTR were also produced in TO cells (Fig 8B), but at very low levels ranging from 14 copies at h to 5044 24 h after stimulation; 2000– 20 000 times below the total IFN transcript quantity Total IFN was thus induced about 2300-fold at 24 h compared with time point h, whereas IFN2 was induced only 360-fold This confirms that the proximal PR-I is most activated upon poly(I:C) induction, at least in nonimmune cells, producing high amounts of short IFN transcripts, while the distal PR-II is poorly induced in TO cells Discussion In this work we have identified the genes encoding the two previously reported cDNAs SasaIFN-a1 and FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS 3899 Atlantic salmon interferon promoter V Bergan et al SasaIFN-a2 [26], and studied their promoters The genes were previously thought to be distinguished by their ability to produce different length transcripts However, the present data suggest that both genes have the potential to encode transcripts with either a short or a long 5¢-UTR This can apparently be explained by the presence of two main regulatory regions in both genes: (a) a proximal promoter region (PR-I) which includes position )202 to +26 from the SasaIFN-A1 transcription start site, which controls synthesis of a short transcript; (b) a distal region (PRII) corresponding to position )747 to )413, which gives rise to a long transcript (Fig 1) Luciferase reporter gene assays in two different salmonid cell lines showed that PR-I was strongly induced by the synthetic dsRNA, poly(I:C), whereas PR-II of the A2 gene was hardly induced at all (Fig 2A,B) This suggests that PR-I is the main control region PR-I contains a putative NFjB-binding element flanked by two IRF-Es and is thus most similar to the human and mouse IFN-b and chicken IFN2 promoters (Fig 9) In contrast with IFN-b promoters, PR-I lacks an ATF-2 ⁄ c-Jun element Comparison of IFN promoter sequences from different vertebrate species suggests that the essential IRF-Es responsible for virus-induced expression are located within the 170-nucleotide region upstream from the ORF, and they all match either the IRF-1 ⁄ (AANNGAAA), the IRF-3 (G ⁄ CGAAANN) or the IRF-7 (T ⁄ CGAAANN) consensus-binding motif (Table 3) [31–33] IRF-7 has recently been shown to be the most important IRF controlling type I IFN expression, although IRF-3 also contributes substantially -800 Salmon IFNA1 -800 Zebrafish IFN Human IFNB -360 Human IFNA1 -900 Human IFNA4 -800 Chicken IFN1-2 -700 Chicken IFN2 -750 TATA-box IRF-E NFκB Fig Distribution of transcription factor binding sites in IFN promoters from selected species ATF-2/c-Jun Table Comparison of proximal interferon regulatory elements within selected type I IFN promoters The IRF binding cores are shaded grey Interferon name Position from ORF Interferon regulatory element Accession no Salmon IFNA1 Salmon IFNA1 Zebrafish IFN Zebrafish IFN Fugu IFN Fugu IFN Tetraodon IFN )96 )149 )115 )151 )97 )146 )148 G G G A A T T G G G G G G G A A A A A A A A A A A A A A A A A A A A A G A G G A A T T T G T C G C G G G G G C C A A A A A A A A A A A A A A A A A A A A A A G A G T G A C T C C C G G DQ354152 DQ354152 AJ544820 AJ544820 AJ583023 AJ583023 AJ544889 Human Human Human Human Human Human )164 )125 )153 )166 )123 )164 G A A G G A A G G G A G A A A A A A A A A A A A A A A A A A C G T G T G T T G C G C G G G A G A A G A A A A A A A A A A A A A A A A G A G A T C G T T A T A X00973 AL353732 AL353732 AL353732 X02955 X02955 )121 )166 )155 AGGAAGGGAAAGA CAAAAGTGAAAGC GAAAAATGAAACA IFN IFN IFN IFN IFN IFN b a a a a a 1 4b 4b Chicken IFN1-2 Chicken IFN1-2 Chicken IFN2 3900 Y14968 Y14968 Y14969 FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS V Bergan et al [16,34] The role of IRFs in induction of fish IFNs is as yet unknown In salmonids, only IRF-1 and IRF-2 have been cloned [35] One of the main differences in mammalian IFN promoters is the presence or absence of an NFjB-binding element The putative NFjB-binding sequence in PR-I (5¢-GGGAAATTCT-3¢) is only one nucleotide different from the NFjB-binding site in the human IFN-b promoter (5¢-GGGAAATTCC-3¢) The NFjB element in the IFN-b promoter is believed to be essential for an immediate early response to virus infection [36,37] IFN-a promoters lack the NFjB element and are usually activated at a later time point, except for mouse IFNA4, which also shows early expression in response to virus infection [38] The structure of PR-I thus suggests that it controls an early response to virus infection in Atlantic salmon A role for NFjB in the activation of PR-I was further supported by two different inhibitor experiments First, dose-dependent inhibition of promoter activity by the NFjB inhibitor PDTC was shown (Fig 7) PDTC is a metal chelator with antioxidant properties which specifically inhibits NFjB-induced pathways [39] Secondly, partial inhibition of promoter activity by 2-AP (Fig 7), indicates a role for PKR, a kinase known to be involved in NFjB activation [40,41] Although fish PKR has yet to be reported, PKR-like sequences are present in the GenBank On the other hand, it cannot be excluded that 2-AP inhibits another kinase in the IFN signaling pathway The zebrafish IFN promoter, which is the only other fish IFN promoter characterized so far, is claimed to contain an NFjB element, but the putative binding site does not conform with the NFjB consensus [28] However, the salmon and zebrafish IFN promoters both contain two IRF-Es at similar position and orientation (Fig 9) The IRF-E located at position )96 in salmon and at position )115 in zebrafish differ by only one nucleotide substitution and they are both present in antisense orientation The second IRF-E, at )149 in salmon and )151 in zebrafish, differs in three nucleotide positions (Table 3) Some species seem to have IRF-Es and ATF-2 ⁄ c-Jun elements in the distal region from the major transcription site, but only the salmon IFN promoters, and perhaps also human IFNA1 promoter, have the unique PR-I and PR-II organization (Fig 9) The PR-II has a somewhat different structure in the two salmon IFN genes (Fig 1) Both contain three identical IRF-Es and an ATF-2 ⁄ c-Jun site However, only PR-II of A1 contains an NFjB element and a CCAAT-box Furthermore, PR-II of A2 contains an additional IRF-E Whether the PR-IIs of the two genes are regulated differently is not yet known Atlantic salmon interferon promoter Promoter constructs that have both PR-I and PR-II or only PR-II showed a basal expression independent of poly(I:C) induction (Fig 2C) Basal expression is, however, a phenomenon often seen in promoter–reporter assays containing long upstream regions from the transcriptional start site The leakiness of transcription is probably due to lack of negative regulatory structures such as chromatin packing and ⁄ or methylation Basal expression has also been observed for the zebrafish IFN promoter distal 5¢-flanking regions ()2.2 to )0.7 kb) in similar experiments [28] PR-II probably controls synthesis of a transcript with a long 5¢-UTR Northern blotting showed that both transcripts are present in head kidney of poly(I:C)-treated Atlantic salmon, although the intensity of the long transcript was about half of the short transcript [26] In TO cells, however, the long transcript was estimated to constitute only 10-3)10-4 of the total IFN mRNA (Fig 8) The long transcript thus appears to be mainly produced in cells of lymphoid tissues The function of the long transcripts is interesting since both transcripts from one gene are believed to produce identical proteins Long 5¢-UTRs are often associated with genes related to cell growth and different types of cellular stress [42,43] Most of these genes are poorly translated because of complex secondary structure within the long 5¢-UTR or they contain small upstream ORFs that are translated before the major ORF [44] Recently, promoter activity was found in long 5¢-UTR sequences of genes that were believed to have internal ribosome entry sites (IRES) as a mechanism for translation [45–47] These alternative promoters were thought to be activated by certain types of stressors to speed up transcription to smaller and more efficiently translated mRNA; especially for genes that were required in small amounts and which could be toxic if over-produced [44] This strengthens the idea that the