Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf

Eur J Biochem 271, 4534–4544 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04413.x Functional dissection of a small anaerobically induced bZIP transcription factor from tomato Simone Sell and Reinhard Hehl Institut fuăr Genetik, Technische Universitaăt Braunschweig, Germany A small anaerobically induced tomato transcription factor was isolated from a subtractive library This factor, designated ABZ1 (anaerobic basic leucine zipper), is anaerobically induced in fruits, leaves and roots and encodes a nuclear localized protein ABZ1 shares close structural and sequence homology with the S-family of small basic leucine zipper (bZIP) transcription factors that are implicated in stress response Nuclear localization of ABZ1 is mediated by the basic region and occurs under normoxic conditions ABZ1 binds to G-box-like target sites as a dimer Binding can be abolished by heterodimerization with a truncated protein retaining the leucine zipper but lacking the DNA binding domain The protein binds in a sequence specific manner to the CaMV 35S promoter which is down regulated when ABZ1 is coexpressed This correlates with the anaerobic down regulation of the 35S promoter in tomato and tobacco These results may suggest that small bZIP proteins are involved in the negative regulation of gene expression under anaerobic conditions Plant survival under adverse environmental situations is largely dependent on their adaptation strategies Anaerobiosis or low oxygen conditions occur when plants are subjected to flooding or to waterlogging of the soil Under these conditions oxygen is rapidly consumed by microorganisms and plant roots [1] Plants react to these conditions with a variety of responses To compensate the decrease in energy production and the lack of NADH regeneration, the rate of glycolysis is increased and fermentative pathways are induced [1] Furthermore, plants can respond to flooding with the induction of aerenchyma in the root cortex and hyponastic growth to push their vital organs above water level [2,3] The reactions of plants towards a low oxygen environment entail a significant reprogramming of gene expression which comprises transcriptional induction and selective translation of mRNAs for anaerobic proteins [4] Plants probably sense the lack of oxygen as an electron acceptor in the mitochondria Mitochondria are implicated in an early response because they release calcium to the cytosol in response to anaerobiosis [5] The complete signal transduc- tion pathway has yet to be elucidated Recent data suggest that O2 deprivation stimulates a G-protein signal transduction pathway that results in the induction of alcohol dehydrogenase (ADH) expression [6] Other components of the signal transduction pathway may comprise 14-3-3 proteins, calcium dependent kinases and several transcription factors [7–9] ADH, one of the most extensively studied genes that is induced during oxygen deprivation, is probably induced by the transcription factor AtMYB2 in Arabidopsis thaliana [10] A comprehensive analysis of low oxygen regulated gene expression was recently reported for A thaliana [11] In a microarray containing 3500 cDNA clones, 210 differentially expressed genes were identified Among these were 21 nonredundant down regulated genes In contrast to transcriptional induction and post-transcriptional regulation, little is known about low oxygen mediated down regulation of gene expression In the present work, a small basic leucine zipper (bZIP) transcription factor (TF) designated ABZ1, was isolated from a tomato cDNA library enriched for anaerobically induced genes This TF was studied in detail In addition to binding site specificity, nuclear localization, identification of DNA– and protein–protein binding domains it is shown that efficient DNA binding of a heterodimer requires two DNA binding domains in the interacting proteins The putative role of ABZ1 in the anaerobic response pathway is discussed Correspondence to R Hehl, Institut fur Genetik Technische ă Universitat Braunschweig Spielmannstr 7, D-38106 Braunschweig, ă Germany Fax: +49 531 391 5765, Tel.: +49 531 391 5772, E-mail: R.Hehl@tu-braunschweig.de Abbreviations: ADH, alcohol dehydrogenase; as-1, activation sequence-1; bZIP, basic leucine zipper; DAPI, 4¢-6-diamidino-2phenylindole; EMSA, electrophoretic mobility shift assay; GUS, b-glucuronidase; LUC, luciferase; NLS, nuclear localization signal; RBSS, random binding site selection Note: A website is available at http://www.tu-braunschweig.de/ifg/ag/ hehl Note: The EMBL/GenBank accession number of ABZ1 is AJ715788 (Received July 2004, revised 30 September 2004, accepted October 2004) Keywords: anaerobiosis; bZIP; DNA binding; Lycopersicon esculentum; transcription factor Materials and methods Tomato cDNA library construction and screening A cDNA library from tomato, Lycopersicon esculentum cv Micro-Tom [12], was generated in plasmid pSport1 using the Invitrogen (Karlsruhe, Germany) ƠSuperScriptTM Plasmid System with Gatewa Technology for cDNA Ó FEBS 2004 Properties of a small bZIP protein from tomato (Eur J Biochem 271) 4535 Synthesis and CloningÕ according to the protocol of the supplier Poly(A)+ RNA (5 lg) isolated from fruits, roots, leaves, and stems of anaerobically induced tomato plants was employed for cDNA synthesis The plants were grown in a greenhouse and were  months old Anaerobic incubations were carried out in an airtight glass container (Merck, Darmstadt, Germany) together with Anaerocult A (Merck) for 20 h in a light chamber (12 : 12 h light/ darkness) Screening of the library and all other recombinant DNA work was done according to standard protocols [13] Sequence analysis of cDNA clones and other in vitro constructs used in this work was performed by Seqlab Company, Gottingen, Germany The sequences were anaă lysed for subcellular localization signals using PSORT at http://psort.nibb.ac.jp/form.html Sequence comparisons and alignments were performed at http://www.ncbi.nlm nih.gov/BLAST and http://www.ch.embnet.org/software/ ClustalW.html The phylogenetic tree was generated using CLUSTALX 1.81 [14] RNA isolation and Northern blot hybridizations Total RNA was isolated according to a previously published procedure [15] To isolate poly(A)+ RNA, mg total RNA was used with the OligotexTM mRNA Midi Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol Northern blots were performed according to standard protocols [13] Total RNA (10 lg) was used for RNA gel electrophoresis and radioactive