Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene Peter Barath 1,2 , Daniela Poliakova 1,2 , Katarina Luciakova 1,2 and B. Dean Nelson 1 1 Department of Biochemistry and Biophysics, Arrhenius Laboratories, Stockholm University, Sweden; 2 Cancer Research Institute, Slovak Academy of Sciences, Bratislava, Slovak Republic The human adenine nucleotide translocase-2 (ANT2) pro- moter contains a silencer region that confers partial repres- sion on the heterologous herpes simplex virus thymidine kinase (HSVtk) promoter [Barath, P., Albert-Fournier, B., Luciakova, K., Nelson, B.D. (1999) J. Biol. Chem. 274, 3378–3384]. Two sequences in the silencer (Site-2 and Site-3) are protected in the DNase I assay in vitro, and one of these is a repeated GTCCTG element previously shown to act as the active repressor element. We have now purified the DNA binding protein, and identified it using MALDI-TOF MS as a 33-kDa member of the nuclear factor 1 (NF1) family of transcription factors. NF1 purified from rat liver and HeLa cell nuclei bind to both silencer Site-2 and Site-3, resulting in a DNase I footprint identical to that obtained with purified recombinant NF1. Furthermore, transient transfection experiments with reporter constructs containing mutated silencer Site-2 and/or Site-3 show that both sites contribute to repression of the HSVtk promoter. Finally, chromatin immunoprecipitation analysis reveals that NF1 is bound to both elements on the endogenous HeLa cell ANT2 promoter. Our data support the belief that NF1 acts as a repressor when bound to silencing Site-2 and Site-3 of the ANT2 gene. Keywords: adenine nucleotide translocase; NF1; promoter regulation; silencer protein; transcription. Two major isoforms of the adenine nucleotide translocase (ANT) are expressed in mammalian cells. Both catalyse the exchange of mitochondrial ATP for cytosolic ADP, thereby playing key roles in maintaining the cytosolic phosphory- lation potential, adenylate charge, and the energy status of the cell. The two forms, ANT1 and ANT2 [1–4], are differentially expressed in mammalian tissue. ANT1 is expressed predominately in heart and skeletal muscle [5,6] whereas ANT2 is more widely expressed [5,7,8]. ANT2 is strongly growth regulated [9,10], and expression of the gene is downregulated in growth arrested cells [10] and re-activated in cells entering the G 1 growth phase. Activa- tion of ANT2 expression is mediated at the level of transcription [10]. To understand ANT2 expression, we have undertaken a study of its promoter. Constitutive ANT2 expression is maintained by two synergistically interacting Sp1 elements (the AB boxes) in the proximal promoter [11]. However, activation via the AB box Sp1 is modulated by three separate repressor regions. One of these is an Sp1 binding element (C box) juxtaposed to the transcriptional start site, which, when occupied, decreases ANT2 expression several- fold [11]. Repression appears to involve a direct interaction between Sp1 bound to the AB and C boxes [12]. A second repressor region, that is responsible for ANT2 down regulation in growth-arrested cells, has recently been identified in the distal promoter [10]. This region contains two DNA elements, Go-1 and Go-2, that bind nuclear factor 1 (NF1) in growth-arrested cells, but not in growth- activated cells [13]. NF1 binding is associated with growth arrest repression of ANT2 transcription. A third repressor (silencer) region, which does not participate in growth arrest repression of the gene [13], but confers repression on a heterologous herpes simplex virus thymidine kinase (HSVtk) reporter gene, has also been located in the ANT2 promoter between the AB activation boxes and the Go repressor region [14]. Two DNA sequences in the silencer region (Site-2 and Site-3) are strongly protected in the DNase I assay. One of these (Site-2) is a repeated element (GTCCTG) shown to have a role in repressing the HSVtk promoter [14]. In the present study, we have purified the silencer element binding protein, and identified it as a member of the NF1 family of proteins (see [15] for review). NF1 binds to Site-2 and Site-3 both in vitro and in vivo, and repression of the heterologous HSVtk promoter is relieved by mutating either element. Thus, NF1 plays a major role in regulating ANT2 expression by modulating (repressing) the efficiency with which Sp1 functions as a constitutive activator. Correspondence to K. Luciakova, Cancer Research Institute, Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava, Slovak Republic. Fax: + 421 259327250, Tel.: + 421 259327110, E-mail: Katarina.Luciakova@savba.sk Abbreviations: ANT, adenine nucleotide translocase; NF1, nuclear factor 1; CAT, chloramphenicol acetyl transferase; HSVtk, herpes simplex virus thymidine kinase; wt, wild-type; mut, mutant; Site-2 and Site-3, NF1 binding elements 2 and 3 in the silencer region; Go-1 and Go-2, Go NF1-binding repressor elements 1 and 2. Note: P. Barath and D. Poliakova contributed equally to this work. (Received 5 December 2003, revised 5 March 2004, accepted 15 March 2004) Eur. J. Biochem. 271, 1781–1788 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04090.x Materials and methods Plasmid preparation ANT2 promoter fragments ()374/)235) bearing the wild- type (wt) or mutated Site-3 ()374/)347) elements were prepared by PCR using the wt or mutated Site-3 element (5¢-GGGTTCTTTT TAAATCCCTGTAGC-3¢, underlined nucleotides represent mutation of the wt, GGC, sequence) as the 5¢ primer. The M13 reverse primer from HSVtk- chloramphenicol acetyltranferase (CAT) [16] was used as the 3¢ primer. Template DNAs [HSVtk-CAT-ANT2 ()413/ )235)] carrying the wt or the mutated Site-2 element were described previously [14]. PCR was performed with Vent DNA polymerase (BioLabs) according to the manufacturer. Amplified DNA containing the wt and/or mutated Site-2 and Site-3 were digested with BglII and ligated into HSVtk- CAT plasmid. All clones were checked for fragment size and orientation by digestion with restriction enzymes, and mutations were verified by sequencing. A DNase I footprint probe containing Site-2, 3 and Go-2 elements was made by adding XbaI sites to both ends of ANT2 )825/)795 [13]. This oligonucleotide, which includes Go-2, was ligated into the XbaI site of the pCAT-ANT2 ()546/)235)wt [14]. The clones were checked by restriction enzyme digestion and sequencing. Cell culture and transfection Growth and transfection of HeLa cells experiments were performed as by Li et al. [11]. Five micrograms of reporter plasmid DNA containing the CAT gene and 2 lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection. CAT and luciferase activities were measured as described [17]. DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19]. The DNase I protection assay was performed as described [17]. Radioactive probes were prepared by PCR using 5¢ [ 32 P]-labelled CAT primer, the M13 primer and pCAT-ANT2-()546/)235)wt [14] or pCAT-Go-2-ANT2()546/)235)wt [13] as the template. Electrophoretic mobility shift (EMSA) and supershift assay EMSA analyses were performed as by Li et al.[11]. For supershift experiments, 2 lL of antibody raised against human NF1-C (rabbit polyclonal antiserum, 8199, kindly provided by N. Tanese, New York University Medical Center, NY, USA) were added to the binding reaction and incubated on ice for a further 15 min. Complexes were separated on 4% nondenaturing polyacrylamide gel. The gels were dried and autoradiographed. Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt, 5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut, 5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢. Chromatin immunoprecipitation Chromatin immunoprecipitation of NF1 from exponenti- ally growing HeLa cells was performed as described previously [13]. Immunoprecipitation was performed with either 2 lL of antiserum 8199 prepared against a central domain of the NF1 C protein (kindly provided by N. Tanese) or 2 lL of antirat liver b-F 1 ATPase (unrelated protein). Amplification of immunoprecipitated DNA frag- ments (2 lL) was performed using the primer set: )525 (5¢-TGACCTTGTCTCGTTGCCTCACCC-3¢)and)378 (5¢-GCTACAGGGATGCCAAAAGAACCC-3¢)forthe Site-3, and primer set )346 (5¢-GCGTCTCACCCTAGT CCTGGTCCTGC-3¢)and)214 (5¢-GGAAGGGGCGGG TCCAGAGAACA-3¢) for the Site-2 element. PCR was performed for 32 cycles with 30 s of denaturation at 94 °C, followed by 30 s of annealing at 60 °C and 30 s of extension at 72 °C. The last step included extension for 10 min at 72 °C. NF1 purification from nuclear extracts Rat liver nuclei were purified as described by Kadonaga [20]. Nuclei from HeLa cells were prepared according to Dignam et al. [18]. Proteins were extracted from nuclei by addition of an equal volume of extraction buffer (20 m M Hepes pH 7.9, 820 m M NaCl, 5 m M MgCl 2 ,1m M EDTA, 1m M EGTA, 0.5 m M phenylmethanesulfonyl fluoride, 