Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis Munehiro Asally 1 , Yoshinari Yasuda 2 , Masahiro Oka 1,2 , Shotaro Otsuka 3 , Shige H. Yoshimura 3 , Kunio Takeyasu 3 and Yoshihiro Yoneda 1,2,4 1 Japan Science and Technology Agency, Core Research for Evolutional Science and Technology, Department of Frontier Biosciences, Graduate School of Frontier Biosciences, Osaka University, Japan 2 Department of Frontier Biosciences, Graduate School of Frontier Biosciences, Osaka University, Japan 3 Department of Responses to Environmental Signals and Stresses, Graduate School of Biostudies, Kyoto University, Japan 4 Department of Biochemistry and Molecular Biology, Graduate School of Medicine, Osaka University, Japan Introduction Nuclear-cytoplasmic trafficking regulates the move- ment of molecules into and out of the nucleus and is necessary for the survival of eukaryotic cells. The pas- sage of molecules such as RNA, proteins and ions across the nuclear envelope occurs through the nuclear pore complex (NPC), a huge protein complex embed- ded in the nuclear envelope. Small molecules (< 9 nm in diameter) pass through the NPC by passive diffu- sion, whereas larger molecules are transported in a facilitated manner [1]. The selective nuclear transport of proteins is directed by specific signal sequences: nuclear localization signals (NLS) for import and nuclear export signals (NES) for export. To achieve selective transport, soluble transport factors are Keywords NPC remodeling; nuclear pore complex; nuclear transport; Nup358 ⁄ RanBP2; skeletal myogenesis Correspondence Y. Yoneda, Department of Frontier Biosciences, Graduate School of Frontier Biosciences, Osaka University, 1–3 Yamada-oka Suita Osaka 565-0871, Japan Fax: +81 6 6879 4609 Tel: +81 6 6879 4606 E-mail: yyoneda@anat3.med.osaka-u.ac.jp (Received 23 August 2010, revised 26 November 2010, accepted 3 December 2010) doi:10.1111/j.1742-4658.2010.07982.x The nuclear pore complex (NPC) is the only gateway for molecular traf- ficking across the nuclear envelope. The NPC is not merely a static nuclear-cytoplasmic transport gate; the functional analysis of nucleoporins has revealed dynamic features of the NPC in various cellular functions, such as mitotic spindle formation and protein modification. However, it is not known whether the NPC undergoes dynamic changes during biological processes such as cell differentiation. In the present study, we evaluate changes in the expression levels of several nucleoporins and show that the amount of Nup358 ⁄ RanBP2 within individual NPCs increases during mus- cle differentiation in C2C12 cells. Using atomic force microscopy, we dem- onstrate structural differences between the cytoplasmic surfaces of myoblast and myotube NPCs and a correlation between the copy number of Nup358 and the NPC structure. Furthermore, small interfering RNA- mediated depletion of Nup358 in myoblasts suppresses myotube formation without affecting cell viability, suggesting that NUP358 plays a role in myogenesis. These findings indicate that the NPC undergoes dynamic remodeling during muscle cell differentiation and that Nup358 is promi- nently involved in the remodeling process. Abbreviations AFM, atomic force microscopy; DM, differentiation medium; EDMD, Emery–Dreifuss muscular dystrophy; EGFP, enhanced green fluorescent protein; GM, growth medium; MyHC, myosin heavy chain; NES, nuclear export signal; NLS, nuclear localization signal; NPC, nuclear pore complex. 610 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS required to interact with both cargo substances and the NPC. One of the best characterized nuclear protein import pathways is mediated by the importin-a ⁄ b hete- rodimer, which imports basic NLS-containing proteins. Conversely, the nuclear export of leucine-rich NES- containing proteins is mediated by CRM1 (also known as exportin-1) [1–3]. A gradient of the small GTPase, RanGTP ⁄ GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors. RanGTP is abun- dant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange factor for Ran. Con- versely, the concentration of RanGDP is high in the cytoplasm as a result of the action of RanGAP, which promotes cytoplasmic GTP hydrolysis by Ran in con- junction with RanBP1 and ⁄ or Nup358 (also known as RanBP2). RanGTP interacts with transport factors and regulates the formation of transport complexes. GTP hydrolysis by Ran in the cytoplasm drives disso- ciation of the export cargo from the export complex, whereas RanGTP promotes disassembly of the import complex in the nucleus [1,2]. The NPC is composed of approximately 30 distinct proteins, known as nucleoporins [4], whose functional analyses have recently attracted much attention. The general architecture of the NPC is evolutionarily con- served in all eukaryotes and