long 5¢-UTR may have a negative regulatory function in salmon IFN production In fact, alternative promoter options usually have regulatory functions or are associated with specific cell type expression [48] As salmonids have a tetraploid origin, the organization of the IFN promoter in the two regions may be important for regulation of the expression levels of IFNs, to prevent overproduction from the many IFN loci in the salmon genome The alternative promoter found in the 5¢-UTR of salmon IFN genes suggests an answer to another question on the evolution of the intronless IFN genes of birds and mammals The intronless type I IFNs of higher vertebrates most probably originated from a retro-transposition event involving the transcript of an FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS 3901 Atlantic salmon interferon promoter V Bergan et al ancestral intron-containing IFN gene This does, however, not immediately explain the origin of the IFN promoters The present observation of a promoter in the 5¢-UTR of salmon IFN transcripts suggests that the promoter of higher vertebrate IFN-a ⁄ b also originates from the same retroposition event that created the first intronless IFN gene in vertebrates dsRNA is thought to activate the NFjB pathway by binding to TLR3, RIG-I ⁄ MDA5 or PKR [6,41,49] NFjB is involved in many different cellular stress responses [50] LPS is a well-known inducer of NFjB activation, but is also thought to be central to TLR4mediated activation of IRF-3 to induce the IFN-b gene in mice [51,52] The minimal IFN promoter was not triggered by LPS treatment in either CHSE-214 cells (Fig 5) or TO cells (data not shown) This indicates that LPS alone is not sufficient to give an IFN response or that the cell types used lack cell surface receptors for LPS such as TLR4 Results suggest that NFjB has a role in the activation of the salmon IFN promoter, but it cannot act alone to initiate transcription A hallmark of mammalian IFN-a ⁄ b is their rapid induction by virus infection mainly because of the recognition of viral dsRNA products [20] Although the dsRNA poly(I:C) strongly activated the salmon IFN promoter, infection with neither IPNV nor ISAV resulted in convincing activation of the promoter (Figs and 6) This suggests that both viruses have developed mechanisms to avoid or inhibit the IFN promoter in the early critical phases of infection For IPNV, this may explain why the virus does not trigger Mx protein production in cultured cells [30,53] IPNV is very sensitive to IFN treatment, and the antiviral mechanism is at least partly mediated by the Atlantic salmon Mx1 protein [54] The chicken birnavirus, infectious bursal disease virus, has also been shown to inhibit transcription of IFN genes [55], which suggests a common immunosuppressive mechanism of this family of dsRNA viruses ISAV, on the other hand, was able to induce the salmon IFN promoter 96 h after infection (Fig 6) However, a previous report has shown that moi of ISAV resulted in peak Mx protein expression 24–48 h after infection [30] This indicates that ISAV may stimulate the Mx promoter independent of IFN ISAV belongs to the same family as influenza viruses, Orthomyxoviridae The NS1 protein of influenza virus is a well-known IFN antagonist which is believed to act upstream of the IFN promoter, through either NFjB or IRF-3 [56–58] The ISAV NS protein is thought to be encoded by segment 7, and may also represent a candidate antagonist of the salmon IFN promoter [59] Taken together, our results 3902 suggest that ISAV and IPNV are successful fish viruses that have developed strategies to hinder IFN production, at least in monocellular systems lacking signals from the multicellular lymphoid system However, the establishment of a salmon IFN promoter reporter assay gives the opportunity to search for viral proteins that antagonize IFN production Experimental procedures Cloning of genomic IFN sequences Atlantic salmon genomic DNA was purified from full blood of one individual fish by proteinase K digestion and phenol ⁄ chloroform extraction as described [60] A genomic DNA library was prepared using the Universal GenomeWalker kit (Clontech