1m M benzamidin, 0.5 m M dithiothreitol). The various fractionation steps are described by Luciakova et al. [13]. Site-2 and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay. The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide contain- ing either the Site-2 and Site-3 elements (nucleotides )404/ )240) or the Go-2 element (nucleotides )825/)792, [13]). The columns were prepared according to Kadonaga [20]. Proteins were eluted in two salt steps (200 m M and 500 m M NaCl) in 20 m M Hepes pH 7.9, 5 m M MgCl 2 ,5m M 2-mercaptoethanol, 5% glycerol, 0.1% Nonidet P-40. Protein fractions were stored at )70 °C. Size exclusion chromatography was carried out on samples fractions from the Heparin Sepharose XK 16/20 column that contained Site-2/Site-3 DNase I footprinting activity (see above). A Superdex 200 HR 10/30 column (Amersham Biosciences) equilibrated in elution buffer (20 m M Hepes pH 7.9, 420 m M NaCl, 5 m M MgCl 2 )was loaded with 0.25 mL of sample. The column was eluted at 0.1 mLÆmin )1 . Fractions of 0.5 mL were collected after the void volume of the column. SDS/PAGE and protein identification by MALDI-TOF MS Samples from the DNA affinity column were precipitated for 20 min on ice in 10% trichloroacetic acid, followed by a 15 min centrifugation at 10 000 g and two washes with ice- cold acetone. Samples were air dried, dissolved in sample buffer, and separated in 10% SDS/PAGE. Proteins were visualized by silver staining and bands of interest were cut 1782 P. Barath et al. (Eur. J. Biochem. 271) Ó FEBS 2004 out. In-gel tryptic digestion and sample preparation was carried out as described by Luciakova et al.[13].MALDI- TOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems). Internal calibration was performed with autodigested trypsin. Data were analysed using MOVERZ software (Proteometrics, LLC, Winnipeg, Canada), and database searches were done with MASCOT (http:// www.matrixscience.com). Results Purification and identification of the silencer binding proteins The promoter of the human ANT2 gene contains three repressor regions (see Fig. 1A for a summary). The silencer region between nucleotides )412 and )235, has been characterized and shown by DNase I protection to include three protein binding sites [14], two of which (Sites-2 and -3, Fig. 1A and B) are consistently and strongly protected in vitro. To identify the Site-2 and Site-3 binding proteins, they were purified from rat liver nuclei using the )404/)240 ANT2 fragment (termed Site-2/Site-3 oligonucleotide) as a DNA affinity probe. Purification was monitored using the DNase I assay. As seen in Fig. 2, proteins that protect Sites 2 and 3 from DNase I coelute from both the Resource Q (Fig. 2A) and the DNA affinity (Fig. 2B) columns. DNA affinity is the last step in the purification scheme. Foot- printing activity is eluted from the DNA affinity column only in fractions 1 and 2 of the low salt (200 m M NaCl) wash (Fig. 2B). SDS/PAGE analysis revealed the presence of several polypeptides in fractions 1 and 2 (Fig. 2C). How- ever, only one, with an apparent mass of around 33 kDa, is found specifically in the active fractions (Fig. 2B). All other polypeptides in low salt fractions 1 and 2 are also present in inactive fractions eluted with 500 m M salt. The 33-kDa polypeptide (marked with a dot in Fig. 2C) was identified as a member of the NF1 family of transcrip- tion factors [15] by trypsin fragment mass analysis using MALDI-TOF MS. Out of 13 peptide masses, nine (69%) were matched to different isoforms of NF1 from different species covering up to 58% of the total protein sequence. The matched peptides originate from a conserved, 240-residue N-terminal DNA binding domain [21] (Fig. 2D), thus excluding the possibility of determining the specific isoform of NF1 (for review see [15]) involved. No other transcription factors were detected in the purified preparations. Identification of a 33 kDa NF1 polypeptide is consistent with our earlier studies in which a 33–38 kDa silencer- binding protein was suggested based on crosslinking and South-western analysis with HeLa cell nuclear extracts [14]. However, gel filtration of the rat liver Heparin Sepharose fraction shows that Site-2/Site-3 binding activity (33 kDa NF1) is present only in fractions 12 and 13 (Fig. 3A) which contain polypeptides of a greater mass. These data suggest that the Site-2/Site-3 binding protein exists as a complex, most likely