probes were generated using the HexaLabelTM DNA Labeling Kit from MBI Fermentas (St Leon-Rot, Germany) Recombinant protein production and purification For the expression in and purification of recombinant proteins from Escherichia coli the QIAexpressionistTM system from Qiagen was used The ABZ1 coding region and two truncated derivatives from ABZ1 were PCR amplified from a full size cDNA clone using the following primer pairs Full size, ABZ1(1–138): 5¢-TATAGGA TCCATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATAT CCCGGGTTAAAATTTAAACAATCCTG-3¢ N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA ATACCTGAGCCTATCAGTC-3¢ The BamHI and SmaI sites within the primers (underlined) were used to directionally clone the amplified DNA fragments into plasmid pQE-30 Prior to this, the amplified DNA fragments were cloned into pCRÒ2.1 (Invitrogen) and sequenced Recombinant pQE-30 plasmids were transformed together with the repressor plasmid pREP4 (Qiagen) in BL21-CodonPlus(DE3)-RIL E coli cells (Stratagene, Amsterdam, the Netherlands) Induction of protein expression and purification over Ni-nitrilotriacetic acid columns were performed according to The QIAexpressionistTM manual Because the recombinant proteins were mainly localized in the insoluble fraction, a previously reported method that includes steps for de- and re-naturing of the protein was employed [16] Protein concentrations were determined according to Bradford [17] Electrophoretic mobility shift assays and random binding site selection Electrophoretic mobility shift assays (EMSA) were carried out according to Ausubel et al [18] The four probes used for EMSA, RBSS1, 1.1, and 6.1 are shown in Table These probes were used because they represent different classes of binding sites RBSS1-Mu, containing a mutation in the ACGT core sequence (GGTTGATTAGGGAA), was used as a nonspecific competitor All fragments are bordered by primer binding sites 5¢-CAGGTCAGT TCAGCGGATCCTGTCG-3¢ and 5¢-GCTGCAGTTG CACTGAATTCGCCTC-3¢ that were also used for PCR amplifications during the random binding site selection (RBSS) assay Random binding site selection was performed according to Ausubel et al [18] Oligonucleotides consisted of five random nucleotides 5¢ and 3¢ of the ACGT core sequence bordered by the above mentioned primer binding sites Oligonucleotides were amplified in the presence of [32P]dCTP[aP] and incubated with recombinant ABZ1 After electrophoretic separation the bound oligonucleotides were eluted from the gel and subjected to another round of PCR amplification, ABZ1 binding, and EMSA Following five rounds of selection the amplified fragments were cloned into pCRÒ2.1 and sequenced Another fragment used for EMSA was a 100 bp fragment from the CaMV 35S promoter that was amplified by PCR using the primers 5¢-TATGTCGACCGAG GAACATAGTGGAAAAAG-3¢ and 5¢-ATAGTCGACT GGGATTGTGCGTCATCCCTT-3¢ Fragments for EMSA were amplified by PCR from recombinant pCRÒ2.1 (RBSS1, 1.1, 6.1, and RBSS1-Mu) and pRT103-GUS (b-glucuronidase) [19] in the presence of [32P]dCTP[aP] Binding reactions were carried out in 15 lL 10 mM Tris/HCl pH 7.5; 40 mM NaCl; mM EDTA; 4% (v/v) glycerol; 10 mM 2-mercaptoethanol; 10 mM dithiothreitol; mM phenylmethanesulfonyl fluoride; lg/15 lL poly(dI-dC) [20] for 30 at room temperature The amounts of recombinant protein, radioactively labelled Table Sequences obtained from a random binding site selection (RBSS) assay with ABZ1 RBSS1, 1.1, and 6.1 are among the 17 selected binding sites Nucleotide frequency at each position is shown relative to the center of the palindromic core K ¼ G/T, N ¼ A/C/G/ T Below the sequences the frequency of the nucleotides A, C, G and T at each position of the 17 selected binding sites is shown A consensus sequence was derived from these frequencies –5 )4 )3 )2 )1 RBSS1 RBSS1.1 RBSS5 RBSS6.1 A C G T Consensus G G T G – K G G G G 1 10 K T G C A 4 N T C A T 2 T G C C G – K Core A A A A 17 – – – A C C C C – 17 – – C G G G G – – 17 – G +1 +2 +3 +4 +5 T T T T – – – 17 T G G G G – 16 – G G G T T – – 12 G G T C A N A G G G 5 N A T C G N 4536 S Sell and R Hehl (Eur J Biochem 271) fragment and competitor DNA is given in the relevant figure legends After addition of lL nondenaturing 5· loading dye [50 mM EDTA pH 8.0; 50 mM Tris/HCl pH 8.0; 50% (v/v) glycerol; 12.5 mg/10 mL bromphenolblue; 12.5 mg/10 mL xylencyanol] the binding assay was loaded on a native polyacrylamide gel (5–9%) After electrophoresis in 1· Tris/glycine the gel was dried under vacuum and exposed to X-ray films Nuclear localization assays Plasmid constructs for the analysis of nuclear localization were generated by fusing full size ABZ1 and truncated derivatives of ABZ1 in-frame upstream to the amino terminal end of the uidA gene in pRT103-GUS [19] The ABZ1 coding region and three truncated derivatives from ABZ1 were PCR amplified from a full size cDNA clone using the following primer pairs Abz1(1–138): 5¢-TA TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites within the primers (underlined) were used to directionally clone the amplified DNA fragments into plasmid pRT103-GUS The resulting clones were subsequently sequenced Layers of onion epidermal cells were placed on Murashige–Skoog media containing 3% (w/v) sucrose and transformed by particle bombardment with recombinant ABZ1-GUS constructs Loading of the gold particles was performed according to the CaCl2/spermidin protocol [21] Particle bombardment of epidermal cell layers was performed with 600–700 p.s.i using the Du Pont PDS-1000 particle delivery system [22] After bombardment the tissue was incubated at 24 °C for 24 h in a light chamber (12 : 12 h light/darkness) The histochemical GUS assay was performed by incubating the tissue in lgỈmL)1 5-bromo-4-chloro-3-indolyl-b-glucuronic acid (X-Gluc) in 50 mM NaPO4 pH 7.0; mM EDTA; 0.1% (v/v) Triton X-100; mM K-ferrocyanid; mM K-ferricyanid for h at 37 °C [23] For microscopy, tissues were transferred into 50 mM NaPO4 pH 7.0 For staining of the nuclei, tissues were treated by adding lgặmL)1 4Â-6-diamidino-2-phenylindole (DAPI) and incubated for 15 at room temperature Light microscopy was carried out with a fluorescent microscope (Axioplan 2, Zeiss, Jena, Germany) using a 360–370 nm filter for DAPI stained tissue Transient gene expression analysis in tobacco and tomato leaves For transient gene expression analysis four different effector plasmids were constructed All constructs are based on plasmid pVKH-35S-pA1 (kindly provided by D Groòkopf, Max-Delbruckă Laboratorium, Koln, Germany) pVKH-35S-pA1 harbours ă ể FEBS 2004 a CaMV 35S promoter and a poly(A)+ signal separated by a cloning linker The coding region of ABZ1 was released with BamHI and SmaI from a recombinant pCRÒ2.1 plasmid that harboured the complete ABZ1 coding region (see above) This fragment was subcloned into pVKH-35S-pA1 which was digested with BamHI and HindIII in which the HindIII site has been filled in This resulted in effector construct designated pVKH-35S-ABZ1pA1 To generate pVKH-35S-AD-ABZ1-pA1 the activation domain of GAL4 was amplified from pGADT7-Rec (Clontech, Heidelberg, Germany) The following primers were used to amplify the activation domain: 5¢-TATAGGATCC ATGGCCAATTTTAATCAAAGTGGGA-3¢ and 5¢-AT ATGGATCCCTCTTTTTTTGGGTTTGGTGGGGT-3¢ The amplified fragment was cut with BamHI (restriction site is underlined in the primers) and cloned into BamHI digested pVKH-35S-ABZ1-pA1 The orientation of the insert and the integrity of the construct was analysed by restriction digest and sequencing The two effector plasmids pVKH-C1-ABZ1-pA1 and pVKH-C1-AD-ABZ1-pA1 were generated by replacing the 35S promoter with the C1 promoter from the sugar beet cab11 gene The 1097 bp long C1 promoter was released with HindIII and BamHI from plasmid pC1L-1097 (kindly provided by D Stahl, Planta GmbH, Einbeck, Germany) After HindIII digestion, the ends were filled in so that the released fragment harbours one blunt and one BamHI end This allowed the directional cloning of the C1 promoter into pVKH-35S-ABZ1-pA1 and pVKH-35S-AD-ABZ1-pA1 from which the 35S promoter was released with SacI and BamHI and in which the SacI site was filled in to generate a blunt end As a reporter, a 35S-uidA construct was generated by removing the TATA box from plasmid pBT10-TATAGUS [24] with NcoI and PstI and replacing it with a 500 bp NcoI/PstI CaMV 35S promoter fragment The resulting plasmid is designated pBT10-35S-GUS For transformation controls, a luciferase gene was used that was either expressed from the 35S promoter in pRT101-LUC [19] or from the C1 promoter in pC1L-1097 For transformation, leaf discs with a diameter of cm were cut from tobacco leaves and placed on wet 3MM Whatman paper Equimolar amounts of effector, reporter and control plasmids were loaded onto gold particles according to standard protocols [21] Particle bombardment was performed with 1100 p.s.i using the Du Pont PDS-1000 particle delivery system [22] After bombardment the tissue was incubated at 24 °C for 24 h in a light chamber (12 : 12 h light/darkness) For protein extraction 0.3 g of tissue was homogenized with liquid nitrogen and by adding of 100 lL extraction buffer (0.1 M NaH2PO4 pH 7.8; mM dithiothreitol) After centrifugation for 10 with 25 500 g at °C the supernatant was used for quantitative GUS and luciferase assays Protein concentrations were determined according to Bradford [17] The determination of GUS activity was performed according to Jefferson & Jefferson et al [25,26] Four hundred and fifty microliters of GUS-reaction buffer [1 mM 4-methyl-umbelliferyl-b-D-glucuronide; 50 mM NaPO4 pH 7.0; 10 mM EDTA; 0.1% (v/v) Triton X-100; 0.1% (v/v) N-laurylsarcosine; 10 mM 2-mercapto- Ó FEBS 2004 Properties of a small bZIP protein from tomato (Eur J Biochem 271) 4537 ethanol] were prewarmed to 37 °C and 50 lL protein extract was added to start the reaction A blank value was determined by transferring 50 lL of the reaction after into 950 lL stop-buffer (0.2 M Na2CO3) Additional aliquots were transferred into stop-buffer after 20, 40 and 60 min, respectively The extinction generated by the reaction product 4-MU was measured in a spectral photometer (Kontron Instruments, Eching, Germany, SFM 25; excitation 365 nm; emission 455 nm) to determine the relative fluorescence units of the generated 4-MU per and lg protein These values were corrected with the values obtained for the transformation control plasmid expressing the luciferase gene [27] For luciferase assays, 50 lL protein extract was transferred to 350 lL luciferase buffer (25 mM glycylglycine; 15 mM MgSO4; mM ATP pH 7.8) After injecting 150 lL substrate solution (0.2 mM luciferin in 25 mM gycylglycine pH 7.8) the emitted photons were measured in a luminometer in a time interval of 10 s (Berthold Lumat 9501; Bad Wildbad, Germany) The determination of the relative GUS activity using the luciferase values were performed as described previously [24,28] The resulting values were used to display the GUS activity of the different transformations relative to the GUS activity obtained without effector plasmids which was set to 100% (see below) For the determination of the relative expression strength of the CaMV 35S promoter under aerobic and anaerobic conditions in tobacco and tomato, a previously reported approach was employed [29] As a reporter a 35S-uidA construct was generated by removing the TATA box from plasmid pBT10-TATA-GUS [24] with NcoI and PstI and replacing it with a 500 bp NcoI/PstI CaMV 35S promoter fragment The resulting plasmid is designated pBT10-35SGUS After bombardment of leaf discs with equimolar amounts of pBT10-35S-GUS and pRT101-LUC [19], two Fig cDNA sequence and deduced amino acid sequence of the ABZ1 gene The138 amino acid long sequence of ABZ1 (nucleotide positions 597–1010) harbours a basic leucine zipper domain (bold) that contains a putative bipartite nuclear localization signal (double underlined) The single amino acids that are part of the leucine zipper are underlined The 30 amino acid long sequence encoded by the upstream open reading frame (nucleotide positions 358–447) harbours several amino acids (bold) that are conserved in other upstream open reading frames of the leaf discs from the same bombardment were incubated aerobically and the other two were incubated anaerobically in an airtight glass container (Merck) together with Anaerocult A (Merck) Incubation was carried out for 24 h in a light chamber (12 : 12 h light/darkness) Luciferase activity, b-glucuronidase activity, and the determination of the relative b-glucuronidase activity were performed as described [29] Results ABZ1 belongs to a family of small bZIP transcription factors and is anaerobically induced in fruits, roots, and leaves Suppression subtractive hybridization was employed for the isolation of cDNA fragments for anaerobically induced genes from tomato cv Micro-Tom (S Sell & R Hehl, unpublished observations) A full size clone was isolated for a cDNA fragment that is homologous to bZIP transcription factors The cDNA is 1216 base pairs long, which includes a poly(A) tail of 20 base pairs Figure shows the cDNA