STT Mức điểm Ý nghĩa Sốlượng (người) Tỷ lệ (%)
1 Từ 1 đến 4 Khơng thích 3 2,50
2 Điểm 5 Khơng thích cũng khơng ghét 16 13,33
3 Từ6 đến 9 Thích 101 84,17
Kết quả thu được (Bảng 3.5) cho thấy tỷ lệ người chấp nhận sản phẩm lên
đến 97,5% (gồm điểm 5 đến 9), là một kết quả khả quan đối với một dòng sản phẩm mới. Màu bia đậm giống mật ong, vị đắng nhẹ, hương thơm nhẹ là những
67 sản phẩm có vị chua nhẹ và bọt hết nhanh là những điểm cần khắc phục ở sản phẩm. Bọt của sản phẩm có độ bền kém hơn so với các loại bia thơng thường khác, do dịch lên men bia lỗng hơn so với dịch lên men các loại bia thông thường,
nhược điểm này có thểđược khắc phục bằng cách sử dụng các sản phẩm tăng độ
bền bọt (malt đặc biệt, tetra hops).
Sau khi được cung cấp thêm thông tin về sản phẩm: nồng độ cồn thấp và có chứa nấm men probiotic, có lợi cho sức khoẻ, 83,33% người thử(100/120 người) có nhận định muốn mua sản phẩm. Quyết định mua một sản phẩm của người tiêu dùng bị chi phối bởi rất nhiều yếu tố: giá cả, nhu cầu sử dụng, chất lượng sản phẩm… nhưng với kết quả thu được từ khảo sát sơ bộ đối với sản phẩm bia này thì có thể thấy đây là một dịng sản phẩm có tiềm năng để phát triển trong tương
68
CHƯƠNG 4. KẾT LUẬN VÀ KIẾN NGHỊ
4.1 Kết luận
Các kết quả của nghiên cứu cho thấy rằng, chúng tôi đã thành cơng trong
việc tạo sản phẩm bia có nồng độ cồn thấp sử dụng nấm men probiotic
Saccharomyces boulardii.
– Đã phân lập được chủng nấm men Saccharomyces boulardii từ chế phẩm Bioflora. Chủng có sinh trưởng được trong mơi trường có nồng độ cồn thấp hơn 2,5% v/v và độ đắng dưới 25 IBU, thích hợp để sử dụng trong sản xuất bia nồng
độ cồn thấp.
– Quy trình sản xuất sản phẩm bia nồng độ cồn thấp bao gồm: đường hoá một nhiệt độ 78oC trong 30 phút với nguyên liệu malt Pilsner/Carabelge: 70/30, tỷ
lệ nguyên liệu/nước:1/5, đun sôi dịch đường với hoa Saaz trong 60 phút thu được dịch đường lên men ban đầu 6,56 g/100ml, với tỷ lệđường lên men được 33,29%.
Quy trình lên men gián đoạn ở 25oC với mật độ nấm men ban đầu là 107 tế bào/mL trong 4 ngày, kết hợp với lên men trong chai đểổn định chất lượng của bia trước khi bảo quản.
– Sản phẩm bia thu được có nồng độ cồn là 1,38% v/v. Sau 24 tuần (6 tháng) bảo quản ở nhiệt độ 8-10oC, nồng độ cồn vẫn được duy trì ổn định và mật độ tế
bào nấm men S.boulardii sống là 2,57×107 tế bào/mL (8,48 tỉ tế bào/chai 330mL). Sản phẩm bia được đánh giá là chấp nhận được với tỷ lệ 97,5% trong tổng số 120
người thử cảm quan.
4.2 Kiến nghị
Để có thể hồn thiện và đi đến thương mại hoá sản phẩm bia này, cần thực hiện một số nghiên cứu tiếp theo:
– Nghiên cứu cải thiện độ bền bọt bằng cách sử dụng thêm các loại malt hỗ
trợ hoặc sử dụng chế phẩm hoa Tetra hop.
– Cải thiện hương thơm cho bia bằng sử dụng một số loại hoa đặc biệt khác. – Sản xuất bia quy mô pilot đểđánh giá hiệu quả kinh tế.
69
TÀI LIỆU THAM KHẢO
[1] K. B. U. Report, "Global Beer Consumption by Country in 2020," 2022. [2] S. Amarnani, "Global Beer Market Forecast 2019-2027."
https://inkwoodresearch.com/reports/global-beer-market/#report-summary
[3] K. Habschied, A. Živković, V. Krstanović, and K. Mastanjević,
"Functional Beer A Review on possibilities," Beverages, vol. 6, no. 3, 2020.