as a dimer. Proteins that bind the Site-2/Site-3 elements and the upstream growth arrest (Go) elements copurify. NF1 also binds two upstream growth arrest elements (Go-1 and Go-2) in the ANT2 promoter [13]. To determine if the Site-2/Site-3 and Go-element binding activities are identical, we constructed a DNAse I protection probe that included both the Go-2 and the Site-2/Site-3 elements (see Methods). As seen in Fig. 3A, Site-2/Site-3 and Go-2 binding proteins comigrate during gel filtration, suggesting that the same or similar proteins bind to both sets of elements. As a further test, Go element binding-proteins were purified from rat liver nuclei by DNA affinity chromatography, and tested in the DNase I protection assay (Fig. 3B). Identical footprints were obtained on the Site-2/Site-3 elements using proteins purified from the Go- or the Site-2/Site-3 affinity columns. These data support the notion that NF1 footprints both the Go and Site-2/Site-3 elements. However, the affinity of NF1 for the Site-2/Site-3 elements is lower than for the Go element, as indicated by elution from the Site-2/Site-3 affinity column in low (200 m M ) salt, whereas elution of footprinting activity from the Go affinity column requires 500 m M NaCl (Fig. 3B). Purified recombinant NF1 binds to the Site-2/Site-3 elements. To obtain further proof that NF1 is the Site-2/ Site-3 binding protein, DNase I protection analysis was carried out using purified recombinant human NF1. As anticipated, recombinant NF1 protected both Site-2 and Site-3 (Fig. 4A). Furthermore, the pattern of protected and Fig. 1. Summary of the human ANT2 promoter region. (A) Repressor elements in the Sp1 C box, the silencer region (Site-2/Site-3), and Go regions of the human ANT2 promoter are shown in grey. The two Sp1 AB box activation elements are shown as open symbols. (B) DNA sequence of the silencer region (nucleotides )413/)235) of the human ANT2 gene. Data are from Barath et al. [14]. Lines above the sequences mark the Site-1, Site-2, and Site-3 regions footprinted in the in vitro DNase I protection assay. The arrows in Site-2 indicate a repeated hexanucleotide (GTCCTG) element identified as an active repressor element [14]. The arrow in the Site-3 indicates a NF1 protein- binding half site described in the present study. The mutations intro- duced into the Site-2 and Site-3 elements are indicated above the sequence. Ó FEBS 2004 NF1 is the silencer protein of ANT2 (Eur. J. Biochem. 271) 1783 hypersensitive sites produced by recombinant NF1 are similar, if not identical, to those observed with rat liver nuclear extracts (Figs 2 and 3A), affinity purified NF1 from rat liver (Figs 2B and 3B and [13]) and HeLa nuclear extracts [14]. NF1 did not footprint Site 1 [14] of the silencer region, which is also present in the probe used in Fig. 4A. Fig. 2. Purification and identification of the silencer Site-2 and Site-3 binding-protein. Rat liver nuclear extracts were purified as described. (A) Fractions eluted from Heparin Sepharose in a 100 m M to 300 m M NaCl linear gradient, or (B) fractions eluted from the DNA affinity column in 200 or 500 m M NaCl were monitored for DNase I protection activity using the ANT2–546/)235 silencer region as a probe. Activity was also determined in samples loaded onto the affinity column (S) and in flow through (F) fractions. Location of Site-2 and Site-3 elements are indicated on the right. Asterisks mark hypersensitive sites, open circles mark protected nucleotides. (C) SDS/PAGE analysis of polypeptide eluted from the DNA affinity column. The dot beside lane 1 indicates the polypeptide band identified as NF1 by MALDI-TOF MS. (D) Peptide mass alignment. Sequences in bold match the trypsin fragment masses from the SDS band in (C). 1784 P. Barath et al. (Eur. J. Biochem. 