that contains a 596 bp leader encoding a short 30 amino acid long peptide reminiscent of upstream open reading frames found in other TFs [30,31] The 596 bp leader is followed by 414 bp coding region and 186 bp 3¢ untranslated sequence The 414 bp coding region translates into a 138 amino acids long protein with a proposed molecular mass of 15.4 kDa Figure shows that the protein harbours a basic region followed by a leucin zipper consisting of five leucines and one isoleucine that are spaced exactly by six amino acids The basic region also harbours a putative nuclear localization signal (see below) The gene for the small bZIP protein from tomato was designated ABZ1 for anaerobic basic leucine bZIP 4538 S Sell and R Hehl (Eur J Biochem 271) Ó FEBS 2004 Fig Anaerobiosis specific expression of ABZ1, in tomato Total RNA from fruits (lanes and 2), leaves (lanes and 4), and roots (lanes and 6) that were either prepared from aerobic organs (lanes 1, 3, and 5) or anaerobically incubated organs (lanes 2, 4, and 6), were hybridized with a cDNA fragment from the ABZ1 gene A single 1.2 kb transcript hybridizes with the probe Staining of the gels prior to blotting indicates equal loading of the RNA To investigate the spatial expression of ABZ1, RNA blot hybridizations were carried out Total RNA from aerobically and anaerobically treated organs from tomato was hybridized with the ABZ1 cDNA fragment isolated in the differential screen for anaerobically induced genes Figure shows that the gene is anaerobically induced in fruits, leaves, and roots of tomato The ubiquitous nature of the anaerobic induction of ABZ1 may suggest a more general role in regulating anaerobic gene expression Phylogenetic analysis using the basic and leucine zipper domains of 16 bZIP transcription factors shown in Fig indicates that ABZ1 is most closely related to BZI-4 from tobacco [32], and belongs to a family of small bZIP proteins that are often induced upon environmental stress [31] For example, maize LIP15 and rice LIP19 are low temperature induced bZIP transcription factors that share 68.9% sequence identity at the amino acid level [33,34] BZI-4 from tobacco is transcribed specifically in the stamen, the petals and the pistils of the tobacco flower [32] Fig Phylogenetic relationship of ABZ1 with other bZIP proteins A phylogenetic tree was constructed by the neighbor joining method with the basic leucine zipper region of 16 different bZIP proteins Zm, Zea mays; Os, Oryza sativa; Nt, Nicotiana tabacum; Le, Lycopersicon esculentum; Am, Antirrhinum majus; Pc, Petroselinum crispus; At, Arabidopsis thaliana The bZIP proteins compared are BZI-4, BZI-3, and BZI-2 [32], tbz17 [53], bZIP911 and bZIP910 [30], CPRF6 [54], mLIP15 [33], LIP19 [34], BZI-1 [55] The five most similar Arabidopsis proteins were also included and the Arabidopsis genome identification number provided At3g62420 corresponds to AtbZIP53, At1g75390 to AtbZIP44, At2g18160 to AtbZIP02, and At4g34590 to AtbZIP11 [31] ABZ1 is underlined The scale represents the frequency of amino acid changes Bootstrap values are indicated The basic domain confers nuclear localization of ABZ1 For gene expression regulation ABZ1 needs to be imported into the nucleus Using bioinformatic tools it was found that ABZ1 harbours a putative bipartite nuclear localization signal (NLS) in its basic region between amino acids 25 and 44 (Fig 1) To determine whether this region harbours a functional NLS, nuclear localization was investigated with fusion proteins using the b-glucuronidase (uidA) reporter gene Fusion constructs were made with the whole 138 amino acid long protein, with the 24 and 44 amino terminal and 94 carboxy terminal amino acids, respectively These fusion constructs were transformed by particle bombardment into onion epidermal cells Figure shows that the majority of the GUS protein that is fused with the complete 138 or the amino terminal 44 amino acids of ABZ1 localizes to the nucleus while the GUS protein alone or fused either with the 24 amino terminal or with the 94 carboxy terminal amino acids of ABZ1 does not localize to the nucleus This indicates that ABZ1 harbours the signal for nuclear localization and that a functional NLS is localized within the basic region between amino acids 25 and 44 Furthermore, nuclear localization was achieved under aerobic conditions ABZ1 binding specificity and dimer formation Transcription factors of the bZIP family are known to bind to G-box like sequences [35] To investigate the binding specificity of ABZ1, the protein was expressed in E coli as a His-tag fusion protein The purified protein was employed in a binding site selection experiment in which 17 putative binding sites were identified Table shows the sequence of four binding sites and the frequency of the nucleotides at each position of the 17 selected binding sites Figure 5A shows EMSA for the four individual binding sites RBSS1, 1.1, and 6.1 (Table 1) These four sites are efficiently and specifically bound by ABZ1 while the sequence GGTTGATTAGGGAA that harbours a mutation in the Ó FEBS 2004 Properties of a small bZIP protein from tomato (Eur J Biochem 271) 4539 Fig The basic region of ABZ1 is required for nuclear localization Fusion gene constructs expressing parts of or the whole ABZ1 protein fused to the b-glucuronidase (uidA) reporter gene were transformed by particle bombardment into onion epidermal cells As indicated, the constructs express amino acids 1–24, 1–44, 1–138, and 45–138 from the ABZ1 protein fused in-frame with the uidA gene Transformed cells were subjected to histochemical GUS staining and to a DAPI staining of the nucleus G-box core sequence (RBSS1-Mu) and was used as an unspecific competitor in EMSAs is not bound by ABZ1 (Fig 5A; u Cmp) EMSAs with RBSS1 were subsequently used to analyse specific binding conditions To confirm that the DNA binding domain resides in the basic region, an N-terminally deleted protein was expressed in E coli The deleted protein comprises amino acids 47– 138 Figure 5B shows that the wild type ABZ1 binds efficiently to the RBSS1 sequence while the amino terminally deleted protein does not bind This shows that the binding domain of ABZ1 resides in the amino terminal 46 amino acids Because both proteins harbour the leucine zipper domain, it was analysed if they interact with each other If interaction of the full size and the amino terminally deleted protein leads to a heterodimer that binds DNA, a faster migrating complex would be expected Surprisingly, addition of the truncated ABZ1 protein abolishs binding of full size ABZ1 in a concentration dependent manner (Fig 5B) This indicates that in vitro binding of a dimer requires the presence of a DNA binding domain in each interacting protein This was further investigated using a carboxy terminal deletion of ABZ1 This protein harbours the first 100 amino acids including basic and leucine zipper domains Figure 5C shows that binding of this protein yields a faster migrating complex (C2) compared to the full size ABZ1 (C1) When both proteins are added in equimolar concentrations a third complex is observed that shows an intermediate migrating behaviour (Fig 5C; C1+2) This complex is interpreted to be caused by heterodimer formation between full size ABZ1 and the carboxy terminally deleted ABZ1 To summarize, ABZ1 binds to RBSS1 as a dimer and efficient DNA binding requires a DNA binding domain in both interacting proteins This result may have important implications for the regulatory properties of small bZIP transcription factors ABZ1 binds to the CaMV 35S promoter which is anaerobically down regulated in tobacco and tomato One well known target of bZIP transcription factors is the CaMV 35S promoter [36] Figure 6A,B shows that recombinant ABZ1 binds to a 100 bp fragment from the CaMV 35S promoter which harbours three potential binding sites for ABZ1 One of the three putative binding sites within this fragment is the activation sequence-1 (as-1) between positions )65 and )85 that consists of two imperfect palindromes, with the palindromic centers spaced by 12 bp and which is known to be bound by different tobacco bZIP TFs [37] The random binding site selection experiment indicates a high similarity between RBSS6.1 and the second imperfect palindrome of as-1 EMSA analysis with recombinant ABZ1 revealed three shifted complexes of which two complexes can be completely competed with RBSS1 (Fig 6A) The three shifted complexes observed may be due to differential occupation of ABZ1 binding sites and may represent different numbers of ABZ1 proteins bound to the promoter fragment These results show that ABZ1 can also bind to the CaMV 35S promoter The binding of the anaerobically induced ABZ1 transcription factor to the CaMV 35S promoter indicates that the 35S promoter may be regulated under anaerobic conditions To investigate this proposal, transient gene expression analyses were performed by transforming a CaMV 35S promoter uidA reporter gene construct into tobacco and tomato leaves Subsequent to particle bombardment, leaves were incubated under aerobic and anaerobic conditions followed by a quantitative GUS assay As shown in Fig 6C, in both host tissues, expression of the 35S promoter is significantly lower under anaerobiosis when compared with expression under aerobic conditions In tobacco, anaerobic expression is only 14% relative to aerobic expression while in tomato the difference between anaerobic and aerobic expression is less stringent (52%, Fig 6C) ABZ1 down regulates the CaMV 35S promoter in a transient gene expression assay The effect of ABZ1 on gene expression of the CaMV 35S promoter was analysed with transient expression assays conducted by coexpressing the ABZ1 protein together with the CaMV 35S driven uidA (GUS) gene in tobacco leaves As a transformation standard, a luciferase gene under the control of the sugar beet cab11 promoter was employed This promoter does not harbour G-box binding sites and confers reporter gene expression in tobacco leaves (D Stahl, Ó FEBS 2004 4540 S Sell and R Hehl (Eur J Biochem 271) A B C Fig ABZ1 binding specificity and dimer formation Electrophoretic mobility shift assays with recombinant full size ABZ1(1–138) and two truncated derivatives harbouring amino acids 47–138 and 1–100, respectively Shifted complexes (C) and free probe (P) are indicated (A) Four sequences (probes) derived from a random binding site selection assay (Table 1) were radioactively labelled, and 0.1 ng (4 · 103 c.p.m.) were either incubated with (+) or without (–) ABZ1 As indicated (+/–) specific (RBSS1) or unspecific (u Cmp) competitor was added in a · 105 molar excess and separated on a nondenaturing polyacrylamide gel (10%) (B) Increasing amounts of truncated derivative of ABZ1 harbouring amino acids 47–138 interferes with DNA binding of full size ABZ1 One microgram of protein (+) and increasing amounts of truncated ABZ1 (1.5 lg, 2.1 lg, and 2.5 lg, designated by the elongated triangle) was incubated with 0.05 ng (2 · 103 c.p.m.) radioactively labeled RBSS1 fragment (P) and separated on a nondenaturing polyacrylamide gel (9%) The complex C1 decreases when truncated ABZ1 lacking the first 46 amino acids is incubated in increasing concentrations together with full size ABZ1 (C) Dimer formation between full size ABZ1 and a truncated derivative of ABZ1 harbouring amino acids 1–100 One microgram of ABZ1 (+) and 770 ng truncated ABZ1 (+) was incubated with 0.1 ng (4 · 103 c.p.m.) radioactively labeled RBSS1 fragment and separated on a nondenaturing polyacrylamide gel (9%) A novel complex (C1+2) is observed when truncated and full size ABZ1 are incubated simultaneously with the radioactive probe personal communication) Figure shows that the coexpression of ABZ1 with the 35S-uidA construct leads to down regulation of GUS expression compared to the 35SuidA construct alone (compare 35S-uidA with 35S-ABZ1/ 35S-uidA, Fig 7A) Expression of the 35S promoter is about 40% reduced in the presence of ABZ1 than without When a fusion construct between ABZ1 and the activation domain of GAL4 is coexpressed with the 35S-uidA construct, expression is higher than observed with ABZ1 (compare 35S-ABZ1/35S-uidA with 35S-AD-ABZ1/35SuidA, Fig 7A) To minimize possible autoregulatory effects of ABZ1 on its own expression this experiment was repeated by expressing ABZ1 with the sugar beet cab11 promoter which is void of putative ABZ1 binding sites Figure 7B shows that similar results were obtained compared to ABZ1 expression with the 35S promoter Coexpression of ABZ1 with the 35SuidA construct leads to down regulation of GUS expression compared to the 35S-uidA construct alone (compare 35SuidA with C1-ABZ1/35S-uidA, Fig 7B) Expression of the 35S promoter is again about 40% reduced in the presence of ABZ1 than without When a fusion construct between Ó FEBS 2004 A Properties of a small bZIP protein from tomato (Eur J Biochem 271) 4541 B C Fig Binding of ABZ1 to the CaMV 35S promoter and down regulation under anaerobic conditions (A) An electrophoretic mobility shift assay with a radioactively labeled 100 bp fragment