a promising source of bioactive prototype molecules for the treatment of

Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

... (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’) b-actin (forward, 5’ CTGGCACCACACCTTCTACAATGA 3’ and reverse, 5’ TTAATGTCACGCACGATTTCCCGC 3’) For each pair ... Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M, Takata T: Periostin promotes invasion and anchorage-independent growth in the metastatic process of head and neck cancer Cancer ... system (ABI, USA) were applied The data was analyzed by ABI Prism 7300 SDS Software (ABI,USA) and the method of ΔΔct was used to calculate Periostin mRNA expression and the silence efficacy The silence...

10
362
0

o cáo hóa học:" Periostin: a promising target of therapeutical intervention for prostate cancer" pptx

Danh mục: Hóa học - Dầu khí

... (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’) b-actin (forward, 5’ CTGGCACCACACCTTCTACAATGA 3’ and reverse, 5’ TTAATGTCACGCACGATTTCCCGC 3’) For each pair ... Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M, Takata T: Periostin promotes invasion and anchorage-independent growth in the metastatic process of head and neck cancer Cancer ... system (ABI, USA) were applied The data was analyzed by ABI Prism 7300 SDS Software (ABI,USA) and the method of ΔΔct was used to calculate Periostin mRNA expression and the silence efficacy The silence...

10
316
0

Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps

Danh mục: Báo cáo khoa học

... significant clinical benefits like disease stability in 80% of patients after 2–3 doses of vaccine The mean survival rate was 13 months for melanoma patients and months for renal cell carcinoma patients ... very small prostate tumors This, in association with radical prostatectomy and radiation therapies, has contributed to increasing the curative indexes [2] After several years of primary therapy, ... metaanalyses of ten clinical trials in melanoma patients (167 patients total) These data support mature DCs as the best choice for conducting clinical trials We prepared DC vaccines using allogeneic...

7
363
0

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Danh mục: Y học thưởng thức

... de-innervation of the joint and removal of the entire end-plate receptors that adhere to the bone and capsular tissue Limitations of the current study include a lack of comparison group and lack of blinding ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16 ... men; mean age 64, range 22-89) were included Length of follow-up was at least years with a maximum of years Location of facet pain was cervical in 45, thoracic in 15, and lumbar in 114 patients...

4
599
0

Tài liệu Lesson 30-A promising year of shipbuilding pdf

Danh mục: Anh văn thương mại

... advanced ship building countries like Poland, Japan and the Republic of Korea In addition, the company plans to hire foreign experts to train its staff "If the company stays on its current path, ... late 2007, by order of the prime minister To compete with foreign design, Vinashin has also devised a strategy to develop its techniques and technology by acquiring the latest software from advanced ... Vinashin will soon become a strong competitor in the international ship building industry," said Deputy General Director Anh.(extracted Saigon Times 16/02/2005) New Words and Expressions 1.promising...

3
632
0

Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx

Danh mục: Lâm nghiệp

... Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, Vila Bella Provenance-wise conservation- India ... months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year 18 First year post- drought data on range and mean of growth characters in the hot-spot region Characters ... the availability of sufficient genetic variability 1981-IRRDB germplasm collection – a valuable reservoir of genes for various abiotic stresses Acre : Brasileia, Feijo, Sena Madureira, Tarauaca,...

23
573
0

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Danh mục: Báo cáo khoa học

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deﬁciency...

9
634
0

Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt

Danh mục: Báo cáo khoa học

... of the majority of domain Ia (D1–250) and a portion of domain Ib (D365–380) from native PE Several RITs incorporating a 38 kDa fragment of PE are in preclinical evaluation or have already reached ... of PE and its intoxication pathway have fueled the translation of basic research into clinical therapies that have the opportunity to make a large positive impact on human health High expectations ... To date, we are unaware of direct evidence for transport of PE through the Sec61p translocon Additional support for the hypothesis that PE exploits the ERAD system is the amino acid bias against...

18
528
0

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Danh mục: Sức khỏe phụ nữ

... with adjunctive therapy or the actual exercise dosage is the critical factor is unclear The optimal length of treatment and the number of treatment episodes could be useful information for the marketing ... quantity and quality of the educational information about the condition and PFM function The impact of these factors on the outcome of treatment has yet to be evaluated Furthermore, it has been ... Hay-Smith (2002) A A = available in English only as abstract; a = According to Australian National Health and Medical Research Council Hierarchy of Evidence (1998); b = Mean age (SD) unless otherwise...

28
738
0

báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx

Danh mục: Hóa học - Dầu khí

... Célia Koiffmann and Cláudia I E de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Page of 10 (page number not for citation purposes) Journal of Translational ... Mariz Vainzof for WB analysis and suggestions; Dr Irina Kerkis for antibodies supplying; Marcos Valadares and Maria Denise Fernandes Carvalho for the support with the cultures Mrs Constancia ... compare, for each of the 19 analyzed markers, the control sample (not labeled htMSCs) in gray and the experimental population of htMSCs (labeled with specific antibodies) in black Page of 10 (page...

10
456
0

báo cáo hóa học:" Is tension band wiring technique the "gold standard" for the treatment of olecranon fractures? A long term functional outcome study" docx

Danh mục: Hóa học - Dầu khí

... parallel 1.8 mm Kirschner wires from the tip of the olecranon and a 18 gauge wire in a figure -of eight fashion Major intraoperative goal was the perforation of the ulnar Mayo Classification for ... Visual Analogue Scale (VAS) patient satisfaction score (b) the intramedullary pin The above hypothesis wasn't confirmed by Paremain et al [22] as the results of their biomechanical study indicated ... olecranon fracture Mayo Type IIA fracture of the left olecranon after a fall in a 52-year-old woman (A) Lateral (B) and anteroposterior radiographs (C) at years postoperatively showed signs of...