271) Ó FEBS 2004 A direct DNase I protection analysis comparing HeLa cell nuclear extract, DNA-affinity purified proteins from HeLa cells and purified recombinant human NF1 show the same pattern of protected nucleotides (Fig. 4B), thus confirming that NF1 binds to the silencer elements. EMSA also showed that oligonucleotides bearing Site-2 and Site-3 elements inhibit binding of HeLa nuclear extract proteins to a bipartite consensus NF1 element (Fig. 4C), but less efficiently than the consensus NF1 element itself. Purified recombinant NF1 exhibit the same specific binding as the HeLa nuclear extract proteins. Supershift experiments confirm the identity of NF1 as the factor bound to Site-2/ Site-3 (Fig. 4C). In vivo occupation of Site-2 and Site-3 as revealed by chromatin immunoprecipitation (ChIP) analysis To determine if Site-2 and Site-3 are occupied in vivo,ChIP analysis was carried out on HeLa cells (Fig. 5). Both elements are occupied by NF1 in vivo (Fig. 5) as detected by EtBr staining of amplified products. Together, the above experiments demonstrate clearly that NF1 is the Site-2 and Site-3 binding protein. Site-2 and Site-3 both contribute to repression of the ANT promoter. Deleting the Site-2/Site-3 silencer elements eliminates repression of the HSVtk promoter in transfected HeLa cells [14]. To study the roles of Site-2 and Site-3 individually, they were mutated and placed in front of the HSVtk promoter. These constructs were transfected into HeLa cells. Fig. 6 shows that promoter activity is increased approximately threefold when both sites are mutated, but appear to be only partially activated when the elements are mutated individually. Thus, it seems likely both elements participate in repression. Discussion We earlier reported the presence of a silencer region in the human ANT2 promoter that conferred repression on the heterologous HSVtk promoter [14]. Three protein-binding sites were found by in vitro DNase I footprinting, one of which contained a GTCCTG repeat required for repres- sion. A 33–38 kDa DNA binding protein was purified using the GTCCTG element (silencer Site-2) as an affinity probe. In the present study, we identify the GTCCTG binding protein as a member of the NF1 family of transcription factors. We also show that NF1 binds to a second silencer element (Site-3, Fig. 1) upstream of the GTCCTG repeat, and that both elements contribute to repression of the HSVtk promoter. Furthermore, NF1 occupies both silencer elements in HeLa cells in vivo, implicating NF1 as a possible repressor even under endogenous conditions. The NF1 polypeptide identified in the present experi- ments exhibits a mass of 33 kDa, which is slightly less than that reported in our previous study [14], but fits well with the mass of the protein that cross-linked to the GTCCTG element [14]. We also reported the copurifica- tion of p33 together with a 49-kDa polypeptide [14]. p49 appeared not to bind DNA, but was loosely associated with p33, perhaps enhancing p33 binding [14]. Using the present purification scheme for the Site-2/Site-3 binding proteins, which is substantially modified from that used in [14], p49 does not appear as a major polypeptide in the purified fractions. This result is consistent with the loose association to p33 observed earlier. However, partially purified Site-2/Site-3 binding activity (NF1) moves on a gel filtration column with an apparent molecular mass greater than 33 kDa, suggesting that it exists as a complex, and most likely as a dimer. Fig. 3. The Site-2 and Site-3 silencer elements and the Go-2 repressor binding proteins cofractionate. (A) Rat liver nuclear extracts were fractionated on a Heparin Sepharose column. Eluted fractions (1–19) were monitored by the DNase I assay using a probe engineered to include both the Site-2 and Site-3 silencer elements and the Go-2 repressor element. Asterisks and open circles mark hypersensitive and protection nucleo- tides, respectively. (B) Rat liver nuclear proteins were purified from a DNA affinity column containing the Go-2 element as a binding matrix [13] (Materials and methods). Site-2, Site-3, and Go-2 elements are indicated on the right. Asterisks denote hypersensitive and open circles protected nucleotides. Ó FEBS 2004 NF1 is the silencer protein of ANT2 (Eur. J. Biochem. 271) 1785 Repression of the HSVtk promoter via the silencer region is partially relieved by mutating Site-2 or Site-3, suggesting that NF1 bound to these elements cooperate in some manner. NF1 binding to Site-2 and Site-3 is not co- operative, because Site-3 remains protected in the DNase I assay when Site-2 is mutated [14]. Thus, repression most probably requires a concerted action between NF1s bound to the two sites, or with a third component. The possibility of an additional component is consistent with our observa- tions concerning p49 (see above). However, this issue remains to be resolved. In any event, the results of ChIP analysis demonstrating the in vivo occupation of Site-2 and Site-3 by NF1 strongly suggest that these interactions are of