[4] J. Palmer and C. Kaminski, Water: A Comprehensive Guide for Brewer
(Brewing Elements). Brewer Association: Kristi Switzer, 2013. [5] "Differences between craft beer and industrial beer."
https://www.micetcraft.com/differences-between-craft-beer-and- industrial-beer/
[6] J. Mallett, Malt A pratical guide from field to brewhouse (Brewing
elements series). Brewers Association, 2014.
[7] W. Kunze, Technology Brewing and Malting. VLB Berlin, 2019.
[8] A. C. Blake Bleier, Samantha Farmer, Hannah Min, "Craft Beer
Production," Scholarly Commons, 2013.
[9] J. Zainasheff and C. White, Yeast The pratical guide to beer fermentation
(Brewing Elements). Brewers Publications, 2010.
[10] D. Million. (2003) Dry hopping techniques. The how to homebrew beer. https://byo.com/article/dry-hopping-techniques/
[11] K. Štulíková, J. Novák, J. Vlček, J. Šavel, P. Košin, and P. Dostálek,
"Bottle Conditioning: Technology and mechanisms applied in refermented beers," Beverages, vol. 6, no. 3, 2020.
[12] "Drinking Guidelines: General Population," International Alliance for Responsible Drinking (IARD), 2019. https://www.iard.org/science- resources/detail/Drinking-Guidelines-General-Population
[13] R. G. Smart and R. E. Mann, "Alcohol and the epidemiology of liver cirrhosis," Alcohol research & health, vol. 16, no. 3, p. 217, 1992. [14] A. Ogbonna, "Beer and health: A review," Technical Quarterly, 2009.
70 [15] M. C. Dufour, F. S. Stinson, and M. F. Caces, "Trends in cirrhosis
morbidity and mortality: United States, 1979-1988," Semin Liver Dis, vol. 13, no. 2, pp. 109-25, 1993.
[16] A. Urbano-Márquez, R. Estruch, J. Fernández-Solá, J. M. Nicolás, J. C. Paré, and E. Rubin, "The greater risk of alcoholic cardiomyopathy and myopathy in women compared with men," Jama, vol. 274, no. 2, pp. 149- 54, 1995.
[17] O. A. Parsons, "Alcohol abuse and alcoholism," in Neuropsychology for
clinical practice: Etiology, assessment, and treatment of common neurological disorders. Washington, DC, US: American Psychological
Association, pp. 175-201, 1996.
[18] A. Richman and R. A. Warren, "Alcohol consumption and morbidity in the Canada Health Survey: inter-beverage differences," Drug Alcohol
Depend, vol. 15, no. 3, pp. 255-82, 1985.
[19] R. L. Sacco, "The protective effect of moderate alcohol consumption on ischemic stroke," Jama, vol. 281, no. 1, pp. 53-60, 1999.
[20] G. Zuccalà, "Dose-related impact of alcohol consumption on cognitive function in advanced age: results of a multicenter survey," Alcohol Clin
Exp Res, vol. 25, no. 12, pp. 1743-8, 2001.
[21] I. Leskosek, "Beer as an Integral Part of Healthy Diets: Current Knowledge and Perspective," pp. 111-144, 2016.
[22] S. Djordjevic, D. Popovic, S. Despotovic, M. Veljovic, and M.
Atanackovic, "Extracts of medicinal plants - as functional beer additives,"
Chemical Industry and Chemical Engineering Quarterly, vol. 22, pp. 44-
44, 2015.
[23] A. Gasiński, J. Kawa-Rygielska, D. Mikulski, G. Kłosowski, and A.
Głowacki, "Application of white grape pomace in the brewing technology and its impact on the concentration of esters and alcohols,
physicochemical parameteres and antioxidative properties of the beer,"
71 [24] M. Veljovic, "The possibility of producing a special type of beer made
from wort with the addition of grape must," Journal of the Institute of
Brewing, vol. 116, 2010.
[25] F. Ferk, "Xanthohumol, a prenylated flavonoid contained in beer, prevents the induction of preneoplastic lesions and DNA damage in liver and colon induced by the heterocyclic aromatic amine amino-3-methyl-imidazo[4,5- f]quinoline (IQ)," Mutat Res, vol. 691, no. 1-2, pp. 17-22, 2010.
[26] F. Burberg and M. Zarnkow, "Special Production Methods," Handbook of
Brewing, pp. 235-256, 2009.