6
492
0

báo cáo hóa học:" The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report" doc

Danh mục: Hóa học - Dầu khí

... is a chance of intra-articular pin placement, causing septic arthritis and a risk of damaging the growth plate An external fixator is also used for the treatment of paediatric supracondylar fractures ... this article as: Lam et al.: The use of tibial Less Invasive Stabilization System (LISS) plate [AO-ASIF] for the treatment of paediatric supracondylar fracture of femur: a case report Journal of ... the site, the pattern of the fracture and its associated injury When treating the displaced supracondylar fracture, the traditional method of traction may fail due to the unbalanced pull of the...

6
438
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

Danh mục: Hóa học - Dầu khí

... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...

7
531
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

Danh mục: Hóa học - Dầu khí

... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... permits and consists of gentle manipulation of the foot and the serial application of long leg plaster casts at weekly interval without the use of anesthesia, as described by Ponseti [4] In all patients, ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...

7
802
0

Báo cáo khoa học: "The Safety and efficacy of a new self-expandable intratracheal nitinol stent for the tracheal collapse in dogs" ppt

Danh mục: Báo cáo khoa học

... located from the mid-cervical to the thoracic trachea increased the diameter of the entire cervical to thoracic tracheal area Coughing and dyspnea disappeared and the dogs resumed normal activity ... female, CT‐TT: cervical trachea to thoracic trachea Fig Lateral radiographs before (a) and after (b) intratracheal placement of self expandable nitinol stent with flare ends in a dog with tracheal ... to fit an individual trachea or bronchus Once implanted into the trachea or bronchus, the stent retains the same external diameter and increases the rigidity of the tracheobronchial wall The nitinol...

3
576
0

Báo cáo y học: "A 12 Week, Open Label, Phase I/IIa Study Using Apatone® for the Treatment of Prostate Cancer Patients Who Have Failed Standard Therapy" pps

Danh mục: Báo cáo khoa học

... study Additional studies appear warranted for the use of Apatone as a co–adjuvant, or for emerging salvage chemotherapy in the treatment of late stage prostate cancer Acknowledgements This research ... fit analysis was used to measure and compare PSA values before, during and after therapy.12 Prostate cancer patients who had failed standard therapy were enrolled at William Beaumont, Royal Oak, ... of prior chemotherapy regimens was two Table Patient Characteristics N = 17 Age: median (range) AUA Symptom Score: median (range) Race: Caucasian African American Prior therapies (1 or more treatments):...

6
510
0

Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot

Danh mục: Báo cáo khoa học

... patient, a Caucasian woman aged 28 years with a DSM-IV diagnosis of unipolar depression, was enrolled in the acute and long-term phases of the pilot study of VNS therapy for TRD At acute-phase study ... Date of Assessment The patient's score on the CGI-S scale also indicated a substantial improvement after the initiation of VNS therapy Figure The patient's score on the CGI-S scale also indicated ... scales [24] After a year of follow-up, adjunctive VNS therapy was associated with sustained symptomatic benefit and sustained or enhanced functional status [25] Because pregnancy was a contraindication...

7
453
0

Báo cáo y học: "Deep transcranial magnetic stimulation for the treatment of auditory hallucinations: a preliminary open-label study" pptx

Danh mục: Báo cáo khoa học

... SANS and amelioration of auditory hallucinations Loo et al [19] noted that examinations of individual-controlled trials reveal that a substantial proportion of rTMS studies for the treatment of ... Ya’akov Mental Health Center and is paid by the research fund of the Beer Ya’akov Mental Health Center KM serves as the director of the Beer Ya’akov Mental Health Center ZA works at the Department ... Department of Neurobiology of the Weizmann Institute of Science and also serves as a research consultant for Brainsway DP is head of the research department of Beer Ya’akov Mental Health Center and head...

6
484
0

báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps

Danh mục: Báo cáo khoa học

... shortened radiation treatment time (86%) and delivery of radiation to a smaller area of the body (77%) Twelve of the patients (27%) indicated that having a local treatment facility was a factor in their ... for treatment Factors affecting the success of implanting the balloon applicator and administering the prescribed radiation therapy were analyzed Patients answered a questionnaire after implantation ... applicable regulations The patient selection criteria were based on the Page of 10 American Society of Breast Surgeons Consensus Statement for Accelerated Partial Breast Irradiation and the American...

10
389
0

Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

Danh mục: Báo cáo khoa học

... The mainstay of surgical therapy in primary or metastatic disease is to achieve a complete resection with negative margins [7] Conventional chemotherapy and radiation therapy may have minor adjunctive ... Kubota K, Makuuchi M, Kusaka K, Kobayashi T, Miki K, Hasegawa K, Harihara Y, Takayama T: Measurement of liver volume and hepatic functional reserve as a guide to decision-making in resectional ... colorectal liver metastases Am J Surg 2003, 185:221-229 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge T, Sugihara K, Moriya Y: Resection for multiple metastatic liver tumors after...

4
454
0

a promising source of bioactive prototype molecules for the treatment of neglected diseases