applicable the functional currency of a foreign operation shall be disclosed specifying the net investment therein when this is not the same as the presentation currency of the annual accounts
The closeness of a foreign sales contract in Binh Minh Household Joint Stock Company
... Effective date: The contract or agreement should have a date stated as the contract date or effective date This date is not necessarily the date when the contract was signed but rather the date from ... their home office is located This designation generally benefits the company because it is operating under these laws already, is familiar with them, and has attorneys who are familiar with them ... by annex of fax Any signature to this contract transmitted by fax shall be deemed as original This contract is made into English originals having the same value and effected from the signing date...
- 41
- 614
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... parallel) at a rate of 30 lLÆmin)1 for (association phase) The dissociation phase was evaluated during the following 10 The vehicle was always injected in parallel-flow channels The running buffer, NaCl ... Biorad) was also used to dilute the analyte All of the assays were performed at 25 °C The sensorgrams (time course of the SPR signal in RU) were normalized to a baseline value of All sensorgram...
- 16
- 560
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... survival Caspases, a family of cysteine acid proteases, are central regulators of apoptosis [12,13] Caspases are routinely used as a measure of apoptosis, in contrast to necrosis Caspase activation ... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... occurs at the intersection of all caspase-dependent pathways and is, therefore, an excellent marker of caspase-dependent apoptotic death We sought to identify whether caspase is activated during...
- 12
- 561
- 0
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... the Protein Data Bank database under the accession number 3NJT Overlay assay Channel analysis Fha30 is a 30-kDa, secreted FHA truncate encompassing the TPS domain and first three repeats It was ... blot with an anti-FhaC serum This antibody was raised in rats against the periplasmic domain of FhaC and prepared by Eurogentec (Seraing, Belgium) The amounts of Fha44 and FhaC were quantified by ... was used as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG...
- 11
- 396
- 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... single AATAAA polyadenylation signal was found 11 nt upstream of the poly (A) tail There was only one stop codon (TAA) at the 3¢ terminus of the ORF The cDNA sequence has been submitted to GenBank ... such as A (Ala) or D (Asp) Only AaHIT4 and BmKAS, a specific anti-insect toxin, also contained a Tyr residue at this position AaHIT4, the unique anti-insect toxin also has a toxic effect on mammals ... treatments has not been established The mechanisms underlying these alterations in cardiovascular function remain unclear It has been suggested that the cardiovascular effects of scorpion venom are dependent...
- 8
- 473
- 0
báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt
... the action of the cilia that continue to clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of ... symptoms of maxillary sinusitis including tenderness in the left infraorbital region and nasal stuffiness In this case a small bone window in the lateral wall of the maxillary sinus was performed ... view of the foreign body in the supero medial aspect of the maxillary sinus Intraoperative endoscopic view of the foreign body in the supero medial aspect of the maxillary sinus Figure Intraoperative...
- 5
- 420
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 ... Oligomerization in the context of thermotolerance, as described in this study, is not as thoroughly investigated as the association between quaternary structure and chaperoning in vitro, where an increase...
- 10
- 495
- 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCG TTAACAGCTGTGAGTGTGCTCAGGAGAGCGAG CCAACATAAGATGGTCATGGTGGCG-3¢ (In order to avoid homologous recombination between the two ... a terminal Gal residue of asialofetuin and asialo -a1 -acid glycoprotein As shown in Table 1, the best acceptor substrate of hST6Gal II was the free disaccharide Galb1–4GlcNAc, lacto-N-neotetraose ... data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and...
- 12
- 584
- 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV Mrcp19k Bacp19k ... contact with the material surface The adsorption to alkylated gold was two-thirds of that to bare gold It is not clear from this study whether this was due to an enlarged contact area of the ... Chemical Industries (Osaka, Japan) and Takara Shuzo Co (Otsu, Japan) Twofold-concentrated ASW was prepared by dissolving ASW (Senju Seiyaku Co., Osaka, Japan) in ultrapure water, which was ultrafiltered...
- 11
- 488
- 0
Establishment of a Co-operation Network of Passive House Promoters (PASS-NET) pptx
... realisation of the database, as well as the consolidation of the both databases and the unlimited operation of the European database b Cooperation with the other PASS -NET partners This secures the internationality ... International Passivhaus database actors Establishing of a platform for know-how transfers of international Passivhaus actors trough: a Core-cooperation of the IG Passivhaus Austria and the Passivhaus ... innovation and technology In particular, the database is to serve as an international acknowledged database for decision-makers of the European Commission and the European Parliament as well as all...
- 64
- 279
- 0
Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf
... TCCATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATAT CCCGGGTTAAAATTTAAACAATCCTG-3¢ N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): ... 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT ... PCR amplified from a full size cDNA clone using the following primer pairs Abz1(1–138): 5¢-TA TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG...
- 11
- 536
- 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
... be the case This may be relevant to the calculation of smelt AFP activity The activity of smelt AFP is about one-third of that of sea raven AFP on a monomer concentration basis [11] As sea raven ... concentrations of BS3, the disappearance of the monomer band corresponded to the gradual increase in intensity of a higher-molecular-mass band The apparent molecular mass of this band was 38 kDa, ... As the molecular mass of the protein on SDS/PAGE is 22 kDa, the value obtained by gel filtration is consistent with a dimer There was no evidence of larger aggregates, as determined by absorbance...
