the ostracod carapace as a hydrochemical source of information at water sediment interface
Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx
... shoots) The comparisons (Tab IIc) are based on the method of contrasts Comparisons concerned P1 + P2 data and also P1 data once the logistic model adjusted on P1 data only IIa Main features of the ... explanatory factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical and a causal value, i.e functional and more precisely ... damage to the spring shoot Thus according to general epidemiological laws, the causal nature of a relationship was particularly well demonstrated when the emergence of a phenomenon was increased...
- 8
- 348
- 0
Báo cáo y học: "Dermoid cyst of the urinary bladder as a differential diagnosis of bladder calculus: a case report" pps
... Misra S, Agarwal PK, Tandon RK, Wakhlu AK, Misra NC: Bladder teratoma: a case report and review of literature Indian J Cancer 1997, 34:20-21 Agrawal S, Khurana N, Mandhani A, Agrawal V, Jain ... and the patient as well as the Figure Sweat glands, hyalinized fibroblastic tissue Sweat glands, hyalinized fibroblastic tissue Page of (page number not for citation purposes) Journal of Medical ... associated with bladder diverticuli and vesical stones [5] This tumour was a solitary tumour at the apex of the bladder It contained calcified material and fat The anterior midline position of the...
- 3
- 231
- 0
Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps
... later, with claudication of the same (right) limb occurring at a distance of more than half a mile and after exercise A repeat Duplex scan demonstrated that his popliteal artery was widely patent ... underwent a surgical exploration of his popliteal artery under general anaesthesia through a posterior approach that allowed adequate exposure of the popliteal artery and cysts Evacuation of all three ... this article as: Ypsilantis and Tisi: Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case...
- 4
- 333
- 0
Báo cáo y học: " Double rupture of interventricular septum and free wall of the left ventricle, as a mechanical complication of acute myocardial infarction: a case report" pot
... preparation, editing, and submission APK was involved in the literature review and manuscript preparation EPM was involved in the patient's evaluation All authors read and approved the final manuscript ... the anteroseptal AMI was complicated by VSD near the LV apex The episode of hypotension at the fifth post-infarct day was probably the manifestation of the second cardiac rupture (FWR), which was ... coexistence of FWR is frequently established only at the time of operation for the correction of VSD [3] Tanaka et al reported that the majority of patients had an apical AMI and VSD near the junction...
- 5
- 280
- 0
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... Ministry of Employment, the Ministry of Social Affairs and the Ministry of Education DWECS was conducted in 1990, and featured a random sample drawn from the Central Population Register of Denmark of ... Additional analysis treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase in disability pension risk with increase in absence days/yr A 10-day increase...
- 6
- 578
- 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... [W/m3] The gas phase and the liquid phase are assumed to be in thermodynamic equilibrium, i.e., the liquid water and the gas phase are at the same temperature The potential distribution in the gas ... relate the level of over- and undersaturation as well as the amount of liquid water present to the amount of water undergoing phase change In the present work, the procedure of the current author ... peak appears in the cathode catalyst layer, implying that major heat generation takes place in the region In general, the temperature at the cathode side is higher than that at the anode side; this...
- 18
- 549
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release glucoronic acids, acetyl xylan esterases that hydrolyze acetylester bonds, ferulic acid ... fragments and acetyl groups are removed forming acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating ... hours At 25 C pretreatment of wheat straw resulted in one half of lignin and most of the hemicelluloses to be solubilised Operating at ambient temperature has the advantage of eliminating heating...
- 20
- 437
- 0
Tài liệu The Value of the Case Study as a Research Strategy doc
... that the application of the methodology is as likely (perhaps inherently) at fault as the methodology itself Qualitative research as preparation - As mentioned above, qualitative research has a ... re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study protocol as well as the case study database already mentioned Validity and ... researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained to \allow repetition and...
- 15
- 587
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... general anesthesia Maternal death due to anesthesia is the sixth leading cause of pregnancyrelated death in the United States [6] and most anesthesia-related deaths occur during general anesthesia ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per ... allocated for the provision of obstetric anesthesia services The OAAI was calculated based on the premise that epidurals and cesareans are the predominant determinants of obstetric anesthesia...
- 14
- 610
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
- 12
- 454
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... performed as by Li et al [11] Five micrograms of reporter plasmid DNA containing the CAT gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities...
- 8
- 426
- 0
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... 68 66 Source: [52] a Canadian figures for 2000 from Statistics Canada (Statistics Canada, 2002) The data and analysis related to the availability and quality of childcare for Canadian women and ... that reverse reforms associated with the welfare state International trade agreements are one way to weaken both national identities and nationally based labour unions Trade is now international, ... disabilities—is relatively low as compared to all nations except the US The low US rate may reflect the lack of available Table Reports of being a victim of crime as percentage of total population...
- 17
- 843
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration of the signal For example, the MEK partner directs the ERK cascade ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...
- 11
- 419
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... in a red alga, C merolae Based on this they pointed out that the evolutionary history of the water oxidation domain in the red algae may be more complex as biochemical data suggests that the ... shown) The behavior of this band in the diatom is thus similar to that of the PsbPlike protein in cyanobacteria [3,12] The fact that C gracilis, P gyrans, L japonica and U pinnatifida contained bands...
- 11
- 501
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... Actually, a minor modification of the above proof shows that the assumptions of Theorem 1.1 could be weakened: the relations Rn need not be transitive if we assume the uniqueness of a point x ... equivalent Jacek Jachymski 33 (i) There exists a sequence (Rn )∞ of equivalence relations in X such that the assumpn= tions of ET are satisfied (ii) There exists a non-Archimedean bounded and complete...
- 6
- 268
- 0
The phrase Phrase as a group of words, which makes sence, but not complete sense,
... Ex: The senile old man disease Many case of infectious A story as old as time The Phrase A noun phrase: A noun phrase consits of a noun and all it modifies Ex: The senile old man Many case of ... that “ she” functions in exactly the same way as “ The beautiful girl” and “ arrived” in exactly the way as “ has arrived” Concentrating on the similarity of function, they define a noun phrase ... phrase Adjective pharse Verb phrase Adverb phrase Preposition pharse The Phrase There are five commonly occurring types of phrase in English: A noun phrase: A noun phrase consits of a noun and all...
- 9
- 512
- 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx
... obtained was used as a template for real-time quantitative polymerase chain reaction, which was performed with the LC FastStart DNA Master SYBR GreenI® (Roche Diagnostics, Mannheim, Germany) in a LightCycler® ... 2:116-126 20 Matsuyama T, Yamada A, Kay J, Yamada KM, Akiyama SK, Schlossman SF, Morimoto C: Activation of CD4 cells by fibronectin and anti-CD3 antibody A synergistic effect mediated by the VLA-5 fibronectin ... anti-haIgG or anti-CD3 mAb Note that the proliferative response of TLR-2-/- CTLs with anti-CD3 mAb alone was higher than that of B6 and TLR-4def CTLs, but that it was not altered by the addition of...
- 14
- 505
- 0
báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf
... tomography of the pelvic cavity at the levels of the neoplasm was detected at the L5 spine level, and palliative radiation therapy in that area was suggested Despite aggressive surgical treatment along ... Gross pathological examination revealed a large mass on the left lateral wall that measured 7.0 cm across its greatest dimension The surface of the tumor on the mucosal side was smooth The mass ... manifest as macroscopic hematuria or irritative urinary symptoms [5] As in our patient’s case, some authors have found an association between malignant fibrous histiocytoma and radiation therapy...
- 6
- 493
- 0
báo cáo khoa học: " Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity" docx
... 5’-CAgTggACTCgTACTTgTTCTTgT-3’ Genomic DNA UBC9GENOM-F 5’-gTTTTggAAATgTTgACAggAC-3’ ATHB1F 5’ gCggAATTCATggAATCCAATTCgTTTTTC 3’ EcoRI ATHB1 and ATHB1WCT cloning ATHB1R 5’ gCgggATCCTAAggCCATCCCCAgAAAg ... gCgggATCCTAAggCCATCCCCAgAAAg 3’ BamH1 ATHB1 cloning ATHB1WCTR 5’ gCggTCgACTACTCTTgTTTgCCCTgAAgC 3’ Sal1 ATHB1WCT cloning ATHB1CTF 5’ gCggAATTCCAAgAgACAgCTAATgAACCA 3’ EcoRI ATHB1 CTR cloning Genomic DNA Sequence of ... 5’-ggggAgCTCTCAATTgAATTgTggTTgTTCC-3’ SacI H4-H1 cloning H1*H4F 5’-gTTggAggTgTAAAAAATAgggAgCCAgC-3’ H1*H4R 5’-TATTTTTTTAgCACCTCCAACTgATTgAgTAgg-3’ H4-WCT-R 5’-CCCgAgTCTCTATTCTTCACCgCTgCCAC-3’ SacI H4WCT...
- 19
- 355
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25