[27] P. Magalhães, P. Dostálek, J. Cruz, L. Guido, and A. Barros, "The impact of a xanthohumol-enriched hop product on the behavior of xanthohumol and isoxanthohumol in Pale and Dark beers: A pilot scale approach,"
Journal of the Institute of Brewing, vol. 114, pp. 246-256, 2008.
[28] M. Karabin, L. Jelínek, T. Kincl, T. Hudcova, B. Kotlikova, and P. Dostálek, "New approach to the production of xanthohumol-enriched beers," Journal of the Institute of Brewing, vol. 119, pp. 98-102, 2013. [29] E. Farnworth, "Kefir - A complex probiotic," Food Science & Technology
Bulletin: Functional Foods, vol. 2, pp. 1-17, 2005.
[30] K. L. Rodrigues, L. R. Caputo, J. C. Carvalho, J. Evangelista, and J. M. Schneedorf, "Antimicrobial and healing activity of kefir and kefiran extract," Int J Antimicrob Agents, vol. 25, no. 5, pp. 404-8, 2005. [31] K. L. Rodrigues, "A novel beer fermented by kefir enhances anti- inflammatory and anti-ulcerogenic activities found isolated in its constituents," Journal of Functional Foods, vol. 21, pp. 58-69, 2016. [32] A. Mikyška, D. Matoulková, M. Slabý, P. Kubizniaková, and I. Hartman,
"Characterization of the strains isolated from kefir grains and their use for the production of beer-based fermented beverages from nontraditional cereals," Kvasny Prum., vol. 61, pp. 311-319, 2015.
[33] Y. Vandenplas, G. Huys, and G. Daube, "Probiotics: an update," J Pediatr
(Rio J), vol. 91, no. 1, pp. 6-21, 2015.
[34] C. E. Hoesl and J. E. Altwein, "The probiotic approach: An alternative treatment option in urology," Eur Urol, vol. 47, no. 3, pp. 288-96, 2005.
72 [35] G. Caramia, A. Atzei, and V. Fanos, "Probiotics and the skin," Clinics in
dermatology, vol. 26, pp. 4-11, 2008.
[36] I. Hojsak, S. Abdović, H. Szajewska, M. Milosević, Z. Krznarić, and S.
Kolacek, "Lactobacillus GG in the prevention of nosocomial
gastrointestinal and respiratory tract infections," Pediatrics, vol. 125, no. 5, pp. e1171-7, 2010.
[37] S. Sohrabvandi, S. Razavi, M. Mousavi, and A. Mortazavian, "Viability of probiotic bacteria in Low alcohol- and Non-alcoholic beer during
refrigerated storage," The Philippine agriculturist, vol. 93, pp. 24-28, 2010.
[38] F. B. Haffner and A. Pasc, "Freeze-dried alginate-silica microparticles as carriers of probiotic bacteria in apple juice and beer," LWT, vol. 91, pp. 175-179, 2018.
[39] M. Z. Alcine Chan, J. Y. Chua, M. Toh, and S. Q. Liu, "Survival of probiotic strain Lactobacillus paracasei L26 during co-fermentation with
S. cerevisiae for the development of a novel beer beverage," Food Microbiol, vol. 82, pp. 541-550, 2019.
[40] A. Capece, "Use of Saccharomyces cerevisiae var. boulardii in co- fermentations with S. cerevisiae for the production of craft beers with potential healthy value-added," International Journal of Food
Microbiology, vol. 284, pp. 22-30, 2018.
[41] Commission regulation (EC) No 41/2009 of 20 January 2009 concerning
the composition and labelling of foodstuffs suitable for people intolerant to gluten, C. A. Commission, Official Journal of the European Union,
2009.
[42] P. Dostálek, I. Hochel, E. Méndez, A. Hernando, and D. Gabrovská, "Immunochemical determination of gluten in malts and beers," Food
Addit Contam, vol. 23, no. 11, pp. 1074-8, 2006.
[43] C. Klose, "Brewing with 100% Oat Malt," Journal of the Institute of
Brewing, vol. 117, 2011.
[44] N. Velić, "Chestnut in beer production: Applicability and effect on beer
73 [45] K. Bellut and E. Arendt, "Chance and Challenge: Non- Saccharomyces
Yeasts in Nonalcoholic and Low Alcohol Beer Brewing – A Review,"
Journal of the American Society of Brewing Chemists, vol. 77, pp. 1-15,
2019.
[46] S. Sohrabvandi, M. Mousavi, S. Razavi, A. M. Mortazavian, and K. Rezaei, "Alcohol-free Beer: Methods of Production, Sensorial Defects, and Healthful Effects," Food Reviews International - FOOD REV INT, vol. 26, pp. 335-352, 2010.
[47] L. C. Salanță, "Non-Alcoholic and Craft Beer Production and Challenges," Processes, vol. 8, no. 11, 2020.
[48] E. International, "Non Alcoholic Beer - Market Sizes - Historical - Total Volume/Total Value RSP," Euromonitor International, 2018.
https://go.euromonitor.com/passport.html
[49] K. Ahuja and A. Rawat, "Non-Alcoholic Beer Market," Global Market Insights, 2019. https://www.gminsights.com/industry-analysis/non-
alcoholic-beer-market
[50] C. Zufall and K. Wackerbauer, "Process engineering parameters for the deaIcoholisation of beer by means of falling film evaporation and its influence on beer quality," Monatsschrift fü Brauwissenschaft, vol. 53, pp. 124-137, 2000.
[51] T. Brányik, D. P. Silva, M. Baszczyňski, R. Lehnert, and J. B. Almeida e
Silva, "A review of methods of low alcohol and alcohol-free beer
production," Journal of Food Engineering, vol. 108, no. 4, pp. 493-506, 2012.
[52] R. Muller, "The production of low-alcohol and alcohol-free beers by limited fermentation," Ferment, vol. 3, no. 4, pp. 224-230, 1990. [53] L. Narziss, H. Miedener, E. Kern, and M. Leibhard, "Technology and
composition of non-alcoholic beer. Processes using arrested
fermentation," Brauwelt International (Germany, F.R), no. 4, pp. 396-410, 1992.
74 [54] J. Plaza-Diaz, F. J. Ruiz-Ojeda, M. Gil-Campos, and A. Gil, "Mechanisms
of Action of Probiotics," Advances in nutrition (Bethesda, Md.), vol. 10, no. suppl_1, pp. S49-S66, 2019.
[55] L. V. McFarland, "Chapter 18 - Common Organisms and Probiotics:
Saccharomyces boulardii," in The Microbiota in Gastrointestinal Pathophysiology, M. H. Floch, Y. Ringel, and W. Allan Walker Eds.
Boston: Academic Press, pp. 145-164, 2017.
[56] M. Altmann, "The Benefits of Sacchromyces boulardii " in The Yeast Role
in Medical Applications, 2017.
[57] L. Du, R. Hao, D. Xiao, L. Guo, and W. Gai, "Research on the
Characteristics and Culture Conditions of Saccharomyces boulardii,"
Advanced Materials Research, vol. 343-344, pp. 594-598, 2011.
[58] M. Lukaszewicz, "Saccharomyces cerevisiae var. boulardii – Probiotic Yeast," pp. 385-397, 2012.
[59] P. Georgiana, C.-T. Buruiană, and C. Vizireanu, "Effects of S. cerevisiae
var. boulardii in gastrointestinal disorders," Journal of Agroalimentary
Processes and Technologies, vol. 21, pp. 148-155, 2015.
[60] M. A. Lazo-Vélez, S. O. Serna-Saldívar, M. F. Rosales-Medina, M. Tinoco-Alvear, and M. Briones-García, "Application of Saccharomyces
cerevisiae var. boulardii in food processing: a review," J Appl Microbiol,
vol. 125, no. 4, pp. 943-951, 2018.
[61] S. C. Chandrasekar Rajendran, B. Chamlagain, S. Kariluoto, V. Piironen, and P. E. J. Saris, "Biofortification of riboflavin and folate in idli batter, based on fermented cereal and pulse, by Lactococcus lactis N8 and
Saccharomyces boulardii SAA655," J Appl Microbiol, vol. 122, no. 6, pp.
1663-1671, 2017.
[62] R. Abid, "Probiotic yeast Saccharomyces: Back to nature to improve human health," Journal of Fungi, vol. 8, no. 5, 2022.
[63] J. J. Liu, "A mutation in PGM2 causing inefficient galactose metabolism in the probiotic yeast Saccharomyces boulardii," Appl Environ Microbiol, vol. 84, no. 10, 2018.
75 [64] T. Sweechin, "Bioprocess optimization for biomass production of
probiotics yeast Saccharomyces boulardii in semi-industrial scale,"
Journal of Chemical and Pharmaceutical Research, vol. 7, pp. 122-132,
2015.
[65] G. Perez-Samper, "The Crabtree effect shapes the Saccharomyces
cerevisiae lag phase during the switch between different carbon sources," mBio, vol. 9, 2018.
[66] H. El Enshasy and A. A. Shereef, "Optimization of high cell density cultivation of (Probiotic/Biotherapeutic) yeast Saccharomyces boulardii adapted to dryness stress," Deutsche Lebensmittel-Rundschau: Zeitschrift
für Lebensmittelkunde und Lebensmittelrecht, vol. 104, pp. 389-394,
2008.
[67] L. V. McFarland, "Systematic review and meta-analysis of
Saccharomyces boulardii in adult patients," World J Gastroenterol, vol.
16, no. 18, pp. 2202-22, 2010.
[68] A. van der Aa Kühle, K. Skovgaard, and L. Jespersen, "In vitro screening of probiotic properties of Saccharomyces cerevisiae var. boulardii and food-borne Saccharomyces cerevisiae strains," Int J Food Microbiol, vol. 101, no. 1, pp. 29-39, 2005.
[69] A. Lourens-Hattingh and B. C. Viljoen, "Growth and survival of a probiotic yeast in dairy products," Food Research International, vol. 34, no. 9, pp. 791-796, 2001.
[70] N. Silanikove, G. Leitner, and U. Merin, "The interrelationships between lactose intolerance and the modern dairy industry: Global perspectives in evolutional and historical backgrounds," Nutrients, vol. 7, no. 9, pp. 7312- 7331, 2015.
[71] F. Fratianni, "Fermentation of tomato juice with the probiotic yeast Saccharomyces cerevisiae boulard II," pp. 143-152, 2013.
[72] C. R. Rekha and G. Vijayalakshmi, "Bioconversion of isoflavone
glycosides to aglycones, mineral bioavailability and vitamin B complex in fermented soymilk by probiotic bacteria and yeast," J Appl Microbiol, vol. 109, no. 4, pp. 1198-208, 2010.
76 [73] L. T. Mai, N. T. Hiền, P. T. Thuỷ, N. T. Hằng, and L. T. L. Chi, Các
phương pháp phân tích ngành cơng nghệ lên men. Nhà xuất bản Khoa học
và Kỹ thuật, 2009.
[74] M. KGaA, Manual Analysis Methods for the Brewery Industry. 2018. [75] F. R. Pinu and S. G. Villas-Boas, "Rapid quantification of major volatile
metabolites in fermented food and beverages using Gas Chromatography- Mass Spectrometry," Metabolites, vol. 7, no. 3, 2017.
[76] H. D. Tư, Kỹ thuật phân tích cảm quan thực phẩm. Nhà xuất bản Khoa học và Kỹ thuật Hà Nội.
[77] I. Khatri, R. Tomar, K. Ganesan, G. Prasad, and S. Subramanian,
"Complete genome sequence and comparative genomics of the probiotic yeast Saccharomyces boulardii," Scientific Reports, vol. 7, 2017.
[78] B. Senkarcinova, I. Dias, J. Nešpor, and T. Brányik, "Probiotic alcohol- free beer made with Saccharomyces cerevisiae var. boulardii," LWT, vol. 100, 2018.
[79] G. Y. Ramírez-Cota, E. O. López-Villegas, A. R. Jiménez-Aparicio, and H. Hernández-Sánchez, "Modeling the ethanol tolerance of the probiotic yeast Saccharomyces cerevisiae var. boulardii CNCM I-745 for its
possible use in a functional beer," Probiotics Antimicrob Proteins, vol. 13, no. 1, pp. 187-194, 2021.
[80] R. Mullet, "The effects of mashing temperature and mash thickness on wort carbohydrate composition," Journal of The Institute of Brewing, vol. 97, pp. 85-92, 1991.
[81] D. E. Evans, H. Collins, J. Eglinton, and A. Wilhelmson, "Assessing the impact of the level of diastatic power enzymes and their thermostability on the hydrolysis of starch during wort production to predict malt fermentability," Journal of the American Society of Brewing Chemists, vol. 63, pp. 185-198, 2005.
[82] F. R. Sharpe and D. R. J. Laws, "The essentail oil of hops A review,"
77
PHỤ LỤC
A1. Trình tự gen sau khi giải trình tự ITS
AAAAGAATTATAATTTTGAAATGGGATTTTTTTGTTTTGGCAAG AGCATGAGAGCTTTTACTGGGCAAGAAGACAAAGAGATGGAGAGTCC AGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTC TTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGA CAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTT GCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACA AACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAA TTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGAT CTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTA ATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATT GCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCT TCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTT GAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTC TCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACC AACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGA TAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCA AATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCATAAACCCGGA AGAAAAG
78
A2. Kết quả so sánh trình tự gen trên ngân hàng gen