consists of filaments on the cytoplasmic surface and spoke rings and a basket- like structure on the nuclear side of the envelope [5]. In recent years, nucleoporins have been found to play dynamic roles in a variety of cellular functions, in addition to their well known function as structural components of the nuclear pore. For example, nucleo- porins have been shown to be involved in protein modification and the regulation of mitotic spindle for- mation [6]. Nup358 and the Nup107–160 subcomplex are localized to kinetochores during mitosis and play a role in spindle assembly [7]. It has long been suggested that nucleoporins are ubiquitously expressed in all cell types and at all developmental stages, although recent studies indicate that some nucleoporins, such as gp210, are expressed in a cell type- and tissue-specific manner [8,9]. In addition, the structural composition of the NPC changes during cell differentiation [10], although it is still unknown whether alterations in NPC archi- tecture play an important role in cellular differentia- tion. C2C12 cells are a well established model system for skeletal muscle differentiation. In high-serum growth medium (GM), these cells grow as mononuclear myo- blasts, although they fuse to form multinuclear myotu- bes when cultured in low-serum differentiation medium (DM). Dynamic remodeling of the nuclear envelope was reported during C2C12 skeletal muscle differentiation [11], including changes in the distribu- tion of lamins, which are components of the nuclear envelope lamina. Mutations within A-type lamin are known to cause several muscle diseases, including Emery–Dreifuss muscular dystrophy (EDMD), and the over-expression of a lamin A ⁄ C mutant in C2C12 cells has been shown to reliably mimic the features of EDMD [12]. Inner nuclear envelope proteins are also known to regulate NPC dynamics [13]. Understanding NPC dynamics during muscle differentiation will not only provide novel information regarding NPC func- tion, but also will contribute to a better understanding of the pathogenesis of muscular disorders such as EDMD. In the present study, we examine NPC remodeling and its associated functional changes during skeletal muscle differentiation in a C2C12 murine myoblast cell line. We compare the composition, architecture and nuclear-cytoplasmic transport activity of NPCs in myoblasts and myotubes. We find that dynamic remodeling of the NPC occurs during muscle cell differentiatin. Results Expression patterns of nucleoporins are altered from myoblasts to myotubes To determine the expression levels of NPC compo- nents (nucleoporins) during skeletal muscle cell differ- entiation, we used real-time PCR to quantify the mRNA levels of each nucleoporin in C2C12 cells before and after the induction of differentiation (Fig. 1). Approximately half of the nucleoporin mRNAs (i.e. Nup107, Nup85, Nup160, Nup43, Nup37, Nup35, Nup205, Nup188, Pom121, Ndc1, Nup155, Nup54, Nup62, NupL1, Nup153 and Nup50) were down-regulated after the induction of myogenesis. By contrast, the expression levels of some nucleoporin mRNAs (i.e. Nup214, Nup88, NupL2 (CG1), Nup133, Seh1, Nup93, Gp210, Nup98, Rae1 and Tpr) remained largely unchanged, and the remaining nucleoporin mRNAs (i.e. Nup358 and Sec13) were slightly up-regu- lated. These results indicate that the relative expression levels of individual nucleoporins change during muscle cell differentiation. To examine the protein levels of specific nucleopo- rins, we prepared C2C12 cell lysates at different stages of muscle cell differentiation and immunoblotted with available antibodies against several nucleoporins. Lysates from C2C12 cells grown in GM and from cells differentiated for either 2 or 5 days in DM were M. Asally et al. Roles of Nup358 in skeletal myogenesis FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 611 analyzed. As shown in Fig. 2A, the protein level of Nup358, a component of the cytoplasmic filaments of the NPC, gradually increased as muscle cell differentia- tion proceeded. All other nucleoporins tested (Nup160, Nup98, Nup93 and Nup62) showed no obvious changes in protein expression levels during differentia- tion. Furthermore, immunofluorescence analysis of Nup358 revealed a stronger signal in myotubes com- pared to myoblasts, whereas the Nup98 signal appeared to be unaltered (Figs 2B and S1). By con- trast, although anti-Nup358 staining also showed an intracellular signal (Fig. 2B), we considered the intra- nuclear signal to be nonspecific (Doc. S1A). We next focused on the nuclear envelope signal of anti-Nup358 staining. To definitely verify the increased expression of Nup358 at the NPCs of myotubes, we examined the Nup358 binding partners, RanGAP and CRM1, which localize to the nuclear rim in a Nup358-dependent manner [2]. RanGAP staining at the nuclear envelope was much stronger in myotubes than in myoblasts (Fig. 2C). Although CRM1 staining in myoblasts and myotubes was comparable when the cells were permea- bilized after formaldehyde fixation, the differences became more evident when the cells were fixed with formaldehyde containing Triton X-100, with stronger CRM1 signals being observed for myotubes than for myoblasts (Fig. 2D). These immunostaining patterns of Nup358, CRM1 and RanGAP clearly reveal that Nup358 expression is up-regulated during skeletal myogenesis in C2C12 cells. To determine whether this increase in Nup358 on the nuclear envelope corresponded to an increase in the number of Nup358 proteins in each NPC, we mea- sured NPC density. Consistent with a recent study [14], nuclear pore density was similar in myoblasts and myotubes (Fig. 2E), indicating that the composition of the myoblast NPC must differ from that of the myo- tube NPC. Specifically, the number of Nup358 pro- teins within individual NPCs increase during skeletal muscle differentiation. An architectural change in the NPC occurs during differentiation from myoblasts to myotubes Because the composition of the NPC changes during differentiation (Figs 1 and 2), we attempted to visual- ize the structure of NPCs at the nanoscale level using atomic force microscopy (AFM). As shown in Fig. 3A, AFM images of the NPCs in myoblasts and myotubes were successfully captured. It was previ- ously observed that the centers of some NPCs are plugged by complexes passing through the NPC [15–17]. Consistent with these studies, we observed that 29.3% of the NPCs in myoblasts were plugged, whereas 54.4% of NPCs in myotubes were plugged (Fig. 3B). Fig. 1. The relative mRNA expression levels of nucleoporins differ during muscle differentiation. C2C12 cells were grown in GM (blue bars) or for 2 days in DM (red bars). Nucleoporin mRNA levels were analyzed by real-time PCR (n = 3, PCR reaction; n = 2, RNA extraction) and normalized to tubulin. Error bars represent the SEM. Roles of Nup358 in skeletal myogenesis M. Asally et al. 612 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS The NPC characteristics measured in the AFM profiles were: outer diameter (O), height (H) and upper rim diameter (Fig. 3C). The values were statistically analyzed (U) using the Mann–Whitney U-test (P < 0.05 was considered statistically significant). The outer diameter of NPCs did not differ significantly between myoblasts and myotubes (Figs 3D and S2A). Myotubes contain greater amounts of Nup358 than do myoblasts (Figs 1 and 2) and, because Nup358 is local- ized in the cytoplasmic filaments of NPCs, we sus- pected that the heights of myotube NPCs might be greater than those of myoblasts. NPC height appeared to not be significantly different in myotubes and myo- blasts (P > 0.05) when unplugged and plugged NPCs were analyzed separately (Fig. 3F). By contrast, the mean ± SEM upper rim diameter increased significantly, from 72.5 ± 1.3 nm (n = 99) in myoblasts to 81.6 ± 1.3 nm (n = 68) in myotubes (Fig. 3E). This trend was observed even when unplugged and plugged NPCs were analyzed separately (Fig. 3D, E) and the different distributions of NPC upper rim diameters in myoblasts and myotubes are clearly demonstrated in a histogram (Fig. S2C). The upper rim diameter of the NPC increased by approxi- mately 9 nm during myotube formation, whereas the outer diameter and the height of the NPC were not significantly changed. Thus, the shape of the NPCs in myoblasts differs from that in myotubes. Nup358 is a cytoplasmically exposed component of the NPC [18] and was increased within individual NPCs during muscle differentiation. Thus, we hypothe- sized that increased Nup358 in individual NPCs was responsible for the change in NPC upper rim diameter. To test this, we used AFM to visualize Nup358- depleted NPCs. AFM analysis of NPCs revealed that the upper rim diameter of Nup358-depleted NPCs was smaller than for NPCs in control small interfering RNA (siRNA)-treated cells (Fig. 4B). By contrast, the height and outer diameter of Nup358-depleted NPCs did not differ significantly from those of the control NPCs (Fig. 4A, C). These results indicate that the Nup358 copy number within individual NPCs is Fig. 2. The level of Nup358 protein increases during skeletal myogenesis. (A) C2C12 cells were grown in GM (0 days) or in DM for 2 or 5 days. Immunoblotting analysis was performed with antibodies against a-tubulin, MyHC (muscle marker protein), Nup160, Nup98, Nup93, Nup62 and mAb414. (B–D) C2C12 myoblast cells (MB) and myotube cells (MT) were cultured on coverslips. The Nup358 cells were fixed and stained with antibodies against Nup358, Nup98 or RanGAP1 (C). The cells were fixed with (D, lower panels) or without (D, upper panels) Triton X-100 and then permeabilized and stained with an antibody against CRM1. Cells were observed with confocal microscopy (LSM510). Scale bars = 5 lm. (E) Myoblasts and myotubes were stained for RL1. NPC density was determined by counting the dots on the nuclear envelope (mean ± SD). M. Asally et al. Roles of Nup358 in skeletal myogenesis FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 613 closely correlated with the upper rim diameter. We conclude that the architecture of the NPC changes during muscle differentiation and that Nup358 is a critical determinant of the NPC architecture. Passive diffusion rate is the same in myoblasts and myotubes We next compared molecular trafficking through the NPCs in myoblasts and myotubes because the NPC is the only gateway for nuclear-cytoplasmic traffic. We observed both compositional and architectural differ- ences between NPCs in these two cell types. First, we used fluorescence recovery after photobleaching analy- sis to examine the passive diffusion rate in C2C12 cells stably expressing enhanced green fluorescent protein (EGFP), a protein small enough to passively diffuse through the NPC. The nuclear EGFP was photo- bleached, fluorescence recovery was monitored (Fig. 5A) and the relative intensity of fluorescence in the nucleus was plotted over time (Fig. 5B). In the early phase, the fluorescence recovery curves for myo- blasts and myotubes overlapped with each other, indi- cating that the passive diffusion rate through the NPC is the same in myoblasts and myotubes. We observed apparent differences in the fluorescence intensity at Fig. 3. Structural differences between myoblast and myotube NPCs. (A) Denuded nuclei from myoblasts and myotubes visualized by AFM. The area shown is 3 · 3 lm. Scale bar = 0.5 lm. (B) The percentage of unplugged and plugged NPCs. (C) The NPC profile was taken from each NPC image and three measurements were obtained for each NPC profile. O, I, and H represent the outer diameter, upper rim diameter and height, respectively. Outer and upper rim diameters indicate the distance between two points on the NPC ring base and on the cyto- plasmic ring, respectively. Height indicates the vertical distance between the NPC cytoplasmic surface and the base. Scale bar = 50 nm. (D) The outer diameter was measured and plotted [mean ± SEM; 145.4 ± 2.4 nm, n = 58 (MB); 144.8 ± 3.7 nm, n = 23 (MT) for unplugged and 143.9 ± 2.2 nm, n = 29 (MB); 145.7 ± 2.5 nm, n = 37 (MT) for plugged]. (E) The upper rim diameter was measured and plotted [mean ± SEM; 70.2 ± 1.9 nm, n = 58 (MB); 78.1 ± 2.3 nm, n = 23 (MT) for unplugged, and 76.1 ± 1.5 nm, n = 29 (MB); 83.2 ± 1.7 nm, n = 37 (MT) for plugged]. (F) The height was measured and plotted [mean ± SEM; 5.5 ± 0.16 nm, n = 116 (MB); 5.43 ± 0.31 nm, n = 46 (MT) for unplugged, and 5.2 ± 0.22 nm, n = 58 (MB); 4.8 ± 0.17 nm, n = 74 (MT) for plugged]. Data were statistically compared by Mann–Whitney U-tests. Roles of Nup358 in skeletal myogenesis M. Asally et al. 614 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS steady state, although this is likely a result of a difference in the ratio of the bleached nuclear area to the total cell volume (Doc. S1B). Nuclear export appears to be more active in myotubes than in myoblasts We next compared the nuclear transport activities before and after muscle differentiation, using microin- jection to examine the rate of active nuclear-cytoplas- mic protein transport. Either GST-SV40NLS-GFP (NLS-GFP) or GST-GFP-RevNES-SV40NLS (GFP- NES-NLS) recombinant protein was microinjected into the cytoplasm of C2C12 cells, and the rate of nuclear transport was observed using time-lapse fluorescence microscopy. The nuclear import efficiency of NLS- GFP did not differ significantly in myoblasts and myo- tubes (Fig. 6A and Videos S1 and S2), suggesting that nuclear import activity is almost identical in myoblasts and myotubes. By contrast, the subcellular localization of microin- jected GFP-NES-NLS was clearly different in the two cell types. In myoblasts, GFP-NES-NLS was primarily localized to the nucleus, whereas, in myotubes, it was evenly distributed between the nucleus and the cyto- plasm (Fig. 6B and Videos S3 and S4). It is important to note that myotubes are polykaryons, whereas myo- blasts have one nucleus. To address the possible effect of this difference on the subcellular distribution of GFP-NES-NLS, myoblasts were fused using polyethyl- ene glycol and GFP-NES-NLS was microinjected into the cytoplasm of the fused cells (Fig. 6D). The locali- zation in the fused cells was very similar to that in nor- mal myoblasts, indicating that the differential distribution of GFP-NES-NLS observed in myoblasts and myotubes is not simply a result of the difference in nuclear number. Additionally, treatment of myotu- bes with leptomycin B, a specific