0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf

Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf

Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf

... and5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3 ¢.Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATCCTCGATCGC-3¢. Abz1(1–24): 5¢-TATACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5 ¢-ATATCCATGGTCTCATCCATTCCTGCATAC-3¢. ... 5¢-TATGGATCCATGCTTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCCGGGTTAAAATTTAAACAATCCTG-3¢.C-terminaldeletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACCTTTAAGGCAGAG-3¢ and 5¢ -A TACCCGGGTTATAAATACCTGAGCCTATCAGTC-3¢.The BamHI and SmaI sites ... pairs. Full size, ABZ1(1–138): 5¢-TATAGGATCCATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCCGGGTTAAAATTTAAACAATCCTG-3¢.N-ter-minal deletion, ABZ1(47–138): 5¢-TATGGATCCATGCTTCTGCAAGATTTGACAGG-3¢ and...
  • 11
  • 536
  • 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

... 5¢-AAGCTTCACCATGTACCCTGCCCACATGTACCAAGTGTAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTCATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATGGCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGGTTTACAAGCTG-3¢) were used. Amplified ... and5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTCTTTG-3¢ for FLAG-DEC1; and 5 ¢-GAATTCGGCGGACCAGAGAATGGACATTTCCTCAACCATC-3¢ and5¢-TCTAGACTACAGCGGCCATGGCAAGTCACTAAAGTC-3¢ for FLAG-BMAL1) were used for amplificationby ... primers(5¢-CGGCAATTTGTAGGTCTCCTTGCTGTCCTCGCTC-3¢ and 5¢-GCCCGGCTCATCGAGAAAAAGAGACGTGACCGG-3¢ for DEC1-H5 7A; 5¢-GATGAGCCGGTGCGGCAATTTGTAGGTCTCC-3¢ and 5 ¢-GAGAAAAAGAGAGCTGACCGGATTAACGAGTGC-3¢ forDEC1-R6 5A, FLAG-DEC1-R6 5A and DEC1:4–232-R6 5A; ...
  • 11
  • 629
  • 0
Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx

Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx

... 2847 Functional dissection of theSchizosaccharomyces pombeHollidayjunction resolvase Ydc2:in vivorole in mitochondrial DNAmaintenanceBarbara Sigala and Irina R. TsanevaDepartment of Biochemistry ... and maintenance of DNA in allorganisms including mitochondrial DNA (mtDNA).Mitochondrial DNA amounts to about 15% of the DNAcontent in Saccharomyces cerevisiae. A haploid cell containsabout ... total cellular DNA were loaded on the gels, as thehybridization signal in these samples was very low. Thegeneral pattern remained the same: the 19.4-kb band wasweak and a significant amount of...
  • 11
  • 575
  • 0
Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx

Báo cáo khoa học: Functional dissection of Escherichia coli phosphotransacetylase structural domains and analysis of key compounds involved in activity regulation potx

... of acs: delacs P1(forward), 5¢-GAGAACAAAAGCATGAGCCAAATTCACAAACACACCA TTGTG TAGGC TGGAGCT GCTTC G-3¢;and delacs P2 (reverse), 5¢-GGCAATTGTGGGTTACGATGGCATCGCGATAGCCTGCTTCATATGAATATCCTCCTTA-3¢. ... Pathways of acetate activationand production in E. coli. Acs catalyzes anirreversible pathway for high-affinity acetateactivation, and AckA and Pta catalyze a reversible pathway involved in acetateproduction ... phosphoenolpyruvate(PEP).Acetyl-CoAAcetatePtaAcetyl-AMPAcetyl-PAckAcsAcsPiCoAADPATPAMPCoAPPiATP2PiPPasaGlucosePEPPyruvateAcetyl-CoAAcetateCoANADHNAD+CO2Acetyl-PPtaPiCoAPiCoAADPATP+-Acetate excretionAcetate assimilationABFig. 1. (A) Pathways...
  • 10
  • 507
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... nm bandpass fil-ter). Data were recorded and analyzed with flowmax soft-ware from Partec.Statistical analysis of ELISA experimentsEach experiment was repeated at least twice, with duplicateor ... aureus, one of the most importantGram-positive pathogens of humans and animals, is a highly versatile bacterium capable of causing a widespectrum of diseases, ranging from superficial skininfections ... Visai1,2, Fiona M. Burke3, Joan A. Geoghegan3,Matteo Stravalaci4, Marco Gobbi4, Giuliano Mazzini5, Carla Renata Arciola6, Timothy J. Foster3andPietro Speziale11 Department of Biochemistry,...
  • 16
  • 560
  • 0
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt

Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt

... as a template with thefollowing primers : R450AUp (5¢-GACGAGTACACGGTGGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TCCTGAGGTTGTATCCG GCCACCGTGT ACTCGTC-3¢);Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAGACGTC-3¢) ... (5¢-ACACGGTGCGCGGAGCCAACCTCAAGACGTC-3¢) and Y452ALo (5¢-GACGTCCTGAGGTTGGCTCCGGCCACCGTGT-3¢); RA+YAUp (5¢-ACACGGTGGCCGGAGCCAACCTCAGGACGTC-3¢) and RA+YALo (5¢-GACGTCCTGAGGTTGGCTCCGGCCACCGTGT-3¢). After mutagenesis and ... analyses of FhaCWThave revealed different behaviours at posi-tive and negative potentials, with noisier current andthe appearance of conductance substates at negativepolarity (Fig. 5A, part...
  • 11
  • 396
  • 0
Báo cáo khoa học: Functional dissection of two Arabidopsis PsbO proteins PsbO1 and PsbO2 doc

Báo cáo khoa học: Functional dissection of two Arabidopsis PsbO proteins PsbO1 and PsbO2 doc

... thaliana O1Arabidopsis thaliana O2Nicotiana tabacumSolanum tuberosumLycopersicon esculentum Pisum sativum Oryza sativa Spinacia oleraceaVolvox carteriChlamydomonas reinhardtiiEuglena ... O2Nicotiana tabacumSolanum tuberosumLycopersicon esculentum Pisum sativum Oryza sativa Spinacia oleraceaVolvox carteriChlamydomonas reinhardtiiEuglena gracilisBigelowiella natansAnabaena ... quenching of chlorophyll fluorescence. Plant Cell Physiol 40,1134–1142.10 Murakami R, Ifuku K, Takabayashi A, Shikanai T,Endo T & Sato F (2002) Characterization of an Arabi-dopsis thaliana mutant...
  • 11
  • 394
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands. Heme catabolism byHOs of mammals, pathogenic bacteria, cyanobacteriaand probably insects is considered to have a similarmechanism, because the characteristic absorptionbands of verdoheme ... T, Zhang X, Sun D,Sato M, Sasahara M, Kayama T, Ikeda-Saito M &Yoshida T (2000) Histidine 20, the crucial proximalaxial heme ligand of bacterial heme oxygenase Hmu O from Corynebacterium ... Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The spectral features of the final reaction mixture were analogous, but not iden-tical,...
  • 16
  • 617
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... GCGCGGATCCACCATGCCCTTCCGGAGAAGA 468/156(p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCTp26-ND60 1–60 (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 396/132(p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCTp26-CD40 ... Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGTp26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 297/93153–192 (p26-153Xho-as) CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT934 J. A. Crack et al.(Eur. ... protein from Artemia franciscanaOligomerization and thermotoleranceJulie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously...
  • 10
  • 495
  • 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

... (phosphocholine), 165.13 and lipid A- OH (O-deacylated lipid A) , 953.02. Relativeabundance was estimated from the area of molecular ion peak relative to the total area (expressed as percentage). Peaks representing ... filtration chromatography and GLC were carried out asdescribed previously [16].Preparation of OS materialO-Deacylation of LPS. O-Deacylation of LPS wasachieved with anhydrous hydrazine, as described ... J.H. & Jeanes, A. (1965) Quantitativedetermination of monosaccharides as their alditol acetates by gasliquid chromatography. Anal. Chem. 37, 1602–1604.28. Gerwig, G.J., Kamerling, J.P. &...
  • 13
  • 433
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam