nuclear energy as a viable source of energy for the future
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... and 5Â-AUAAGUAAUUUCUACGACGdTdT-3Â; Nup358, 5Â-CCAGUCACUUACAAUUAAAdTdT-3Â and 5Â-UUUAAUUGUAAGUGACUGGdTdT-3Â(siNup358-1), 5Â-UGAAGCACAUGCUAUAAAAdTdT-3Âand 5Â-UUUUAUAGCAUGUGCUUCAdTdT-3Â (siNup-358-2)]. ... 5Â-AGCTTATCCTCGTTACAATCAAGAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3Â) were annealed and inserted into the BglII and HindIIIsites of pEGFP-NLS. The oligonucleotide fragment for NES-NLS was flanked ... 114,4435–4445.13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R,Tachibana T, Hashikawa T, Imamoto F & ImamotoN (2006) Cell-cycle-dependent dynamics of nuclear pores: pore-free islands and lamins. J...
- 12
- 454
- 0
Assessing counterparty risk at private companies in energy industry A descriptive survey of credit models potx
... to a 1 Altman, 1968. 53 At the same time, all the above described models have a common disadvantage for industrial companies. Their application requires extended database of loans and ... a number of analytical methodologies corporate risk management software solutions are widely available for application at various economic areas. Among these are integrated risk modeling packages ... framework to apply for the risk valuation of nontradable assets such as loans and privately placed bonds. The main assumption of this model is that transition probabilities are stable across borrower...
- 60
- 324
- 0
Báo cáo sinh học: " Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage" pptx
... ranges in an age- and gender-balanced population of 100 healthy adults a monocentric German study. Clin Immunol 2005,116:192-197.15. Tani S, Nagao K, Anazawa T, Kawamata H, Furuya S, Takahashi H, ... http://www.illumina.com/documents/products/datasheets/datasheet_humanomni1_quad.pdf. The geno-typing assay was performed according to the standard Illu-mina Infinium HD Super Assay protocol (Infinium HDSuper Assay P rotocol ... Aging, and the National EyeInstitute; by the Centers for Disease Control and Prevention; and by GeneralClinical Research Centers. Abbott Laboratories, Amylin Pharmaceutical,AstraZeneca Pharmaceuticals...
- 8
- 370
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... physical work environment variables. The Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with in-crease in risk of disability ... (DWECS) and the national register on social transfer payments (DREAM). DREAM is a register based on data from the Danish Ministry of Employment, the Ministry of Social Affairs and the Ministry of ... in the higher occupational grades may introduce another source of bias. In relation to our study the basic retrospective measure of frequency was used ’How many workdays in total have...
- 6
- 578
- 0
Tài liệu Toilet design for rural areas and separated urine collection as a fertilizer source pptx
... composition of the human and animal in Vietnam (Table 3) as well as average rate of excretion (Table 4). Table 3: Chemical composition of excreta and urine of the human and animal Content in % of ... delta 50 47 The Northern of central area 44 41 Coastal Central area 42 32 Highland area 36 24 The Eastern part of the South 53 46 The Mekong river delta 48 19 (Source: National Strategy ... considered as a rich and sustainable rural indicator. In 1999, the National Strategy for Rural Water Supply and Sanitation of Vietnamese Government has stated the goals: "Up to year 2010, about...
- 7
- 476
- 1
Tài liệu Using a Web Service as a Data Source pdf
... "Order_OrderDetails_Relation"; // . . . [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet. da = ... view of the orders table to the grid. dataGrid.DataSource = ds.Tables[ORDERS_TABLE].DefaultView; Discussion An XML web service is software that is accessible using Internet standards such as ... SchemaType .Source) ; da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet. da = new SqlDataAdapter("SELECT * FROM [Order Details]",...
- 4
- 369
- 0
Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx
... to have nopathway for caspase activation by cytochrome c.Incontrast, homologues of mitochondrial caspase-inde-pendent apoptosis effectors, as well as caspase homo-logues (paracaspases and ... high-molecular mass DNA, oligonucleosomalDNA laddering, and complete degradation of the nuclear DNA, with the ultimate outcome of nuclear resorption. Caspase-8- and caspase-9-likeactivities are involved ... Tetrahymena have any nuclease activ-ity, the mitochondria were purified from vegetativelygrowing cells and incubated with a circular plasmid as the substrate DNA. The substrate plasmid DNA wasAA’BB’CC’DD’EE’Fig....
- 10
- 642
- 0
Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx
... 3Acre : Brasileia, Feijo, Sena Madureira, Tarauaca, XapuriRondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, JaruMato Grosso: Aracotuba, Cartriquaca, Itauba, ... - rainfall pattern limited only to four months in a year- average annual rain fall of 7.5mm per day - average of 90 rainy days/ year. 1 A mature rubber plantationAmazonian accessions of wild ... stomata per mm2 in the abaxial surface - Thickness of palisade tissue (àm)- Thickness of mesophyll tissue (àm)- Mean number of cells in unit length of the palisade layer- Leaf lamina thickness...
- 23
- 573
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... determinants of obstetric anesthesia workload and that a typical epidural takes about half the time of a typical cesarean. Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of ... the anesthesia workforce allocated for the provision of obstetric anesthesia services. The OAAI was calculated based on the premise that epidurals and cesareans are the predominant determinants ... The obstetric anesthesia activity index (OAAI) The majority of anesthesia workload in the labor ward comprises epidural labor analgesia and cesarean delivery. The OAAI is a formula composite...
- 14
- 610
- 0
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf
... was able to maintain 90% oxygen saturation(SaO2) at room air. Anti-tuberculosis therapy wascontinued and at 12 weeks he was maintainingoxygen saturation (SaO2) of 94% at room air. Hewas ... hospital stay was 111 days.DISCUSSIONIdentification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy. Active pulmonary TB is a rareprimary cause of ... tuberculousbronchopneumonia, was able to maintain oxygensaturation (SaO2) of 96% at room air, while patientwith tuberculous pneumonia in case 2 was able tomaintain SaO2 of 90% at room air at six weeks.Organ...
- 7
- 352
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008