- 8
- 518
- 0
Báo cáo y học: "Structural and functional map of a bacterial nucleoid" doc
... expressed at the beginning of the exponential growth phase and regulates the transcription of the ribosomal genes, among others On this basis, Vora et al [3] hypothesize that tsEPODs may comprise the ... should be to obtain chromosomal occupancy profiles at different growing phases - that is, lag, early, mid, and late exponential and early and late stationary phases With these data, investigators ... should be able to obtain a dynamic picture of protein occupancy for NAPs along the different growth phases of a bacterial culture As each NAP is produced maximally at different growth phases,...
- 4
- 307
- 0
báo cáo khoa học: " Isolation and functional characterization of a cDNA coding a hydroxycinnamoyltransferase involved in phenylpropanoid biosynthesis in Cynara cardunculus L" potx
... 5'-GGGTTTCATATGAAGATCGAGGTGAGAGAA-3' 5'-CGGGATCCTTAGATATCATATAGGAACTTGC-3' 5'-TCCCCAATTTTCACACAC-3' 5'-AAGTGCCGATTTTAGATAAT-3' detected when the chlorogenate was incubated with CoEnzyme A in presence of ... 5'-TTTTATCCNATGGCNGGDMG-3' 5'-AACGTTHCCRAARTANCC-3' 5'-ATGGCAACACTGTCAATTA-3' 5'-CCCGACGATCAGGATA-3' 5'-ACCGCCGGGATGAGTT-3' 5'-CCGCCTCCACGAACAA-3' 5'-TTCCGTTTCGTTTCTTCAA-3' 5'-TGGCCATAACCATTTTAGATAT-3' ... an Arabidopsis thaliana HCT (80% identity and 89% similarity) (Fig 2) More distantly related acyltransferases are those annotated as hydroxycinnamoyl-CoA quinate: hydroxycinnamoyl transferase...
- 14
- 535
- 0
Functional effects of a novel BIM deletion polymorphism in mediating resistance to tyrosine kinase inhibitors in cancer
... the last kinase in this cascade is known as the MAP kinase, an example of which is extracellular signal-regulated kinase (ERK) (Figure 3)25 The activation of the MAP kinase pathway mediated by EGFR ... MAP kinase pathway The MAP kinase pathway consists of a phosphorylation cascade that regulates gene transcription The phosphorylation cascade consists of three protein kinases, in which the last ... diagnosis103; 104 This scoring system is based on clinical and laboratory features, such as the percentage of blast cells, the size of the spleen as well as the platelet count, to assess a CML patient’s...
- 169
- 224
- 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor
... of PPARγ agonists for the treatment of diabetes and the use of PPARα agonists for the treatment of dyslipidemia and coronary heart disease makes it likely that dual PPARα and PPARγ agonists might ... region of the PPARα has been observed in Singapore and other East-Asian populations with relatively high allelic frequencies This variant was associated with perturbations in plasma lipid levels and ... PPRE, the regulation of PPAR expression, the post-translational modifications of PPAR; and the association with coregulators 1.4.1 Action of AF-1 and AF-2 The AF-1 at the N-terminal of the PPAR TAD...
- 263
- 267
- 0
Genomic organization and functional characterization of a novel cancer associated gene u0 44
... However, this DNA damage-mediated apoptosis signals can be attenuated and this may be a result of resistance, which is a major limitation of cisplatin-based chemotherapy There are several mechanisms ... a key obstacle for the treatment of patients with advance ovarian cancer 1.3.3 Cisplatin Mode of Action and Molecular Basis of Resistance Cisplatin belongs to the chemotherapy group of alkylating ... treatment of ovarian cancer is based on the staging of the disease, which reflects the extent and spread of the cancer to other parts of the body 1.3.1 Surgery and Chemotherapy for Ovarian Cancer...
- 198
- 331
- 0
Functional studies of a type III and a novel secretion system of edwardsiella tarda
... types of catalaseperoxidase (Kat1-3) of which KatB being the major catalase enzyme (Srinivasa Rao et al., 2003b) KatB was required for E tarda survival and replication in phagocyte-rich organs ... humans E tarda is the only species of this genus that can infect humans and cause diseases in humans Association of E tarda with human diseases was first reported in 1969 (Jordan and Hadley, 1969) ... speculated to help in bacterial adherence to host cells Clinical E tarda isolates were invasive in a HeLa cell assay (Marques et al., 1984) Janda et al (199 1a) reported that E tarda was able to penetrate...
- 205
- 618
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus Iso1 ... and the pI was predicted to be 5.80 by the use of the N-D-AAase amino acid composition in the DNASIS software package Sequence comparison of the V paradoxus N -D-AAase protein Alignment by the ... alignment analysis of the other N-D-AAase protein gene sequences in the GenBank database A single band was obtained after PCR amplification with these degenerate primers using the plasmid pBK-damD4 as...
- 11
- 656
- 0
''''This Is Not a Game'''': Immersive Aesthetics and Collective Play pdf
... positions the Nokia Game experience as a game; consider the paraphrase, "Really, it's a game." As opposed to the Beast, there is no real effort to disguise the game's gameness This is especially evident ... that nothing about this virtual play was simulated The computer-driven alternate reality the Beast created was make-believe, but every aspect of the player's experience was, phenomenologically ... perception of New York City's landscape yielded a merged terrain, rather than separate perceptions of a play and a real Manhattan Although the pervasive elements of the Beast (phone calls, PDA downloads,...
- 10
- 583
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25