Laboratories Inc., Mountain View, CA, USA) Nested-PCR of GenomeWalker library DNA using the primer pairs BR23 and AP1 first and BR22 and AP2 second was performed according to the kit manual (primer details are listed in Table 4) The major PCR products were sequenced and new primers were designed to clone full-length IFN genes from an Atlantic salmon BAC library purchased from BACPAC Resources (http://bacpac chori.org/salmon214.htm) The genomic sequence for SasaIFNa1 was obtained from the 409K8 BAC clone using the primer pairs Band41AP2 ⁄ BR21, and SasaIFNa2 was found in the 286F7 BAC using Band41AP2 ⁄ GAT2AAS (Table 4) The sequences were obtained with long distance PCR using the Dynazyme EXT PCR kit (Finnzymes Oy, Espoo, Finland) and cloned into the pCR-XL-TOPO vector (Invitrogen, Carlsbad, CA, USA) Promoter constructs Various constructs of the promoter region of SasaIFN-A1 and SasaIFN-A2 were PCR-cloned into the pGL3-basic vector (Promega, Southampton, UK) using the primers specified in Table The full-length luciferase construct, pA1()1.2 kb), was obtained with the primer pairs K5FBrev and IFN1()1.2 kb); pA1()747) with K5FBrev and IFN1()747); pA1()333) with K5FBrev and IFN1()333); pA1()202) with K5FBrev and IFN1()202); pA1()135) with K5FBrev and IFN1()135); and pA2()275) with IFN2(+ 58) and IFN1()747) (Fig 1A) The b-galactosidase control vector (pJatLacZ) was a gift from J Jørgensen (Norwegian College of Fishery Science, Tromsø, Norway), and contains the LacZ gene under the control of a rat b-actin promoter [61] Cells and viruses TO cells originate from Atlantic salmon head kidney [62] and were obtained from H Wergeland (University of FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS V Bergan et al Atlantic salmon interferon promoter Table Primer sequences used in the cloning procedures and real-time RT-PCR The position is given in reference to SasaIFN-a1 (accession no AY216594); R, reverse; F, forward Primer name Sequence 5¢ fi 3¢ Position, orientation Purpose used BR22 BR23-nested Band41AP2 BR21 GAT2AAS K5FBrev IFN1()1,2kb) IFN1()747) IFN1()333) IFN1()202) IFN1()135) IFN2(+ 58) SasaIFN1-F SasaIFN1-R SasaIFN2-F SasaIFN2-R AS18S-F AS18S-R tgcaaataataagacaaatacacgt gctgtttgtttcgctgttagttttc aaccaaggcctgtatttattaagcatctca actttataaactggtaagggcgtagc cgtttttattcacattttcaatgttattttttcat attaagcttgctgtttgtttcgctgttagttttc attgctagcaaccaaggcctgtatttattaagca attgctagcagccctgtcaaaactattgactctg attgctagcgttcacgcgaagttattatcagttg agctagcaaggagaatgtgtatagatttactgtga attgctagctgctgcatgtgctagtctggaaaatg attaagcttgacattaatttagtgggtttcgttca tgcagtatgcagagcgtgtg tctcctcccatctggtccag ttcgtccaggagaaggagca ctgatcaacctaccggaggc tgtgccgctagaggtgaaatt gcaaatgctttcgctttcg 56–80, R 2–26, R )1281–1251, F 584–609, R 765–799, R 2–26, R )1281–1251, F )747–722, F )333–309, F )202–176, F )135–109, F )439–413, R 77–96, F 158–177, R )171–152, F )100–81, R – – Genome walking Genome walking BAC amplification BAC amplification BAC amplification Promoter cloning Promoter cloning Promoter cloning Promoter cloning Promoter cloning Promoter cloning Promoter cloning Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR Bergen, Norway) TO and CHSE-214 cells were grown in Eagle’s minimal essential medium (EMEM) supplemented with 1% nonessential amino acids, mm l-glutamine, 5% fetal bovine serum, 100 lgỈmL)1 streptomycin and 200 mL)1 penicillin G in 5% CO2 at 20 °C IPNV seriotype NVI-023 [63] was propagated in TO cells Virus was harvested from the medium supernatant and titrated to · 107 TCID50ỈmL)1 and stored at )80 °C until use ISAV was likewise propagated in TO cells and titrated to 1.9 · 108 TCID50ỈmL)1 Chemicals used for promoter activation or inhibition Stock solutions were as follows: for synthetic dsRNA, poly(I:C), mgỈmL)1; for synthetic dsDNA, poly(dG:dC), 100 ngỈmL)1 (both polymers from GE Healthcare, Amersham Biosciences, Uppsala, Sweden); for LPS 2.5 mgỈmL)1; for PDTC 10 mm; for 2-AP 10 mm All chemicals were purchased from Sigma-Aldrich Inc (St Louis MO, USA), and stock solutions were all prepared in NaCl ⁄ Pi, divided into aliquots, and stored at )80 °C before use Luciferase assays For CHSE-214 cells, 1.8 · 105 cells were seeded