physiological relevance. Fig. 4. Identification of the Site-2 and Site-3 binding protein as a member of the NF1 family of transcription factors. (A) Binding of purified, recombinant NF1 to the Site-2 and Site-3 elements was monitored by the DNase I protection assay of ANT2 oligonucleotide ()546/)235). Only the coding strand is shown. Competitor oligonucleotides contained either a wt or mutated (mut) Site-2, Site-3 or NF1 element. Asterisks denote hypersensitive nucleotides, open circles denote protected nucleotides. (B) Proteins from HeLa cells and purified recombinant NF1 protect the same nucleotides in the ANT2 silencer region. Asterisks denote hypersensitive nucleotides and open circles denote protected nucleotides in the Site-2/Site-3 region. (C) EMSA and supershift analysis was performed with 10 lg of HeLa nuclear extract or with purified recombinant NF1 (as indicated) and the 32 P-labelled oligonucleotide probe containing a NF1 bipartite consensus binding sequence (probe NF1 wt, Santa Cruz Biotechnology). Wild-type (wt) or mutated (mut) competitor oligonucleotides were added. The NF1 element was added in 50-fold excess, and oligonucleotides containing the Site-2 ()339/ )310) or Site-3 element ()374/)347) were added in 100-fold excess. Samples in lanes marked with Ab NF1 were incubated with antibody 8199 (Materials and methods). Preimmune serum was used as a control for supershift experiments. The major shifted complexismarkedbyanarrow.Freeprobeis seen near the bottom of the gel. 1786 P. Barath et al. (Eur. J. Biochem. 271) Ó FEBS 2004 The NF1 family of proteins plays a wide role in replication of several viral DNAs and in transcription of many cellular genes. A significant role for NF1 proteins in regulating the growth state, hormonal induction and repression and oncogenic processes has been also described (see [15] for review). The NF1 family is composed of four genes, NF1-A, -B, -C and -X (see [15] for review), and a large number of splice variants of each gene [22–24]. Most expressed isoforms contain a highly conserved 240-residue, N-terminal DNA binding domain. Because our identifica- tion of NF1 by MALDI-TOF MS is based primarily on peptide mass matches within the conserved DNA binding domain, we cannot distinguish between the various isoforms. Furthermore, NF1 exist in the cell as homodimers or heterodimers [25], and the large number of possible dimers that can be formed complicate identification of the active species on any particular promoter. Several isoforms of NF1 can act as transcription repres- sors [26–30], and in some cases repressor domains have been located within the protein [30,31]. Furthermore, repression/ activation by individual NF1 isoforms can also depend on cell context [13,30–32], suggesting that the molecular action of NF1 depends on cell-specific factors. Indeed, a variety of factors is reported to interact directly with NF1; including coactivators p300/CBP and SRC-1 [33], histone H3 [34] and the general transcription factor Sp1 [35], TFIIB [36], and TAFII155 [37]. Thus, the molecular mechanisms of NF1 repression on ANT2 remain to be elucidated. The physiological role of the Site-2/Site-3 repressor elements remains to be investigated. Deletion of these elements has no apparent influence on growth-arrest repression of ANT2 exerted via the Go-2/Go-3 growth- arrest elements [13]. Thus, we speculate that NF1 bound to Site-2/Site-3 elements most probably has a role in adjusting the tissue-specific constitutive expression of ANT2, similar to that proposed for the unique Sp1 repressor element (C box) juxtaposed to transcription start [11]. Acknowledgements This study was supported by the Swedish Research Council (to B. D. N.), the Slovak Science and Technology Assistance Agency (APVT) Grant 26-002102 and the Slovak Grant Agency (VEGA) 2/3087/23 (to K. L.). The authors thank O ¨ . Wrange for recombinant human NF1 and N. Tanese for the generous gift of antihuman NF1-C serum. References 1. Neckelmann, N., Li, K., Wade, R.P., Shuster, R. & Wallace, D.C. (1987) cDNA sequence of a human skeletal muscle ADP/ATP translocator: Lack of a leader peptode, divergence from a fibro- blast translocator cDNA, and coevolution with mitochondrial DNA genes. Proc.NatlAcad.Sci.USA84, 7580–7584. 2. Houldsworth, J. & Attardi, G. (1988) Two disctinct genes for ADP/ATP translocase are expressed at the mRNA level in adult human liver. Proc. Natl Acad. Sci. USA 85, 377–381. 