from the CaMV 35S promoter is shown Lanes 1–4 harbour the radioactive probe (P) while in lanes 2–4, 500 ng recombinant ABZ1 was added to the probe (0.3 ng, · 103 c.p.m.) resulting in three shifted complexes (C1, C2, and C3) Specific competition was achieved with a · 103 molar excess of fragment RBSS1 (lane 3) The unspecific competitor in which the ACGT core sequence of fragment RBSS1 was altered to ATTA did not compete for binding when added in a · 103 molar excess (lane 4) (B) The sequence of the 100 bp fragment from the 35S promoter used for EMSA is shown Putative ABZ1 binding sites are underlined The as-1 element between positions )65 and )85 is indicated (C) Expression of a 35S-uidA promoter reporter gene construct after transient bombardment of tobacco and tomato leaves under aerobic and anaerobic conditions The expression strength under anaerobic conditions is displayed relative to the expression under aerobic conditions (100%) The mean values were derived from seven (tobacco) and six (tomato) measurements ABZ1 and the activation domain of GAL4 is coexpressed with the 35S-uidA construct, expression is higher than observed with ABZ1 (compare 35S-ABZ1/35S-uidA with C1-AD-ABZ1/35S-uidA, Fig 7B) In summary, these two independent sets of experiments support the notion that the anaerobically induced ABZ1 transcription factor contributes to the anaerobic down regulation of the 35S CaMV promoter Discussion Anaerobic gene expression regulation The primary plant stress in flooded or compressed soils is conferred by oxygen limitation that is most apparent in below ground tissue Plants respond to oxygen limitation with a significant reprogramming of gene expression These responses usually permit a prolonged survival under these adverse conditions Gene expression regulation involves various mechanisms Many genes are induced by Fig Transient gene expression analysis using reporter and effector gene constructs in particle bombardments on tobacco leaves Reporter construct 35S-uidA harbours the b-glucuronidase gene under the control of the CaMV 35S promoter (A) Relative expression strength of the 35S promoter in the presence and absence of effector constructs under the control of the 35S promoter Expression strength is shown relative to the 35S-uidA expression (100%) The mean value was derived from 10 (35S-uidA), 10 (35S-uidA + 35S-ABZ1), and 12 (35SuidA + 35S-AD-ABZ1) measurements, respectively (B) Relative expression strength of the 35S promoter in the presence and absence of effector constructs under the control of the C1 promoter Expression strength is shown relative to the 35S-uidA expression (100%) The mean value was derived from eight (35S-uidA), seven (35S-uidA + C1ABZ1), and eight (35S-uidA + C1-AD-ABZ1) measurements, respectively transcription factors In Arabidopsis thaliana for example, this is achieved by the low oxygen induction of the AtMYB2 transcription factor which leads to the enhanced expression of the ADH1 gene [10] The extent of post-transcriptional regulation is best illustrated when the limited number of anaerobic proteins detected is compared to the large number of genes that are still transcribed under low oxygen conditions [4,11,38,39] It has long been observed that low oxygen conditions suppress the translation of the majority of mRNAs and increase translation of a particular subset corresponding to anaerobic proteins This may be related to impaired ribosomal RNA transcription and ribosomal protein synthesis under oxygen deprivation [40–42] The analysis of ribosome loading patterns indicated that translational control of anaerobic genes occurs at the initiation and postinitiation phases in a message-specific manner [43] Another post-transcriptional mechanism of low oxygen regulated gene expression is the increased splicing efficiency of specific introns [44,45] In the present study a small anaerobically induced bZIP transcription factor designated ABZ1 was identified from tomato ABZ1 binds to the CaMV 35S promoter (Fig 6A) Ó FEBS 2004 4542 S Sell and R Hehl (Eur J Biochem 271) The promoter activity is reduced under anaerobiosis in tobacco and tomato (Fig 6C) Although many bZIP transcription factors have been isolated from plants, their role in gene expression regulation under low oxygen conditions has not been analysed extensively Previously, de Vetten & Ferl isolated a G-box binding protein from maize, GBF1, which is anaerobically induced [46] The main structural differences between GBF1 and ABZ1 are the size (377 amino acids for GBF1 vs 138 for ABZ1) and a proline rich region at the N terminus of GBF1 The proline rich region of GBF1 may indicate that this protein is a transcriptional activator [47] A second anaerobically induced G-box binding factor from maize, mLIP15, is structurally more similar to ABZ1 because it is 135 amino acids long and also lacks a proline rich region at its N terminus [33] Both maize G-box binding factors were shown to interact with the maize ADH1 promoter, which is anaerobically induced [33,46] It may be conceivable that in maize GBF1 acts as a transcriptional activator while expression of mLIP15 may modulate or repress anaerobic expression by competing or interacting with GBF1 Small bZIP proteins may be one of the components of the cellular machinery that contribute to the low oxygen mediated down regulation of gene expression Functional dissection of ABZ1 The ABZ1 transcription factor isolated in this study was extensively analysed using biochemical approaches Although the basic and leucine zipper domain are often assumed to be the DNA binding and dimerization domains, the present study confirms this experimentally (Fig 5) The nuclear localization signal resides within the basic domain required for DNA binding Some bZIP factors are regulated by a subcellular localization mechanism in response to environmental cues For example nuclear import of the parsley bZIP factor CPRF2 is light mediated [48] Cytoplasmatic retention of the bZIP factor RSG is mediated by a 14-3-3 protein which has been suggested to modulate the endogenous amounts of gibberellins through the control of a gibberellic acid biosynthetic enzyme [49] In the study presented here no evidence for cytoplasmatic retention of ABZ1 was found for the full size ABZ1 and the protein is readily detected in the nucleus under aerobic conditions (Fig 4) Interestingly, the binding of ABZ1 to its target sequence can be abolished with increasing amounts of a truncated ABZ1 that lacks the DNA binding domain (Fig 5B) Therefore, efficient DNA binding requires