Báo cáo khoa học: " Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy" pps

... are suitable for a clear dis- Original article Taxonomical impact of morphological variation in Quercus robur and Q petraea: a contribution to the hybrid controversy G Aas Chair ... supported by the findings of this project. Quercus robur / Quercus petraea /taxonomy / morphological variation / hybridization Résumé — Im...

Ngày tải lên: 08/08/2014, 19:21

... ACL and AFNLP Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study Wenbin Jiang † Liang Huang ‡ Qun Liu † † Key Lab. of Intelligent Information ... decoding is analogous to the training. First, the character se- quence is input into the source classifier to ob- tain an source standard annotated classification result, then it...

Ngày tải lên: 17/03/2014, 01:20

... morphological segmen- tation and syntactic parsing using a PCFGLA lattice parser. In Proceedings of ACL. Spence Green and Christopher D. Manning. 2010. Better Arabic parsing: Baselines, evaluations, and ... and analysis. In Proceedings of COLING. Nizar Habash and Owen Rambow. 2005. Arabic tok- enization, part -of- speech tagging and morphological disambiguation in...

Ngày tải lên: 23/03/2014, 14:20

... xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers ... Wellenreuther and W. Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in...

Ngày tải lên: 18/02/2014, 06:20

... bifunctional protein was named AUH (‘AU bind- ing homolog of enoyl-CoA hydratase’). The RNA- binding activity of the human protein and also of the murine homologue was investigated further, its ... AUH in brain has a molecular weight of 32 kDa (AUHp32) [15]. For the kinetic characterization of AUH described in the work at hand, AUH was overproduced in Escherichia...

Ngày tải lên: 19/02/2014, 07:20

... kinase domain and interferes with the substrate binding sites. In the case of the titin and twitchin kinases, the autoinhibitory sequence acts as a pseudo- substrate, occluding ATP binding and ... CaM in a 1 : 1 molar ratio and then analysed by gel filtration chromatography. The peaks were concentrated using 3 lL of Strataclean protein bind- ing beads (Stratagene,...

Ngày tải lên: 19/02/2014, 17:20

... responses to our in- quiry. References Apache UIMA 2008. Available at http://uima.apache.org. Jason Baldridge, Tom Morton, and Gann Bierner. 2005. OpenNLP Maxent Package in Java, Available at: ... Biological, translational, and clinical language pro- cessing, Prague, CZ. David Ferrucci and Adam Lally. 2004. UIMA: An Ar- chitectural Approach to Unstructured Information Pr...

Ngày tải lên: 20/02/2014, 05:20

... = 64 N = 2048 331 Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 324–332, Suntec, Singapore, 2-7 August 2009. c 2009 ACL and AFNLP 1 2 3 1 1 2 3 { } 324  ... 128 N 330 X a →    X 1 , X 1  X b → X 1  X 2 , X 1 X 2  X c →    X d → X 1   , X 1  X e →   ,  X a X d X b X a X b X d ≺ X a ≺ X b ≺ X c ≺ X d...

Ngày tải lên: 20/02/2014, 07:20

... languages, and the problem of semantic dis- ambiguation of these phrases has many potential applications in areas such as question-answering and machine translation. One very common ap- proach to this ... frequency of the preposition in a paraphrase such as “storm in the desert” and the ease of understanding that phrase. For example, the preposition &apos ;...

Ngày tải lên: 20/02/2014, 12:20

... Brilliant Blue staining. Table 2. Quantitation and comparison of proteins in GM and WI-38 cells. From the data in Fig. 2 and others, the concentrations of Mcm proteins, ORC2 and PCNA in total protein ... chromatin-bound proteins (Fig. 3 and Table 2). In contrast, the amounts of total Fig. 4. Abundance of Mcm2 mRNA in HeLa and WI-38 cells. (A) Total mRNA was...

Ngày tải lên: 20/02/2014, 23:20