nuclear energy as a viable source of energy for the future
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
Ngày tải lên: 05/09/2013, 14:58
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
Ngày tải lên: 05/09/2013, 15:28
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... and 5Â-AUAAGUAAUUUCUACGACG dTdT-3Â; Nup358, 5Â-CCAGUCACUUACAAUUAAAd TdT-3Â and 5Â-UUUAAUUGUAAGUGACUGGdTdT-3Â (siNup358-1), 5Â-UGAAGCACAUGCUAUAAAAdTdT-3Â and 5Â-UUUUAUAGCAUGUGCUUCAdTdT-3Â (siNup- 358-2)]. ... 5Â-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3Â) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS. The oligonucleotide fragment for NES-NLS was flanked ... 114, 4435–4445. 13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R, Tachibana T, Hashikawa T, Imamoto F & Imamoto N (2006) Cell-cycle-dependent dynamics of nuclear pores: pore-free islands and lamins. J...
Ngày tải lên: 06/03/2014, 01:20
Assessing counterparty risk at private companies in energy industry A descriptive survey of credit models potx
... to a 1 Altman, 1968. 53 At the same time, all the above described models have a common disadvantage for industrial companies. Their application requires extended database of loans and ... a number of analytical methodologies corporate risk management software solutions are widely available for application at various economic areas. Among these are integrated risk modeling packages ... framework to apply for the risk valuation of nontradable assets such as loans and privately placed bonds. The main assumption of this model is that transition probabilities are stable across borrower...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx
... ranges in an age- and gender-balanced population of 100 healthy adults a monocentric German study. Clin Immunol 2005, 116:192-197. 15. Tani S, Nagao K, Anazawa T, Kawamata H, Furuya S, Takahashi H, ... http://www.illumina.com/documents/products/ datasheets/datasheet_humanomni1_quad.pdf. The geno- typing assay was performed according to the standard Illu- mina Infinium HD Super Assay protocol (Infinium HD Super Assay P rotocol ... Aging, and the National Eye Institute; by the Centers for Disease Control and Prevention; and by General Clinical Research Centers. Abbott Laboratories, Amylin Pharmaceutical, AstraZeneca Pharmaceuticals...
Ngày tải lên: 18/06/2014, 19:20
How to be a good steward of energy and the environment potx
Ngày tải lên: 29/06/2014, 04:20
A position paper of the EPS Energy for the Future phần 1 ppt
Ngày tải lên: 08/08/2014, 15:21
A position paper of the EPS Energy for the Future phần 2 ppt
Ngày tải lên: 08/08/2014, 15:21
A position paper of the EPS Energy for the Future phần 3 potx
Ngày tải lên: 08/08/2014, 15:21
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... physical work environment variables. The Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with in- crease in risk of disability ... (DWECS) and the national register on social transfer payments (DREAM). DREAM is a register based on data from the Danish Ministry of Employment, the Ministry of Social Affairs and the Ministry of ... in the higher occupational grades may introduce another source of bias. In relation to our study the basic retrospective measure of frequency was used ’How many workdays in total have...
Ngày tải lên: 26/10/2012, 10:03
Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx
... composition of the human and animal in Vietnam (Table 3) as well as average rate of excretion (Table 4). Table 3: Chemical composition of excreta and urine of the human and animal Content in % of ... delta 50 47 The Northern of central area 44 41 Coastal Central area 42 32 Highland area 36 24 The Eastern part of the South 53 46 The Mekong river delta 48 19 (Source: National Strategy ... considered as a rich and sustainable rural indicator. In 1999, the National Strategy for Rural Water Supply and Sanitation of Vietnamese Government has stated the goals: "Up to year 2010, about...
Ngày tải lên: 16/01/2014, 17:20
Tài liệu Using a Web Service as a Data Source pdf
... "Order_OrderDetails_Relation"; // . . . [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet. da = ... view of the orders table to the grid. dataGrid.DataSource = ds.Tables[ORDERS_TABLE].DefaultView; Discussion An XML web service is software that is accessible using Internet standards such as ... SchemaType .Source) ; da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet. da = new SqlDataAdapter("SELECT * FROM [Order Details]",...
Ngày tải lên: 21/01/2014, 11:20
Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx
... to have no pathway for caspase activation by cytochrome c.In contrast, homologues of mitochondrial caspase-inde- pendent apoptosis effectors, as well as caspase homo- logues (paracaspases and ... high-molecular mass DNA, oligonucleosomal DNA laddering, and complete degradation of the nuclear DNA, with the ultimate outcome of nuclear resorption. Caspase-8- and caspase-9-like activities are involved ... Tetrahymena have any nuclease activ- ity, the mitochondria were purified from vegetatively growing cells and incubated with a circular plasmid as the substrate DNA. The substrate plasmid DNA was AA’ BB’ C C’ D D’ E E’ Fig....
Ngày tải lên: 20/02/2014, 03:20
Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx
... 3 Acre : Brasileia, Feijo, Sena Madureira, Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, ... - rainfall pattern limited only to four months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year. 1 A mature rubber plantation Amazonian accessions of wild ... stomata per mm2 in the abaxial surface - Thickness of palisade tissue (àm) - Thickness of mesophyll tissue (àm) - Mean number of cells in unit length of the palisade layer - Leaf lamina thickness...
Ngày tải lên: 21/02/2014, 04:20
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... determinants of obstetric anesthesia workload and that a typical epidural takes about half the time of a typical cesarean. Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of ... the anesthesia workforce allocated for the provision of obstetric anesthesia services. The OAAI was calculated based on the premise that epidurals and cesareans are the predominant determinants ... The obstetric anesthesia activity index (OAAI) The majority of anesthesia workload in the labor ward comprises epidural labor analgesia and cesarean delivery. The OAAI is a formula composite...
Ngày tải lên: 05/03/2014, 15:20
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf
... was able to maintain 90% oxygen saturation (SaO 2 ) at room air. Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO 2 ) of 94% at room air. He was ... hospital stay was 111 days. DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy. Active pulmonary TB is a rare primary cause of ... tuberculous bronchopneumonia, was able to maintain oxygen saturation (SaO 2 ) of 96% at room air, while patient with tuberculous pneumonia in case 2 was able to maintain SaO 2 of 90% at room air at six weeks. Organ...
Ngày tải lên: 06/03/2014, 04:20