for each well in 24-well plates and transfected at 90% cell confluency using the lipofectamine 2000 transfection reagent (Invitrogen) For each well, 300 ng of the luciferase vector constructs and 100 ng of the b-gal vector were complexed with lL Lipofectamine 2000 in 100 lL EMEM without serum Transfections were performed in 500 lL minimal growth medium (EMEM supplemented with 2% fetal bovine serum) for 24 h before changing to 400 lL fresh minimal growth medium Poly(I:C), lgỈmL)1, complexed with lLỈmL)1 Fugene (Roche, Basel, Switzerland) in 100 lL EMEM without serum was added to the cells for stimulation or they were mock-treated with 100 lL EMEM without serum (control) The poly(I:C)-containing medium was replaced with fresh minimal medium 24 h after poly(I:C) treatment For TO cells, transfections were performed using nucleofection (Amaxa Biosystems, Cologne, Germany) Cells were split days before transfection to 70–90% confluency The cells were washed in NaCl ⁄ Pi, trypsinated, and resuspended in growth medium and centrifuged at 200 g for 10 The cells were resuspended in serum-free medium and counted For each transfection, · 106 cells were centrifuged at 200 g for 10 and resuspended in 100 lL nucleofector solution T (Amaxa Biosystems) A total of 15 lg plasmid was added, and the mixture was transferred to a cuvette and transfected with program T-20 in the nucleofector device (Amaxa Biosystems) After the transfection, 500 lL growth medium was added to the cells, left for 10 min, and subsequently seeded in 24-well plates After 24 h, the cell medium was replaced with fresh medium to remove unattached cells The cells were left growing for at least days before stimulation with lgỈmL)1 poly(I:C) or mock-treated with growth medium For both cell types, cells were harvested at various time intervals after stimulation (12, 24 or 48 h) according to the protocol for the dual-light luciferase kit (Applied Biosystems, Foster City, CA, USA) using 50 lL lysis buffer for each well Samples were kept on ice during harvesting and centrifuged at 14 000 g for to remove cell debris before storage at )80 °C Luciferase and b-gal activities FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS 3903 Atlantic salmon interferon promoter V Bergan et al were measured using 20 lL of each sample following the manual of the dual-light luciferase kit (Applied Biosystems) Cell experiments with inhibitors (PTDC and 2-AP) were performed as above, except that the inhibitors were applied h before poly(I:C) treatment and left on the cells for 24 h Then fresh minimal growth medium was added for another 24 h before cells were harvested 48 h after poly(I:C) treatment for luciferase measurements RNA isolation and cDNA synthesis Atlantic salmon TO cells were seeded in six-well plates at · 105 cells per well 24 h before poly(I:C) treatment Cells were then stimulated with lgỈmL)1 poly(I:C) complexed with lLỈmL)1 Fugene (Roche) Triplicate wells were harvested at time points 0, 4, 8, 12 and 24 h after poly(I:C) treatment and directly processed using the RNeasy mini kit (Qiagen, Hilden, Germany) RNA samples were treated with DNase I using the turbo DNA-free kit (Ambion Inc, Austin, TX, USA) before measurement of RNA concentrations with Nanodrop ND1000 (Nanodrop Tec., Wilmington, DE, USA) Total RNA (100 ng) was reversetranscribed using the TaqMan Reverse Transcription Reagent kit (Applied Biosystems) in a 10-lL reaction for h at 37 °C Quantitative RT-PCR The SYBRÒ Green PCR kit (Applied Biosystems) was used for real-time amplification of total IFN, IFN-a2 or 18S rRNA (internal control) The SasaIFN1 primers were designed to overlap exon–intron junctions and amplified PCR products of both a1 and a2 (Table 4) The SasaIFN2 primers amplified regions in the 5¢-UTR of SasaIFN-a2 that corresponded to the promoter region of SasaIFN-a1 Realtime PCR was performed using a 9.5 lL cDNA (1 : 10 dilution) in 25 lL reaction mixture containing 12.5 lL 2· SYBR green PCR Mastermix (Applied Biosystems) and 300 nm of each primer Real-time PCR was initiated at 95 °C for 10 to activate the AmpliTaq GoldÒ DNA polymerase, and then run at 40 cycles of 95 °C for 15 s followed by 60 °C for Each sample was run in triplicate, and deviations more than 0.4 Ct between parallels were rejected 18S rRNA was used as reference gene and was diluted : 10 000 to avoid differences of more than 10 Ct between reference and target amplicons Quantitation of IFN transcript per ng total RNA was determined by relating Ct values to a standard curve ranging from 105 to 109 copies of a plasmid containing the SasaIFN-a2 cDNA Acknowledgements We thank Dr Jorunn Jørgensen at the Norwegian College of Fishery Science, Tromsø, Norway for supplying 3904 the pJatLacZ b-galactosidase vector This work was supported by The Research Council of Norway (grants 151938 ⁄ 150) References Samuel CE (2001) Antiviral actions of interferons Clin Microbiol Rev 14, 778–809 Kawai T & Akira S (2006) Innate immune recognition of viral infection Nat Immunol 7, 131–137 Haller O, Kochs G & Weber F (2006) The interferon response circuit: induction and suppression by pathogenic viruses Virology 344, 119–130 Magyarics Z & Rajnavolgyi E (2005) Professional type I interferon-producing cells: a unique subpopulation of dendritic cells Acta Microbiol Immunol Hung 52, 443– 462 Zhang Z & Wang FS (2005) Plasmacytoid dendritic cells act as the most competent cell type in linking antiviral innate and adaptive immune responses Cell Mol Immunol 2, 411–417 Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M, Taira K, Akira S & Fujita T (2004) The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses Nat Immunol 5, 730–737 Andrejeva J, Childs KS, Young DF, Carlos TS, Stock N, Goodbourn S & Randall RE (2004) The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter Proc Natl Acad Sci USA 101, 17264–17269 Kang DC, Gopalkrishnan RV, Wu Q, Jankowsky E, Pyle AM & Fisher PB (2002) mda-5: An interferoninducible putative RNA helicase with double-stranded RNA-dependent ATPase activity and melanoma growth-suppressive properties Proc Natl Acad Sci USA 99, 637–642 Yoneyama M, Kikuchi M, Matsumoto K, Imaizumi T, Miyagishi M, Taira K, Foy E, Loo YM, Gale M Jr, Akira S, et al (2005) Shared and unique functions of the DExD ⁄ H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity J Immunol 175, 2851–2858 10 Kawai T, Takahashi K, Sato S, Coban C, Kumar H, Kato H, Ishii KJ, Takeuchi O & Akira S (2005) IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction Nat Immunol 6, 981–988 11 Seth RB, Sun L, Ea CK & Chen ZJ (2005) Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF Cell 122, 669–682 12 Levy DE, Marie I, Smith E & Prakash A (2002) Enhancement and diversification of IFN induction by IRF-7-mediated positive feedback J Interferon Cytokine Res 22, 87–93 FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS V Bergan et al 13 Sato M, Suemori H, Hata N, Asagiri M, Ogasawara K, Nakao K, Nakaya T, Katsuki M, Noguchi S, Tanaka N, et al (2000) Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha ⁄ beta gene induction Immunity 13, 539–548 14 Tailor P, Tamura T & Ozato K (2006) IRF family proteins and type I interferon induction in dendritic cells Cell Res 16, 134–140 15 Kadowaki N, Ho S, Antonenko S, Malefyt RW, Kastelein RA, Bazan F & Liu YJ (2001) Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens J Exp Med 194, 863–869 16 Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T, Shimada N, Ohba Y, Takaoka A, Yoshida N, et al (2005) IRF-7 is the master regulator of type-I interferon-dependent immune responses Nature 434, 772–777 17 Raftopoulou M (2005) IRF-7 triggers the interferon alarm Nat Cell Biol 7, 459 18 Izaguirre A, Barnes BJ, Amrute S, Yeow WS, Megjugorac N, Dai J, Feng D, Chung E, Pitha PM & Fitzgerald-Bocarsly P (2003) Comparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells J Leukoc Biol 74, 1125–1138 19 Doly J, Civas A, Navarro S & Uze G (1998) Type I interferons: expression and signalization Cell Mol Life Sci 54, 1109–1121 20 Honda K, Yanai H, Takaoka A & Taniguchi T (2005) Regulation of the type I IFN induction: a current view Int Immunol 17, 1367–1378 21 Malmgaard L (2004) Induction and regulation of IFNs during viral infections J Interferon Cytokine Res 24, 439–454 22 Sheppard P, Kindsvogel W, Xu W, Henderson K, Schlutsmeyer S, Whitmore TE, Kuestner R, Garrigues U, Birks C, Roraback J, et al (2003) IL-28, IL-29 and their class II cytokine receptor IL-28R Nat Immunol 4, 63–68 23 Kotenko SV, Gallagher G, Baurin VV, Lewis-Antes A, Shen M, Shah NK, Langer JA, Sheikh F, Dickensheets H & Donnelly RP (2003) IFN-lambdas mediate antiviral protection through a distinct class II cytokine receptor complex Nat Immunol 4, 69–77 24 Robertsen B (2006) The interferon system of teleost fish Fish Shellfish Immunol 20, 172–191 25 Altmann SM, Mellon MT, Distel DL & Kim CH (2003) Molecular and functional analysis of an interferon gene from the zebrafish, Danio reri J Virol 77, 1992–2002 26 Robertsen B, Bergan V, Rokenes T, Larsen R & Albuquerque A (2003) Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity J Interferon Cytokine Res 23, 601–612 Atlantic salmon interferon promoter 27 Long S, Milev-Milovanovic I, Wilson M, Bengten E, Clem LW, Miller NW & Chinchar VG (2006) Identification and expression analysis of cDNAs encoding channel catfish type I interferons Fish Shellfish Immunol 21, 42–59 28 Chen JY, You YK, Chen JC, Huang TC & Kuo CM (2005) Organization and promoter analysis of the zebrafish (Danio rerio) interferon gene DNA Cell Biol 24, 641–650 29 Tanaka N, Kawakami T & Taniguchi T (1993) Recognition DNA sequences of interferon regulatory factor (IRF-1) and IRF-2, regulators of cell growth and the interferon system Mol Cell Biol 13, 4531–4538 30 Jensen I & Robertsen B (2002) Effect of doublestranded RNA and interferon on the antiviral activity of Atlantic salmon cells against infectious salmon anemia virus and infectious pancreatic necrosis virus Fish Shellfish Immunol 13, 221–241 31 Fujii Y, Shimizu T, Kusumoto M, Kyogoku Y, Taniguchi T & Hakoshima T (1999) Crystal structure of an IRF-DNA complex reveals novel DNA recognition and cooperative binding to a tandem repeat of core sequences EMBO J 18, 5028–5041 32 Escalante CR, Yie J, Thanos D & Aggarwal AK (1998) Structure of IRF-1 with bound DNA reveals determinants of interferon regulation Nature 391, 103–106 33 Lin R, Genin P, Mamane Y & Hiscott J (2000) Selective DNA binding and association with the CREB binding protein coactivator contribute to differential activation of alpha ⁄ beta interferon genes by interferon regulatory factors and Mol Cell Biol 20, 6342–6353 34 Servant MJ, Tenoever B & Lin R (2002) Overlapping and distinct mechanisms regulating IRF-3 and IRF-7 function J Interferon Cytokine Res 22, 49–58 35 Collet B, Hovens GC, Mazzoni D, Hirono I, Aoki T & Secombes CJ (2003) Cloning and expression analysis of rainbow trout Oncorhynchus mykiss interferon regulatory factor and (IRF-1 and IRF-2) Dev Comp Immunol 27, 111–126 36 Thanos D & Maniatis T (1995) Identification of the rel family members required for virus induction of the human beta interferon gene Mol Cell Biol 15, 152– 164 37 Kirchhoff S, Wilhelm D, Angel P & Hauser H (1999) NFkappaB activation is required for interferon regulatory factor-1-mediated interferon beta induction Eur J Biochem 261, 546–554 38 Morin P, Genin P, Doly J & Civas A (2002) The virus-induced factor VIF differentially recognizes the virus-responsive modules of the mouse IFNA4 gene promoter J Interferon Cytokine Res 22, 77–86 39 Schreck R, Meier B, Mannel DN, Droge W & Baeuerle PA (1992) Dithiocarbamates as potent inhibitors of nuclear factor kappa B activation in intact cells J Exp Med 175, 1181–1194 FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS 3905 Atlantic salmon interferon promoter V Bergan et al 40 Fremont M, Vaeyens F, Herst CV, De Meirleir KL & Englebienne P (2006) Double-stranded RNA-dependent protein kinase (PKR) is a stress-responsive kinase that induces NFkappaB-mediated resistance against mercury cytotoxicity Life Sci 78, 1845–1856 41 Zamanian-Daryoush M, Mogensen TH, DiDonato JA & Williams BR (2000) NF-kappaB activation by double-stranded-RNA-activated protein kinase (PKR) is mediated through NF-kappaB-inducing kinase and IkappaB kinase Mol Cell Biol 20, 1278–1290 42 Kozak M (1987) An analysis of 5¢-noncoding sequences from 699 vertebrate messenger RNAs Nucleic Acids Res 15, 8125–8148 43 Kozak M (1988) Leader length and secondary structure modulate mRNA function under conditions of stress Mol Cell Biol 8, 2737–2744 44 Kozak M (2005) Regulation of translation via mRNA structure in prokaryotes and eukaryotes Gene 361, 13–37 45 Han B & Zhang JT (2002) Regulation of gene expression by internal ribosome entry sites or cryptic promoters: the eIF4G story Mol Cell Biol 22, 7372–7384 46 Wang Z, Weaver M & Magnuson NS (2005) Cryptic promoter activity in the DNA sequence corresponding to the pim-1 5¢-UTR Nucleic Acids Res 33, 2248–2258 47 Kozak M (2005) A second look at cellular mRNA sequences said to function as internal ribosome entry sites Nucleic Acids Res 33, 6593–6602 48 Landry JR, Mager DL & Wilhelm BT (2003) Complex controls: the role of alternative promoters in mammalian genomes Trends Genet 19, 640–648 49 Alexopoulou L, Holt AC, Medzhitov R & Flavell RA (2001) Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor Nature 413, 732–738 50 Pahl HL (1999) Activators and target genes of Rel ⁄ NFkappaB transcription factors Oncogene 18, 6853–6866 51 Sankar S, Chan H, Romanow WJ, Li J & Bates RJ (2005) IKK-i signals through IRF3 and NFkappaB to mediate the production of inflammatory cytokines Cell Signal 18, 982–993 52 Sakaguchi S, Negishi H, Asagiri M, Nakajima C, Mizutani T, Takaoka A, Honda K & Taniguchi T (2003) Essential role of IRF-3 in lipopolysaccharide-induced 3906 53 54 55 56 57 58 59 60 61 62 63 interferon-beta gene expression and endotoxin shock Biochem Biophys Res Commun 306, 860–866 Jensen V & Robertsen B (2000) Cloning of an Mx cDNA from Atlantic halibut (Hippoglossus hippoglossus) and characterization of Mx mRNA expression in response to double-stranded RNA or infectious pancreatic necrosis virus J Interferon Cytokine Res 20, 701–710 Larsen R, Rokenes TP & Robertsen B (2004) Inhibition of infectious pancreatic necrosis virus replication by atlantic salmon Mx1 protein J Virol 78, 7938–7944 Ragland WL, Novak R, El-Attrache J, Savic V & Ester K (2002) Chicken anemia virus and infectious bursal disease virus interfere with transcription of chicken IFN-alpha and IFN-gamma mRNA J Interferon Cytokine Res 22, 437–441 Talon J, Horvath CM, Polley R, Basler CF, Muster T, Palese P & Garcia-Sastre A (2000) Activation of interferon regulatory factor is inhibited by the influenza A virus NS1 protein J Virol 74, 7989–7996 Wang X, Li M, Zheng H, Muster T, Palese P, Beg AA & Garcia-Sastre A (2000) Influenza A virus NS1 protein prevents activation of NF-kappaB and induction of alpha ⁄ beta interferon J Virol 74, 11566–11573 Marcus PI, Rojek JM & Sekellick MJ (2005) Interferon induction and ⁄ or production and its suppression by influenza A viruses J Virol 79, 2880–2890 McBeath AJ, Collet B, Paley R, Duraffour S, Aspehaug V, Biering E, Secombes CJ & Snow M (2006) Identification of an interferon antagonist protein encoded by segment of infectious salmon anaemia virus Virus Res 115, 176–184 Sambrook J, Fritsch E & Maniatis T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Johansen A, Collet B, Sandaker E, Secombes CJ & Jorgensen JB (2004) Quantification of Atlantic salmon type-I interferon using an Mx1 promoter reporter gene assay Fish Shellfish Immunol 16, 173–184 Wergeland HI & Jakobsen RA (2001) A salmonid cell line (TO) for production of infectious salmon anaemia virus (ISAV) Dis Aquat Organ 44, 183–190 Santi N, Vakharia VN & Evensen O (2004) Identification of putative motifs involved in the virulence of infectious pancreatic necrosis virus Virology 322, 31–40 FEBS Journal 273 (2006) 3893–3906 ª 2006 The Authors Journal compilation ª 2006 FEBS ... role in the activation of the salmon IFN promoter, but it cannot act alone to initiate transcription A hallmark of mammalian IFN-a ⁄ b is their rapid induction by virus infection mainly because of. .. Atlantic salmon A role for NFjB in the activation of PR -I was further supported by two different inhibitor experiments First, dose-dependent inhibition of promoter activity by the NFjB inhibitor... type I IFN genes of Atlantic salmon show a rather unique organization of the promoter in comparison with mammals, 3894 birds and zebrafish Atlantic salmon stimulated with the dsRNA polyinosinic