3. Cozens, A.L., Runswick, M.J. & Walker, J.E. (1989) DNA sequences of two expressed nuclear genes for human mitochon- drial ADP/ATP translocase. J. Mol. Biol. 206, 261–280. 4. Ku, D H., Kagan, J., Chen, S T., Chang, C D., Baserga, R. & Wurzel, J. (1990) The human fibroblast adenine nucleotide translocator gene. Molecular cloning and sequencing. J. Biol. Chem. 265, 16060–16063. 5. Stepien, G., Torroni, A., Chung, A.B., Hodge, J.A. & Wallace, D.C. (1992) Differential expression of adenine nucleotide trans- locator isoforms in mammalian tissues and during muscle cell differentiation. J. Biol. Chem. 267, 14592–14597. 6. Lunardi, J., Hurko, O., Engel, W.K. & Attardi, G. (1992) The multiple ADP/ATP translocase genes are differentially expressed during human muscle development. J. Biol. Chem. 267, 15267– 15270. 7. Do ¨ rner, A., Pauschinger, M., Badorff, A., Noutsias, M., Giessen, S., Schulze, K., Bilger, J., Rauch, U. & Schultheiss, H P. (1997) Tissue-specific transcription pattern of the adenine nucleotide translocase isoforms in humans. FEBS Lett. 414, 258–262. 8. Du ¨ mmler, K., Mu ¨ ller, S. & Seitz, H.J. (1996) Regulation of adenine nucleotide translocase and glycerol 3-phosphate Fig. 6. Site-2 and Site-3 elements act in a concerted manner to cause the repression of ANT2 promoter. Transient transfections analysis of the heterologous )374/)235 ANT2 promoter constructs bearing combi- nation of the wt (open boxes) or mutated (crossed boxes) Site-2 ()339/ )310) and Site-3 ()374/)347) elements. Promoter fragments were cloned in front of the HSVtk promoter and transfected into HeLa cells. CAT activity was normalized for transfection efficiency. The values of the activities are set relative to the activity of the clone carrying wt Site-2 and Site-3 elements. The results represent the mean value ± S.E. of five independent experiments in which each experi- mental point was determined in triplicate. Fig. 5. The Site 2 and Site 3 silencer elements are occupied by NF1 in vivo. ChIP was carried out on formaldehyde-crosslinked HeLa cells. Exponentially growing cells were crosslinked with 0.25% formalde- hyde. Chromatin was isolated and specific DNA–protein complexes were immunoprecipitated with no antibody (lanes 2 and 7), or with anti-NF1 8199 (lanes 4 and 9), or with unrelated antibodies (lanes 3 and 8). After reversal of the crosslink, DNA was amplified by PCR using the specific primers: Site-3, primer set )525/)378; Site-2, primer set )346/)214. Total chromatin (lanes 5 and 10), and no DNA (lanes 1 and 6) were used as positive and negative PCR controls. As a marker (lane M), the 100-bp gene ruler (Fermentas) was used. Ó FEBS 2004 NF1 is the silencer protein of ANT2 (Eur. J. Biochem. 271) 1787 dehydrogenase expression by thyroid hormones in different rat tissues. Biochem. J. 317, 913–918. 9. Battini, R., Ferrari, S., Kaczmarek, L., Calabretta, B., Chen, S T. & Baserga, R. (1987) Molecular cloning of a cDNA for a human ADP/ATP carrier which is growth-regulated. J. Biol. Chem. 262, 4355–4359. 10. Barath,P.,Luciakova,K.,Hodny,Z.,Li,R.&Nelson,B.D. (1999) The growth-dependent expression of the adenine nucleo- tide translocase-2 (ANT2) gene is regulated at the level of tran- scription and is a marker of cell proliferation. Exp. Cell Res. 248, 583–588. 11. Li, R., Hodny, Z., Luciakova, K., Barath, P. & Nelson, B.D. (1996) Sp1 activates and inhibits transcription from separate ele- ments in the proximal promoter of the human adenine nucleotide translocase 2 (ANT2) gene. J. Biol. Chem. 271, 18925–18930. 12. Zaid, A., Hodny, Z., Li, R. & Nelson, B.D. (2001) Sp1 acts as a repressor of the human adenine nucleotide translocator-2 (ANT2) gene. Eur. J. Biochem. 268, 5497–5503. 13. Luciakova, K., Barath, P., Poliakova, D., Persson, A. & Nelson, B.D. (2003) Repression of the human ANT2 gene in growth- arrested human diploid cells: The role of nuclear factor 1 (NF1). J. Biol. Chem. 278, 30624–30633. 14. Barath, P., Albert-Fournier, B., Luciakova, K. & Nelson, B.D. (1999) Characterization of a silencer element and purification of a silencer protein that negatively regulates the human adenine nucleotide translocator 2 promoter. J. Biol. Chem. 274, 3378–3384. 15. Gronostajski, R.M. (2000) Roles of the NFI/CTF gene family in transcription and development. Gene 249, 31–45. 16. Luckow,B.&Schu ¨ tz, G. (1987) CAT constructions with multiple unique restriction sites for the functional analysis of eucaryotic promoters and regulatory elements. Nucleic Acids Res. 15, 5490. 17. Promega (1991) Promega Protocols and Applications Guide. 2nd edition. Madison, WI. 18. Dignam, J.D., Lebovitz, R.M. & Roeder, R.G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475– 1489. 19. Blobel, G. & Potter, V.R. (1966) Nuclei from rat liver: isolation method that combines purity with high yield. Science 154, 1662– 1665 issn: 0036–8075. 20. Kadonaga, J.T. (1991) Purification of sequence-specific binding proteins by DNA affinity chromatography. Methods Enzymol. 208, 10–23. 21. Gounari, F., De Francesco, R., Schmitt, J., van der Vliet, P., Cortese, R. & Stunnenberg, H. (1990) Amino-terminal domain of NF1 binds to DNA as a dimer and activates adenovirus DNA replication. EMBO J. 9, 559–566. 22. Santoro, C., Mermod, N., Andrews, P. & Tjian, R. (1988) A family of human CCAAT/box/binding proteins active in tran- scription and DNA replication: cloning and expression of multiple cDNAs. Nature 334, 218–224. 23. Rupp,R.,Kruse,U.,Multhaup,G.,Gobel,U.,Beyreuther,K.& Sippel, A. (1990) Chicken NF1/TGGCA proteins are encoded by at least three independent genes: NFI-A, NFI-B, and NFI-C with homologues in mammalian genomes. Nucleic Acids Res. 18, 2607–2616. 24. Kruse, U. & Sippel, A.E. (1994) The genes for transcription factor nuclear factor I give rise to corresponding splice variants between vertebrate species. J. Mol Biol. 238, 860–865. 25. Kruse, U. & Sippel, A.E. (1994) Transcription factor nuclear factor I proteins form stable homo- and heterodimers. FEBS Lett. 348, 46–50. 26. Adams, A.D., Choate, D.M. & Thompson, M.A. (1995) NF1-L is the DNA-binding component of the protein complex at the peripherin negative regulatory element. J. Biol. Chem. 270, 6975– 6983. 27. Osada, S., Daimon, S., Ikeda, T., Nishihara, T., Yano, K., Yamasaki, M. & Imagawa, M. (1997) Nuclear factor 1 family proteins bind to the silencer element in the rat glutathione trans- ferase P gene. J. Biochem. (Tokyo) 121, 355–363. 28. Szabo, P., Moitra, J., Rencendorj, A., Rakhely, G., Rauch, T. & Kiss, I. (1995) Identification of a nuclear factor-I family protein- binding site in the silencer region of the cartilage matrix protein gene. J. Biol. Chem. 270, 10212–10221. 29. Liu, Y., Bernard, H.U. & Apt, D. (1997) NFI-B3, a novel tran- scriptional repressor of the nuclear factor I family, is generated by alternative RNA processing. J. Biol. Chem. 272, 10739–10745. 30. Gao, B. & Kunos, G. (1998) Cell type-specific transcriptional activation and suppression of the alpha1B adrenergic receptor gene middle promoter by nuclear factor 1. J. Biol. Chem. 273, 31784–31787. 31. Osada, S., Ikeda, T., Xu, M., Nishihara, T. & Imagawa, M. (1997) Identification of the transcriptional repression domain of nuclear factor 1-A. Biochem. Biophys. Res. Commun. 238, 744–747. 32. Apt, D., Liu, Y. & Bernard, H.U. (1994) Cloning and functional analysis of spliced isoforms of human nuclear factor I–X: inter- ference with transcriptional activation by NFI/CTF in a cell-type specific manner. Nucl. Acids Res. 22, 3825–3833. 33. Chaudhry, A.Z., Vitullo, A.D. & Gronostajski, R.M. (1999) NuclearfactorI-mediatedrepressionofthemousemammary tumor virus promoter is abrogated by the coactivators p300/CBP and SRC-1. J. Biol. Chem. 274, 7072–7081. 34. Alevizopoulos, A., Dusserre, Y., Tsai-Pflugfelder, M., von der Weid, T., Wahli, W. & Mermod, N. (1995) A proline-rich TGF- beta-responsive transcriptional activator interacts with histone H3. Genes Dev. 9, 3051–3066. 35. Rafty, L.A., Santiago, F.S. & Khachigian, L.M. (2002) NF1/X represses PDGF A-chain transcription by interacting with Sp1 and antagonizing Sp1 occupancy of the promoter. EMBO J. 21, 334–343. 36. Kim, T.K. & Roeder, R.G. (1994) Proline-rich activator CTF1 targets the TFIIB assembly step during transcriptional activation. Proc.NatlAcad.Sci.USA91, 4170–4174. 37. Tanese, N., Pugh, B.F. & Tjian, R. (1991) Coactivators for a proline-rich activator purified from the mutlisubunit human TFIID complex. Genes Dev. 5, 2212–2224. 1788 P. Barath et al. (Eur. J. Biochem. 271) Ó FEBS 2004 . Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene Peter Barath 1,2 , Daniela Poliakova 1,2 , Katarina Luciakova 1,2 and. dried and autoradiographed. Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt, 5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut, 5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢. Chromatin