that the dimerization occurs with another bZIP factor harbouring a basic DNA binding domain Whether heterodimerization of ABZ1 to other bZIP factors occurs, has not been analysed directly However, because its closest relative BZI-4 heterodimerizes with BZI-1 [32] it may be conceivable that ABZ1 can also form heterodimers Remarkably, no other bZIP transcription factor was isolated in a yeast two hybrid screen (S Sell & R Hehl, unpublished observations) This may either relate to an insufficient number of primary clones or to the fact that the mRNA used for constructing the prey library was isolated from anaerobic tissue and may not contain transcripts for other bZIP factors because their expression may be down regulated under anaerobic conditions Because ABZ1 is able to bind to the 35S promoter which is down regulated under anaerobic conditions and in the presence of ABZ1 in cobombardment analyses, this may suggest that ABZ1 either competes with other bZIP factors for the same binding sites or that heterodimerization also down regulates target gene expression In mammalian systems heterodimer formation of a bZIP factor with another leucine zipper containing transcription factor results in down regulation of target gene expression [50] To date several attempts to generate transgenic tomato or tobacco plants that overexpress ABZ1 have failed Reverse genetic approaches to analyse the role of small bZIP proteins in anaerobic gene expression may be more readily carried out in A thaliana Therefore, a screen for A thaliana homologs was performed using TAIR BLAST [51] ABZ1 is closely related to the four bZIP transcription factors AtbZIP53 (At3g62420; 53% identity), AtbZIP44 (At1g75390; 42% identity), AtbZIP02 (At2g18160; 50% identity), and AtbZIP11 (At4g34590; 58% identity) Recently, data on AtbZIP02 and AtbZIP11 suggested that these small bZIP factors bind to the sequence ACTCAT and may act as transcriptional activators under hypoosmotic conditions [52] It may be very interesting to learn how small bZIP proteins are involved in transcriptional activation This may relate to the position of the cis-regulatory element in the promoter or to the presence of interacting proteins that contribute a transcription activation domain Acknowledgements This work was supported by a grant through the ÔForschungsschwerpunkt Agrarbiotechnologie des Landes Niedersachsen (VW-Vorab)Õ We are grateful to Ralf R Mendel for critical reading of the manuscript and to Robert Hansch for advice using the particle delivery system We ă would like to thank Jorn Petersen for help with the phylogenetic ă analysis References Drew, M.C (1997) Oxygen deficiency and root metabolism: Injury and acclimation under hypoxia and anoxia Annu Rev Plant Physiol Plant Mol Biol 48, 223–250 Colmer, T.D (2003) Aerenchyma and an inducible barrier to radial oxygen loss facilitate root aeration in upland, paddy and deep-water rice (Oryza sativa L.) Ann Bot (Lond.) 91, 301– 309 Cox, M.C., Millenaar, F.F., Van Berkel, Y.E., Peeters, A.J & Voesenek, L.A (2003) Plant movement Submergence-induced petiole elongation in Rumex palustris depends on hyponastic growth Plant Physiol 132, 282–291 Sachs, M.M., Freeling, M & Okimoto, R (1980) The anaerobic proteins of maize Cell 20, 761–767 Subbaiah, C.C., Bush, D.S & Sachs, M.M (1998) Mitochondrial contribution to the anoxic Ca2+ signal in maize suspension-cultured cells Plant Physiol 118, 759–771 Baxter-Burrell, A., Yang, Z., Springer, P.S & Bailey-Serres, J (2002) RopGAP4-dependent Rop GTPase rheostat control of Arabidopsis oxygen deprivation tolerance Science 296, 2026– 2028 Lu, G., DeLisle, A.J., de Vetten, N.C & Ferl, R.J (1992) Brain proteins in plants: an Arabidopsis homolog to neurotransmitter pathway activators is part of a DNA binding complex Proc Natl Acad Sci USA 89, 11490–11494 Ó FEBS 2004 Properties of a small bZIP protein from tomato (Eur J Biochem 271) 4543 Lu, G., Sehnke, P.C & Ferl, R.J (1994) Phosphorylation and calcium binding properties of an Arabidopsis GF14 brain protein homolog Plant Cell 6, 501–510 Ferl, R.J (1996) 14-3-3 proteins and signal transduction Annu Rev Plant Physiol Plant Mol Biol 47, 49–73 10 Hoeren, F.U., Dolferus, R., Wu, Y., Peacock, W.J & Dennis, E.S (1998) Evidence for a role for AtMYB2 in the induction of the Arabidopsis alcohol dehydrogenase gene (ADH1) by low oxygen Genetics 149, 479–490 11 Klok, E.J., Wilson, I.W., Wilson, D., Chapman, S.C., Ewing, R.M., Somerville, S.C., Peacock, W.J., Dolferus, R & Dennis, E.S (2002) Expression profile analysis of the low-oxygen response in Arabidopsis root cultures Plant Cell 14, 2481–2494 12 Meissner, R., Jacobson, Y., Melamed, S., Levyatuv, S., Shalev, G., Ashri, A., Elkind, Y & Levy, A (1997) A new model system for tomato genetics Plant J 12, 1465–1472 13 Sambrook, J., Fritsch, E.F & Maniatis, T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, New York 14 Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F & Higgins, D.G (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25, 4876–4882 15 Meyer-Gauen, G., Herbrand, H., Pahnke, J., Cerff, R & Martin, W (1998) Gene structure, expression in Escherichia coli and biochemical properties of the NAD+-dependent glyceraldehyde-3phosphate dehydrogenase from Pinus sylvestris chloroplasts Gene 209, 167–174 16 Schmitz, M.L & Baeuerle, P.A (1997) Bacterial expression, purification, and potential use of His-tagged GAL4 fusion proteins Methods Mol Biol 63, 129–137 17 Bradford, M.M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 7, 248–254 18 Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A & Struhl, K (1988) Current Protocols in Molecular Biology, Greene and Wiley Interscience, New York 19 Topfer, R., Maas, C., Horicke-Grandpierre, C., Schell, J & ă Steinbiss, H.H (1993) Expression vectors for high-level gene expression in dicotyledonous and monocotyledonous plants Methods Enzymol 217, 67–78 20 Schindler, U & Cashmore, A.R (1990) Photoregulated gene expression may involve ubiquitous DNA binding proteins EMBO J 9, 3415–3427 21 Klein, T.M., Gradziel, T., Fromm, M.E & Sanford, J.C (1988) Factors influencing gene delivery into Zea mays cells by highvelocity microprojectiles Bio/Technology 6, 559–563 22 Sanford, J.C (1988) The biolistic process Trends Biotechnol 6, 299–302 23 Isono, K., Yamamoto, H., Satoh, K & Kobayashi, H (1999) An Arabidopsis cDNA encoding a DNA-binding protein that is highly similar to the DEAH family of RNA/DNA helicase genes Nucleic Acids Res 27, 3728–3735 24 Sprenger-Haussels, M & Weisshaar, B (2000) Transactivation