inhibitor of CRM1- mediated nuclear export, caused the accumulation of GFP-NES-NLS proteins in the nucleus (Fig. 6C), showing that GFP-NES-NLS protein is actively shut- tled across the nuclear envelope in myotubes. Taken together with the data from the NLS injections, these results strongly suggest that nuclear export efficiency is increased in myotubes relative to myoblasts. siRNA-mediated Nup358 depletion suppresses myotube formation To determine whether Nup358 is necessary for C2C12 differentiation, we performed siRNA experiments using two different sets of siRNA duplexes against Nup358. As indicated, both Nup358 siRNAs effec- tively reduce Nup358 expression (Fig. 7A). Immunoflu- orescence staining demonstrated a marked reduction in the nuclear rim signal for Nup358 in siNup358-treated cells (Fig. 7B). Furthermore, the nuclear rim signal of RanGAP, which localizes to the nuclear envelope in a Nup358-dependent manner, was clearly diminished (Fig. 7B). Other nucleoporins (Nup214, Nup98 and Nup62) remained unaltered at the nuclear rim in Nup358-depleted cells (Fig. 7B), indicating that the depletion of Nup358 did not affect all NPC compo- nents. Microinjection analysis of the GFP-NES-NLS trans- port substrates suggested that nuclear import and export of proteins was globally unaffected in Nup358- depleted cells (Figs 7C and S3). Under these condi- tions, the siRNA-treated C2C12 myoblasts were cultured in DM and then stained for myosin heavy chain (MyHC; green) and DNA (blue). As shown in Fig. 7D, the efficiency of multinuclear myotube forma- tion was clearly decreased in Nup358-depleted cells, whereas the control cells (left two panels) efficiently underwent myotube formation. These results indicate that Nup358 is specifically involved in muscle cell differentiation. Discussion In the present study, we have demonstrated that both the composition and the architecture of NPCs are altered during the differentiation of C2C12 cells. Our real-time PCR data indicate that the mRNA expres- sion levels of several nucleoporins differ between myo- blasts and myotubes (Fig. 1). The mRNA levels of a large proportion of nucleoporins decreased during dif- ferentiation (i.e. Nup107, Nup85, Nup160, Nup43, Nup37, Nup35, Nup205, Nup188, Pom121, Ndc1, Fig. 4. Nup358 depletion decreases the upper rim diameter of the NPC. C2C12 cells were transfected with nontargeting siRNA or Nup358 siRNA oligonucleotides (siNup358-2) and incubated for 48 h. The outer diameter (A), upper rim diameter (B) and height (C) of the NPC were measured and shown in a graph as in Fig. 3. M. Asally et al. Roles of Nup358 in skeletal myogenesis FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 615 Nup155, Nup54, Nup62, NupL1, Nup153 and Nup50). Notably, most of the nucleoporins for which mRNA expression was maintained during differentiation (e.g., Nup358, Nup214, Nup88 and NupL2 (CG1), Nup98, Rae1 and Tpr) are involved in the nuclear export of proteins or mRNA, indicating that the relative expres- sion of the nucleoporins involved in nuclear export increased during myogenesis. Consistent with this, we found that nuclear export in myotubes was more active than that in myoblasts (Fig. 6), whereas the rates of nuclear import (Fig. 6) and passive diffusion (Fig. 5) remained constant. We also showed protein expression levels of some nucleoporins by immunoblotting (Fig. 2). Although real-time PCR showed decreased expression of Nup107 and Nup62, their protein expression appeared to be equivalent, as indicated by immunoblotting. An expla- nation for such discrepancies of nucleoporin expression levels between qPCR and immunoblot results was offered by a recent study [14] demonstrating that some scaffold nucleoporins, such as members of the Nup107-160 subcomplex, have extremely long protein half-lives compared to other nucleoporins. Thus, pro- teins levels remain stable, even if mRNA expression levels are decreased. We specifically demonstrated that the copy number of Nup358 within individual NPCs increases during C2C12 muscle differentiation, at both mRNA (Fig. 1) and protein (Fig. 2) levels. Nup358 plays a supportive role in CRM1-mediated nuclear export by stimulating CRM1 recycling [2]. Nup358 provides a platform for the disassembly of CRM1 export complexes and the re-import of free CRM1 to the nucleus [19]. As shown in Fig. 2D, CRM1 signals on the NPC were increased in myotubes compared to myoblasts, coinciding with the increase of Nup358 in myotube NPCs. Although we were unable to demonstrate the direct effects of Nup358 on protein export in myotubes (Fig. 7C), it is possible that the Fig. 5. The efficiency of passive diffusion though the NPC is the same in myoblasts and myotubes. (A) C2C12 cells stably expressing EGFP were photobleached for 4 s and fluorescence recovery was monitored immediately after bleaching. (B) Data were normalized to the pre-bleaching value of 100% and plotted against time [mean ± SEM; n = 5 (myoblasts), n = 12 (myotubes)]. Roles of Nup358 in skeletal myogenesis M. Asally et al. 616 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS relative increase in several nucleoporins, which are known to function in protein export, rather than the increase of Nup358 alone, may cause the activation of CRM1 in myotubes. It is therefore likely that an increase in Nup358 during myogenesis supports the CRM1 activity and is involved in the activation of nuclear protein export in myotubes. It is highly possible that a selective increase in the efficiency of nuclear protein export triggers the redistri- bution of a number of key molecules important for cell differentiation and that the difference in nuclear export activity between myotubes and myoblasts affects cell differentiation from myoblasts to myotubes. For exam- ple, HDAC5 (histone deacetylase 5) is known to move from the nucleus to the cytoplasm during myotube for- mation in a differentiation-dependent manner and is involved in the control of cellular differentiation in C2C12 [20,21]. Similarly, the regulation of nuclear- cytoplasmic transport by importin-a subtype switching was shown to trigger cell differentiation [22]. Further studies will be required to elucidate this possibility. The structure of the NPC changes to allow adapta- tion to different cellular environments during differen- tiation [8–10]. In the present study, using AFM, we found that the architecture of the NPC changes during muscle differentiation and that Nup358 is a key deter- minant of NPC architecture. In addition, we showed that the depletion of Nup358 prevented myotube for- mation (Fig. 7). These results indicate that Nup358 affects the structure of the NPC and plays a role in muscle cell differentiation. Recent evidence suggests that the NPCs are closely related to the transcriptional machinery [6] and thus it is also possible that the structural changes induced by Nup358 modulate the transcription of genes required for cell differentiation. Furthermore, Nup358 is known to be a multifunction- al protein that acts as both an allosteric activator for kinesin [23] and a SUMO E3 ligase [24]. Nup358 may therefore contribute to muscle differentiation in C2C12 cells in various ways. In conclusion, in the present study, we demonstrate that the NPC is functionally and structurally regulated during muscle cell differentiation and that Nup358 is required for muscle cell differentiation and also is likely involved in the remodeling of the NPC. Materials and methods Cells and antibodies C2C12 myoblast cells were cultured in GM consisting of DMEM (D5796; Sigma, St Louis, MO, USA) supplemented with 10% fetal bovine serum. The cells were maintained in an incubator at 5% CO 2 and 37 °C. To induce differentiation, Fig. 6. Active nuclear export through NPCs is facilitated in myotubes. GST-SV40NLS- GFP (A) or GST-GFP-RevNES-SV40NLS (B) recombinant protein was microinjected with an injection marker into the cytoplasm of C2C12 cells and then incubated for 10 min at 37 °C (for NLS substrate, see Videos S1 and 2; for NES-NLS substrate, see Videos S3 and 4). Scale bars = 50 lm. (C) GST- GFP-RevNES-SV40NLS protein was microin- jected with an injection marker into the cytoplasm and then incubated in LMB-con- taining medium for 10 min at 37 °C. Scale bar = 20 lm. (D) C2C12 myoblast cells were fused using polyethylene glycol (PEG). Recombinant GST-GFP-RevNES-SV40NLS protein was microinjected with an injection marker into the cytoplasm of PEG-fused myoblasts. The cells were incubated in DMEM for 10 min at 37 °C. Scale bar = 20 lm. M. Asally et al. Roles of Nup358 in skeletal myogenesis FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 617 GM was replaced with DM consisting of DMEM with 3% horse serum for 2–5 days. For poly(ethylene glycol) fusion, cells were incubated in 50% PEG-8000 in DMEM (D5796; Sigma) for 1 min and washed with NaCl ⁄ P i . Cells were then cultured for 2 h in an incubator at 5% CO 2 and 37 °C. Anti-Nup98 sera were kindly provided by Tachibana et al. [25]. Antibodies purchased from commercial sources were: mAb414 (MMS-120p; Covance, Princeton, NJ, USA), anti-Nup214 (sc-26055; Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-Nup160 (sc-27401; Santa Cruz Biotechnology), anti-Nup107 (A301-787A; Bethyl, Mont- Fig. 7. Depletion of Nup358 from C2C12 cells by siRNA. C2C12 cells were mock-transfected (no siRNA) or transfected with nontargeting siRNA or Nup358 siRNA oligonucleotides (siNup358-1, -2) and incubated for 48 h. (A) Immunoblotting analysis with mAb414 was performed 48 h after transfection. Nup62 was used as a loading control. (B) Immunofluorescence was performed with antibodies against Nup358, Ran- GAP1, Nup214, Nup98 and Nup62. Scale bars = 10 lm. (C) C2C12 cells were transfected with nontargeting siRNA or Nup358 siRNA oligo- nucleotide and incubated for 48 h. Recombinant GST-GFP-RevNES-SV40NLS protein was microinjected with an injection marker into the cytoplasm of C2C12 cells transfected with siRNA oligonucleotides. (D) C2C12 cells were mock-transfected (no siRNA) or transfected with nontargeting siRNA or Nup358 siRNA oligonucleotides (siNup358-1, -2). The cells were induced to differentiate 2 days after transfection and cultured in DM without transfection reagents for 2.5 days. The cells were fixed and stained with anti-MyHC (green) and Hoechst 33342 (blue). Scale bar = 100 lm. Roles of Nup358 in skeletal myogenesis M. Asally et al. 618 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS gomery, TX, USA), anti-Nup358 (PA1-082; Affinity BioRe- agents, Golden, CO, USA), anti-Nup93 (551976; BD Pharmingen, San Diego, CA, USA), anti-Nup62 (N43620; Transduction Lab, Lexington, KY, USA), anti-skeletal myosin heavy chain (M4276; Sigma) and anti-a-tubulin (T9026; Sigma). Plasmids and recombinant proteins For recombinant GST-GFP-NES-NLS, synthesized oligo- nucleotides for RevNES (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A-3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS. The oligonucleotide fragment for NES-NLS was flanked with BglII and BamHI, and then inserted into the BamHI site of pGEX-hGFP. Recombinant GST-GFP-NES-NLS and GST-NLS-GFP proteins were expressed and purified as described previously [3]. Real-time PCR Total RNA from C2C12 cells was purified using the RNeasy kit (Qiagen, Valencia, CA, USA) and cDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR was per- formed using FastStart SYBR Green Master (Roche, Basel, Switzerland) with an ABI PRISM 7900HT (Applied Biosys- tems, Foster City, CA, USA). Primer sets were designed by Primer Bank [26] and are listed in Table S1. RNA interference Cells were either mock-transfected or transfected with syn- thesized siRNAs [nontargeting, 5¢-GCAGCAUCUUUAAU- GAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup- 358-2)]. Transfection with a specific siRNA was performed using RNAi Max (Invitrogen) in accordance with the manu- facturer’s instructions. The transfected cells were harvested 48 h (for Nup358) or 72 h (for Nup107) after transfection and fixed for immunofluorescence, lysed for immunoblotting or used for induced myotube formation in DM without siR- NA reagents. Immunoblotting and immunofluorescence For immunoblotting, C2C12 cells were lysed in NP-40 buf- fer (150 mm sodium chloride, 1% NP-40 and 50 mm Tris, pH 8.0), analyzed by SDS ⁄ PAGE and immunoblotted using Immobilon-P (Millipore, Billerica, MA, USA) with standard semidry methods. The ECLÔ detection reagent (GE Healthcare, Milwaukee, WI, USA) was used for pro- tein visualization. For immunofluorescence, C2C12 cells were grown on glass coverslips (Matsunami, Osaka, Japan). The cells were washed twice in NaCl ⁄ P i , fixed with 3.7% formaldehyde in NaCl ⁄ P i for 10 min, and permeabilized with 0.5% Triton X-100 in NaCl ⁄ P i for 5 min. For Nup358 staining, the cells were permeabilized simultaneously with fixation. After incu- bation with 5% skim milk in NaCl ⁄ P i , antibodies were incubated with the cells for 1 h. The cells were washed with NaCl ⁄ P i and incubated with Alexa 488- or 546-conjugated antibodies for 1 h. Samples were then thoroughly washed with NaCl ⁄ P i and mounted in NaCl ⁄ P i -glycerol plus 1,4- diazabicyclo[2.2.2]octane. DNA was counterstained with Hoechst 33342. All procedures for immunofluorescence were performed at room temperature. The stained cells were observed with a laser-scanning LSM510 microscope (Carl Zeiss, Oberkochen, Germany). Calculation of NPC density For the measurement of NPC density, methanol ⁄ acetone- fixed cells were stained with mAb414. NPC number in a 2 · 2 lm area was counted for both myoblast and myotube nuclei. The fluorescence intensity of a spot was used to deter- mine how many pores existed in a diffraction-limited area. AFM AFM was performed in contact mode with a Molecular Force Probe 3D (MFP-3D; Asylum Research, Santa Bar- bara, CA, USA) using a microcantilever OMCL TR-400 PSA (Olympus, Tokyo, Japan). To prepare the AFM sam- ple, myoblast and myotube cells were cultured on an eight- well slide glass (MP Biomedicals, LLC, Santa Ana, CA, USA). The cells were treated with hypotonic buffer (40 m m NaCl, 5.4 mm KCl, 0.8 mm MgCl, 1 m m NaH 2 PO 4 and 10 mm Hepes, pH 7.4) for 3 min and then treated with buf- fer X (1% Triton X-100, 75 mm KCL, 15 mm NaCl and 20 mm Mops, pH 7.4) for 6 min. Denuded nuclei were fur- ther washed with buffer W (15.5 mm NaCl, 70 mm KCl, 6.5 mm K 2 HPO 4 and 1.5 mm NaH 2 PO 4 ) and fixed with 1% glutaraldehyde and 3.7% formaldehyde in NaCl ⁄ P i for 15 min. Finally, the nuclei were rinsed with Milli-Q water (Millipore) and air-dried. Data were analyzed with Igor-Pro (Wavemetrix Inc., Portland, OR, USA) and statistical anal- yses were performed with GraphPad Prism 4 (GraphPad Software Inc., San Diego, CA, USA). Fluorescence recovery after photobleaching To establish stable cell lines, transfection was carried out with Effectene Transfection Reagent (Qiagen). Ssp1- digested pIRES-puro3-EGFP was transfected into C2C12 M. Asally et al. Roles of Nup358 in skeletal myogenesis FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 619 [...]... Differential localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda Y (2007) Triggering neural differentiation of ES cells by subtype switching of importin-alpha Nat Cell Biol 9, 72–79 23 Cho KI, Yi H, Desai R, Hand AR, Haas AL & Ferreira PA (2009) RANBP2 is an allosteric... Hybridoma (Larchmt) 24, 244–247 26 Wang X & Seed B (2003) A PCR primer bank for quantitative gene expression analysis Nucleic Acids Res 31, e154 Supporting information The following supplementary material is available: Doc S1 (A) Nuclear envelope localization of Nup358 (B) Nuclear FRAP assay for nuclear- cytoplasmic transport dynamics Fig S1 (A) Myoblasts (MB) and myotubes (MT) were stained with anti-Nup358... allosteric activator of the conventional kinesin-1 motor protein, KIF5B, in a minimal cell-free system EMBO Rep 10, 480–486 24 Pichler A, Gast A, Seeler JS, Dejean A & Melchior F (2002) The nucleoporin RanBP2 has SUMO1 E3 ligase activity Cell 108, 109–120 25 Fukuhara T, Ozaki T, Shikata K, Katahira J, Yoneda Y, Ogino K & Tachibana T (2005) Specific monoclonal antibody against the nuclear pore complex protein,... anti-Nup358 serum as shown in Fig 2 Roles of Nup358 in skeletal myogenesis (B) C2C12 cells were transfected with pEGFP-Nup358 and then fixed and stained with anti-CRM1 and antiGFP Fig S2 Histogram of AFM data from Fig 4E–G Outer diameter (A) , upper rim diameter (B) and height (C) data obtained using AFM (Fig 3D–G) are shown in a histogram Blue bars represent the data obtained from myoblasts and red bars represent... RanBP2 attaches to the nuclear pore complex via association with Nup88 and Nup214 ⁄ CAN and plays a supporting role in CRM1-mediated nuclear protein export Mol Cell Biol 24, 2373–2384 20 McKinsey TA, Zhang CL, Lu J & Olson EN (2000) Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation Nature 408, 106– 111 21 Miska EA, Langley E, Wolf D, Karlsso C, Pines J & Kouzarides... cell-type specific nuclear pores in metazoans Exp Cell Res 292, 359–370 10 Perez-Terzic C, Faustino RS, Boorsma BJ, Arrell DK, Niederlander NJ, Behfar A & Terzic A (2007) Stem cells transform into a cardiac phenotype with remodeling of the nuclear transport machinery Nat Clin Pract Cardiovasc Med 4(Suppl 1), S68–S76 11 Markiewicz E, Ledran M & Hutchison CJ (2005) Remodelling of the nuclear lamina and nucleoskeleton... dynamics of nuclear pores: pore- free islands and lamins J Cell Sci 119, 4442–4451 14 D’Angelo MA, Raices M, Panowski SH & Hetzer MW (2009) Age-dependent deterioration of nuclear pore complexes causes a loss of nuclear integrity in postmitotic cells Cell 136, 84–295 15 Beck M, Lucic V, Forster F, Baumeister W & Medalia O (2007) Snapshots of nuclear pore complexes in action captured by cryo-electron tomography... pore- targeting complex in nuclear protein import EMBO J 14, 3617–3626 4 Cronshaw JM, Krutchinsky AN, Zhang W, Chait BT & Matunis MJ (2002) Proteomic analysis of the mammalian nuclear pore complex J Cell Biol 158, 915–927 5 D’Angelo MA & Hetzer MW (2008) Structure, dynamics and function of nuclear pore complexes Trends Cell Biol 18, 456–466 620 6 Tran EJ & Wente SR (2006) Dynamic nuclear pore complexes: life on the. .. for skeletal muscle differentiation in vitro J Cell Sci 118, 409–420 12 Ostlund C, Bonne G, Schwartz K & Worman HJ (2001) Properties of lamin A mutants found in EmeryDreifuss muscular dystrophy, cardiomyopathy and Dunnigan-type partial lipodystrophy J Cell Sci 114, 4435–4445 13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R, Tachibana T, Hashikawa T, Imamoto F & Imamoto N (2006) Cell-cycle-dependent dynamics... Crossing the nuclear envelope: hierarchical regulation of nucleocytoplasmic transport Science 318, 1412–1416 2 Hutten S & Kehlenbach RH (2007) CRM1-mediated nuclear export: to the pore and beyond Trends Cell Biol 17, 193–201 3 Imamoto N, Shimamoto T, Takao T, Tachibana T, Kose S, Matsubae M, Sekimoto T, Shimonishi Y & Yoneda Y (1995) In vivo evidence for involvement of a 58 kDa component of nuclear pore- targeting . (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites. [nontargeting, 5¢-GCAGCAUCUUUAAU- GAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1),