a promising year of shipbuilding

Tài liệu Lesson 30-A promising year of shipbuilding pdf

Ngày tải lên : 13/12/2013, 21:15

... Graig Group in five month intervals. The signing of the building contracts signals the start of a busy and successful year for Vinashin, as the company has also received orders from Vinalines ... Vinashin has maximised its limited State budget allocation to cut down on imports. Now, approximately 30-40 per cent of the equipment and materials used in the shipyards are made in Viet Nam. ... Nam. Vinashin expects this figure to reach 60 per cent by 2010. Contract signing ceremony between Vinashin and Aalborg Denmark Vinashin also has plans to upgrade the Ha Long, Bach Dang, Ben...

3
632
0

Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

Ngày tải lên : 18/06/2014, 19:20

... as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC- GATTTCCCGC ... 9:99 http://www.translational-medicine.com/content/9/1/99 Page 8 of 10 hyperplasia; HE: hematoxylin and eosin; iTRAQ: isobaric tags for relative and absolute quantification; PAP: pro- static acid phosphatase; PCa: prostate cancer; PIN: pro- static ... growth of colon cancer by augmenting cell survival via the Akt/PKB pathway. Cancer Cell 2004, 5:329-339. 16. Kudo Y, Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M, Takata T:...

10
362
0

o cáo hóa học:" Periostin: a promising target of therapeutical intervention for prostate cancer" pptx

Ngày tải lên : 20/06/2014, 04:20

... as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC- GATTTCCCGC ... growth of colon cancer by augmenting cell survival via the Akt/PKB pathway. Cancer Cell 2004, 5:329-339. 16. Kudo Y, Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M, Takata T: ... 5 of 10 hyperplasia; HE: hematoxylin and eosin; iTRAQ: isobaric tags for relative and absolute quantification; PAP: pro- static acid phosphatase; PCa: prostate cancer; PIN: pro- static intraepithelial...

10
316
0

Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

Ngày tải lên : 25/10/2012, 11:40

... a 76 -year- old man with a coarctation of the aorta. Cardiology 1999, 92:284-286. 8. Bauer M, Alexi-Meskishvili V, Bauer U. Benefits of surgical repair of coarctation of the aorta in patients ... York: McGraw Hill Professional; 2004:1866. 4. Campbell M. Natural history of coarctation of the aorta. Br Heart J 1970, 32:633-640. 5. Jenkins NP, Ward AR. Coarctation of the aorta: natural history ... Discussion Aortic coarctation is a congenital vascular lesion typically diagnosed in early life, accounting for 5 to 10% of all congenital cardiovascular malformations 1 but may go undetected...

2
487
0

Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"

Ngày tải lên : 26/10/2012, 09:07

... of Paducah, Paducah, KY, USA 5. Statistician at the Pain Management Center of Paducah, Paducah, KY, USA  Corresponding author: Laxmaiah Manchikanti, MD, 2831 Lone Oak Road, Paducah, Kentucky ... Hospital, Philadelphia, PA, Associate Professor, Department of PM&R, Temple University Medical School, Philadelphia, PA, USA 4. Research Coordinator at the Pain Management Center of Paducah, ... Vidyasagar Pampati 5 1. Medical Director of the Pain Management Center of Paducah, Paducah, KY and Associate Clinical Professor, Anest- hesiology and Perioperative Medicine, University of Louisville,...

12
669
0

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Ngày tải lên : 03/11/2012, 11:44

... http://www.medsci.org 35 Abbreviations AVNRT: Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; ... (5) and insufficient (6). Y-axis: Percentage of patients Panel A: AVNRT. Panel B: AVRT. Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying ... transvenous cryoablation of supraventricular tachycardia (atrial fibrillation, atrial flutter, Wolff-Parkinson-White syn- drome, atrioventricular nodal reentry tachycardia). Journal of cardiovascular...

9
679
0

Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and triﬂuoromethionine, a promising lead compound against amoebiasis ppt

Ngày tải lên : 07/03/2014, 05:20

... Parasitol 147, 163–176. 36 Sato D, Yamagata W, Kamei K, Nozaki T & Harada S (2006) Expression, puriﬁcation and crystallization of L-methionine gamma-lyase 2 from Entamoeba histolytica. Acta ... Nakayama T, Esaki N, Tanaka H & Soda K (1988) Speciﬁc labeling of the essential cysteine residue of L-methionine gamma-lyase with a cofactor analogue, N-(bromoacetyl)pyridoxamine phosphate. ... Misaki S, Yamashita M, Tamura T, Takak- ura T, Yoshioka T, Yagi S, Hoffman RM, Takimoto A & Inagaki K (2007) Structure of the antitumor enzyme L-methionine c-lyase from Pseudomonas putida at...

13
406
0

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simpliﬁed enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Ngày tải lên : 23/03/2014, 06:20

... consumption rate appears at a 3.3-fold increased value of k ATPase as compared to the value k 0 ATPase ¼ 1:6h À1 . At values of k ATPase exceeding seven-fold of its normal value, no stationary states can ... physiologically feasible ranges: 1 2 k 0 ATPase k ATPase 2k 0 ATPase (small variation of the energetic load) 1 5 k 0 ATPase k ATPase 5k 0 ATPase (large variation of the energetic load) 1 50 k 0 ox ... 5. Ranking of saturation parameters for hepatocyte purine metabolism. Average ranking of saturation parameters according to their impact on the dynamic stability of the network assessed by analysis...

15
456
0

gallery of best resumes for people without a four-year degree

Ngày tải lên : 01/06/2014, 10:19

... Health Association of New York D ATA MANAGEMENT  Researched automated bookkeeping systems for the Association and was instrumental in the selection and purchase of the Data Ease software. ... and documentation Grand Rapids, MI Packaging Converting, Inc. 1990–1993 Office Manager / Assistant to Plant Manager Processed accounts payable and receivable; prepared trend analysis, balance ... allocation policies; processed accounts payable and accounts receivable. Developed standardized procedures for accounts payable and receivable Calculated payroll Prepared all related tax payments...

433
514
0

báo cáo sinh học:" Systematic inclusion of mandatory interprofessional education in health professions curricula at Gunma University: a report of student self-assessment in a nine-year implementation" ppt

Ngày tải lên : 18/06/2014, 17:20

... Hatsue Ogawara - ogawara@health.gunma-u.ac.jp; Tomoko Hayashi - tomokoha@health.gunma-u.ac.jp; Yasuyoshi Asakawa - yasakawa@health.gunma-u.ac.jp; Kiyotaka Iwasaki - kiwasaki@health.gunma-u.ac.jp; ... also obtained. Statistical analysis A multivariate analysis of variance (MANOVA) model was used, and then factor analysis of the responses was per- formed with varimax rotation by means of the Statistical Package ... curricula at Gunma University: a report of student self-assessment in a nine -year implementation Hatsue Ogawara 1 , Tomoko Hayashi 2 , Yasuyoshi Asakawa 3 , Kiyotaka Iwasaki 4 , Tamiko Matsuda 2 ,...

8
488
0

Báo cáo sinh học: "Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" docx

Ngày tải lên : 18/06/2014, 19:20

... DC loading and imaging and data analysis. CO YZ participated in nanoparticle characterization, DC imaging and data analysis. MO participated in nanoparticle characterization, DC loading and imaging ... statistical analysis and manuscript preparation. DM participated in nanoparticle characterization, DC loading and data analysis. VK participated in data analysis and supervised studies related to murine ... into nanoparticles, and data analysis. VB participated in the design of the study, helped with the statistical analysis and manuscript preparation. YZ participated in nanoparticle characterization,...

10
386
0

báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

Ngày tải lên : 18/06/2014, 19:20

... conception and design of the study, acquisition of data and analysis and interpretation of data, (ii) drafting of this manuscript and have given final approval of this version for publica- tion. Additional ... general practices from the North Staffordshire Pri- mary Care Research Consortium were used as a population sampling frame to mail 11230 adults aged 50 years and over with a postal questionnaire ... Classification of Functioning, Disability and Health provides a framework to describe the impact of health conditions on abnormal functioning at three separate levels: anatomical/physiological (impairment); individual...

11
498
0

Báo cáo hóa học: " Discovery of frameshifting in Alphavirus 6K resolves a 20-year enigma" docx

Ngày tải lên : 20/06/2014, 01:20

... overscores. CGGGCGCACGCAGC U AG U G U GGCAGAGAC U A U GGCC U AC UU G U GGGACCAAAACCAAGCG UU G UU C U GG UU GGAG UUU GCGGCCCC U G UU GCC U GCA U CC U CA U CA U CACG U A UU GCC U C AGAAACG U GC U G U G UU GC U G U AAGAGCC UUU C UUUUUU AG U GC U AC U GAGCC U CGGGGCAACCGCCAGAGC UU ACGAACA UU CGACAG U AA U GCCGAACG U GG U GGGG UU CCCG U A U AAG RAHAASVAETMAYLWD Q N Q ALFWLEFAAPVACI ... 41TF (GCCTTTCTTTTTTAGTGCTACTTAGCCTCGGGGC) and 41TR (GCCCCGAGGCTAAGTAGCACTAAAAAAGAAAG GC). PCR product was then transformed into DH5αT1 cells (InVitrogen) and plated on Ampicillin-LB plates. Propagated plasmids ... '6K' and '4K' is the degree of acylation, then the deacylated '6K' and '4K' should migrate together (as lane 1 of Figure 4B appears to show that deacylation...

19
466
0

báo cáo hóa học:" Enhanced presentation of MHC class Ia, Ib and class II-restricted peptides encapsulated in biodegradable nanoparticles: a promising strategy for tumor immunotherapy" doc

Ngày tải lên : 20/06/2014, 03:20

... PE-anti-human HLA-DR, PE-anti-human CD83, FITC-anti-human CD80, and FITC-anti-human CD86. All data was analyzed using the Cell Quest software. Antigen presentation by the NP-loaded DC Human ... and IFN-g measured by ELISA. Statistical analysis Data were analyzed by descriptive statistics, calculating the mean and standard deviation for continuous variables. The paired Student’s t test was ... as well as insertional mutagenesis and oncogenic effects [35]. Nanoparticle-based vaccin e deliver y system s offer sig- nificant advantages due to their safety profile, ease of manufacture and...

10
375
0

báo cáo hóa học:" Tuberculosis of symphysis pubis in a 17 year old male: a rare case presentation and review of literature" potx

Ngày tải lên : 20/06/2014, 04:20

... review of literature Kamal Bali * , Vishal Kumar, Sandeep Patel, Aditya K Mootha Abstract Tuberculosis of symphysis pubis is a rare condition with hardly any report of such cases in the last decade. ... 1 1991 Rozadilla A 1 1992 Mazameque L 1 1995 Tsay MH 1 1997 Benbouazza K 2 2001 Balsarkar DJ 1 2006 Bayrakci K 1 * one case report along with review of 15 cases. Bali et al. Journal of Orthopaedic ... tubercular osteo- myelitis, and differe ntiate them by means of aspiration and histological evaluation. Only then can a rational and specific therapy be initiated. In our case, we had a high index of...