properties of parsley proline-rich bZIP transcription factors Plant J 22, 1–8 25 Jefferson, R.A., Kavanagh, T.A & Bevan, M.W (1987) GUS fusions: b-glucuronidase as a sensitive and versatile gene fusion marker in higher plants EMBO J 6, 3901–3907 26 Jefferson, R.A (1987) Assaying chimaric genes in plants: the GUS gene fusion system Plant Mol Biol Report 5, 387–405 27 deWet, J.R., Wood, K.V., DeLuca, M., Helinski, D.R & Subramani, S (1987) Firefly luciferase gene: structure and expression in mammalian cells Mol Cell Biol 7, 725–737 28 Schledzewski, K & Mendel, R.R (1994) Quantitative transient gene expression: comparison of the promoter for maize 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 polyubiquitin1, rice actin1, maize derived Emu and CaMV 35S in cells of bareley, maize and tobacco Transgenic Res 3, 249–255 Geffers, R., Sell, S., Cerff, R & Hehl, R (2001) The TATA box and a Myb binding site are essential for anaerobic expression of a maize GapC4 minimal promoter in tobacco Biochim Biophys Acta 1521, 120–125 Martinez-Garcia, J.F., Moyano, E., Alcocer, M.J & Martin, C (1998) Two bZIP proteins from Antirrhinum flowers preferentially bind a hybrid C-box/G-box motif and help to define a new subfamily of bZIP transcription factors Plant J 13, 489–505 Jakoby, M., Weisshaar, B., Droge-Laser, W., Vicente-Carbajosa, ă J., Tiedemann, J., Kroj, T & Parcy, F (2002) bZIP transcription factors in Arabidopsis Trends Plant Sci 7, 106–111 Strathmann, A., Kuhlmann, M., Heinekamp, T & Droge-Laser, ă W (2001) BZI-1 specically heterodimerises with the tobacco bZIP transcription factors BZI-2, BZI-3/TBZF and BZI-4, and is functionally involved in flower development Plant J 28, 397– 408 Kusano, T., Berberich, T., Harada, M., Suzuki, N & Sugawara, K (1995) A maize DNA-binding factor with a bZIP motif is induced by low temperature Mol Gen Genet 248, 507–517 Aguan, K., Sugawara, K., Suzuki, N & Kusano, T (1993) Lowtemperature-dependent expression of a rice gene encoding a protein with a leucine-zipper motif Mol Gen Genet 240, 1–8 Izawa, T., Foster, R & Chua, N.H (1993) Plant bZIP protein DNA binding specificity J Mol Biol 230, 1131–1144 Lam, E & Lam, Y.K (1995) Binding site requirements and differential representation of TGF factors in nuclear ASF-1 activity Nucleic Acids Res 23, 3778–3785 Krawczyk, S., Thurow, C., Niggeweg, R & Gatz, C (2002) Analysis of the spacing between the two palindromes of activation sequence-1 with respect to binding to different TGA factors and transcriptional activation potential Nucleic Acids Res 30, 775– 781 Russell, D.A & Sachs, M.M (1992) Protein synthesis in maize during anaerobic and heat stress Plant Physiol 99, 615–620 Germain, V., Ricard, B., Raymond, P & Saglio, P.H (1997) The role of sugars, hexokinase, and sucrose synthase in the determination of hypoxically induced tolerance to anoxia in tomato roots Plant Physiol 114, 167–175 Bailey-Serres, J & Freeling, M (1990) Hypoxic stress-induced changes in ribosomes of maize seedling roots Plant Phys 94, 1237–1243 Fennoy, S.L & Bailey-Serres, J (1995) Post-transcriptional regulation of gene expression in oxygen-deprived roots of maize Plant J 7, 287–295 Fennoy, S., Jayachandran, S & Bailey-Serres, J (1997) RNase activities are reduced concomitantly with conservation of total cellular RNA and ribosomes in O2-deprived seedling roots of maize Plant Physiol 115, 1109–1117 Fennoy, S.L., Nong, T & Bailey-Serres, J (1998) Transcriptional and post-transcriptional processes regulate gene expression in oxygen-deprived roots of maize Plant J 15, 727–735 Kohler, U., Donath, M., Mendel, R.R., Cerff, R & Hehl, R (1996) ă Intron-specic stimulation of anaerobic gene expression and splicing efficiency in maize cells Mol Gen Genet 251, 252–258 Magaraggia, F., Solinas, G., Valle, G., Giovinazzo, G & Coraggio, I (1997) Maturation and translation mechanisms involved in the expression of a myb gene of rice Plant Mol Biol 35, 1003– 1008 de Vetten, N.C & Ferl, R.J (1995) Characterization of a maize G-box binding factor that is induced by hypoxia Plant J 7, 589– 601 Siberil, Y., Doireau, P & Gantet, P (2001) Plant bZIP G-box binding factors Modular structure and activation mechanisms Eur J Biochem 268, 5655–5666 4544 S Sell and R Hehl (Eur J Biochem 271) 48 Kircher, S., Wellmer, F., Nick, P., Rugner, A., Schafer, E & ă ă Harter, K (1999) Nuclear import of the parsley bZIP transcription factor CPRF2 is regulated by phytochrome photoreceptors J Cell Biol 144, 201–211 49 Igarashi, D., Ishida, S., Fukazawa, J & Takahashi, Y (2001) 14-33 proteins regulate intracellular localization of the bZIP transcriptional activator RSG Plant Cell 13, 2483–2497 50 Pognonec, P., Boulukos, K.E., Aperlo, C., Fujimoto, M., Ariga, H., Nomoto, A & Kato, H (1997) Cross–family interaction between the bHLHZip USF and bZip Fra1 proteins results in down-regulation of AP1 activity Oncogene 14, 2091–2098 51 Rhee, S.Y., Beavis, W., Berardini, T.Z., Chen, G., Dixon, D., Doyle, A., Garcia-Hernandez, M., Huala, E., Lander, G., Montoya, M., Miller, N., Mueller, L.A., Mundodi, S., Reiser, L., Tacklind, J., Weems, D.C., Wu, Y., Xu, I., Yoo, D., Yoon, J & Zhang, P (2003) The Arabidopsis Information Resource (TAIR): a model organism database providing a centralized, curated gateway to Arabidopsis biology, research materials and community Nucleic Acids Res 31, 224–228 Ó FEBS 2004 52 Satoh, R., Fujita, Y., Nakashima, K., Shinozaki, K & Yamaguchi-Shinozaki, K (2004) A novel subgroup of bZIP proteins functions as transcriptional activators in hypoosmolarityresponsive expression of the ProDH gene in Arabidopsis Plant Cell Physiol 45, 309–317 53 Kusano, T., Sugawara, K., Harada, M & Berberich, T (1998) Molecular cloning and partial characterization of a tobacco cDNA encoding a small bZIP protein Biochim Biophys Acta 1395, 171–175 54 Rugner, A., Frohnmeyer, H., Nake, C., Wellmer, F., Kircher, S., ă ¨ Schafer, E & Harter, K (2001) Isolation and characterization of ă four novel parsley proteins that interact with the transcriptional regulators CPRF1 and CPRF2 Mol Genet Genomics 265, 964–976 55 Heinekamp, T., Kuhlmann, M., Lenk, A., Strathmann, A & Droge-Laser, W (2002) The tobacco bZIP transcription factor ă BZI-1 binds to G-box elements in the promoters of phenylpropanoid pathway genes in vitro, but it is not involved in their regulation in vivo Mol Genet Genomics 267, 16–26  ... TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT... 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites... N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA