0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene Peter Barath1,2, Daniela Poliakova1,2, Katarina Luciakova1,2and B. Dean Nelson11Department ... Site-3 of the ANT2 gene. Keywords: adenine nucleotide translocase; NF1; promoterregulation; silencer protein; transcription.Two major isoforms of the adenine nucleotide translocase(ANT) are expressed ... binding activity in all fractions wasmonitored by the in vitro DNase I protection assay. The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide contain-ing...
  • 8
  • 426
  • 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... ssDNA S (lanes 1 and 2). The structures of DNAs used as probes are indicated above each lane. The DNA protein complexes were resolved by 6% PAGE and visu-alized by autoradiography.K. Takahama ... TT) and KGG3-2 reverse d(GAA CAT TCC ACCGGG ACC ACC AC). pGEX–KGG3-4 was generated byPCR using pGEX–KGG2 as a template and the followingprimers: KGG3-4 forward d(AGA CAA AGG TGG CTTCAA AGG ... stop assayThis assay was adapted from the method described byHan et al. [43]. The 25-mer primer was 5¢-labeled with32P, mixed with the 76-mer template DNA and annealed as described above. The...
  • 11
  • 786
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... 3¢-RACEZf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACEZf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCRZf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACEZf3¢tbet-F2 CTGGATTGAAGCGCCCTCGGTTAATC...
  • 20
  • 689
  • 0
Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

Tài liệu Báo cáo khoa học: Identification of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin sense) [19]Kan FP CTC ATC GAG CAT CAA ATG (kanamycin ... Branhamella catarrhalis: an organismgaining respect as a pathogen. Clin Microbiol Rev 3,293–320.2 Karalus R & Campagnari A (2000) Moraxella catarrh-alis: a review of an important human ... measured at varioustime points postchallenge. The minimum detectable number of viable bacteria was 100 CFU per lung. Clearance of M. catarrhalis was expressed as the percentage of bacterialCFU...
  • 14
  • 674
  • 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... P(2000) The transcriptional co-activator P ⁄ CAF potenti-ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28,4291–4298.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, Kato ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al.(2003) Transcriptome analysis of the acoelomate human parasite Schistosoma ... (Canis familiaris), the common chimpanzee (Pantroglodytes) and the Rhesus monkey (Macaca mulatta), as well as the closely related BMP Smad from the tapeworm (E. multilocularis), EmSmadB, attained...
  • 19
  • 653
  • 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... reticulum area around the nucleus and is maxi-mal in the cytoplasmic apex of the branchial epidermis.By contrast, the staining is very weak basally along the myoepithelium that lines the internal ... elegans, the fruitflies D. melanogaster and D. pseudoobscura, the mos-quitoes A. aegypti and A. gambiae, the clam T. gigas andlarval sequences from the cnidarian F. scutaria. Finally, wechose an ... sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas,D. melanogaster-2 and D. melanogaster-3 sequences(data not shown). By contrast, R. pachyptila aminoacid sequences do not have any...
  • 14
  • 591
  • 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK GGAAATGGAAATAACAAGACAAATAGCGCGCAACTAATGCTTCCACAAHSP70 TGACCAAGGCAACAGAACCAAATCAGACGGCCGGTATGTGHeat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAACTCATCCTCCACCGGATTGTHSP23 ... kinasecomplex-associated protein AAAGCAGAGCAGAAAAAGTGGAAGGACAATGCCGCGATCAGNon-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACAGGGATGGAGGGTAAGACCATACAGlutamine synthetase ACGGAGGTTGACGGGACTTGCTGGCACCACGATTGGDelta-9-desaturase ... GATACAGCAAACGGAAAGTCAACACAGTTCCTCGGGCCAACACystatin B GCCCCCCTCCCACACACATCTTCGGCCGTCTTTCCCTSL GTTCTTGTTCCTGCTCATCAGTATGTGGATCGCCAAAAACTCATGQM protein AATGCTGGCTCTCCCTCGATGCTTGGCTACTGGACCATCAAHYPK...
  • 11
  • 570
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T ... byinvertebrates, and has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals ... structural and biochemicalbases of the biomineralization framework and mineral-associated protein have not been elucidated.On the other hand, vertebrates possess collagens as a main component of the...
  • 12
  • 568
  • 0
Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

Tài liệu Báo cáo khoa học: Identification of b-amyrin and sophoradiol 24-hydroxylase by expressed sequence tag mining and functional expression assay docx

... for soyasapogenol A is not as simple as that for soyasapogenol B, and the presence of additional hydroxylases must beconsidered. Fortunately, the aglycone of the majorsoyasaponins is soyasapogenol ... cerevisiaestrain GIL77Two oligo DNAs (5¢-CTTCGTCGACAAGATGTGGAGGTTGAAGATA-3¢ and 5¢-GTCCGCTAGCTCAAGGCAAAGGAACTCTTCT-3¢), corresponding to the N- andC-terminal sequences of b-amyrin synthase from ... struc-tures of soyasapogenol A, soyasapogenol B, andsoyasapogenol E, oleanene sapogenols from soybean,structures of soyasaponin I, soyasaponin II, and soyasa-ponin III. Chem Pharm Bull 30,...
  • 12
  • 704
  • 0
Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

Tài liệu Báo cáo khoa học: Identification of GAS-dependent interferon-sensitive target genes whose transcription is STAT2-dependent but ISGF3-independent doc

... responses [3,4].Arguably the most notable of these cascades is the Janus kinase (Jak)-signal transducer and activator of transcription (STAT) pathway that regulates the transcription of numerous ... La Jolla, CA,USA) and the Online Predicted Human Interaction Data-base (OPHID; http://ophid.utoronto.ca). OPHID is a web-based database of about 40 000 predicted and known human protein protein ... IFN-inducible transcriptional activation in the absence of the STAT2 DNA binding domain as determined by Affymetrix DNA microarrayanalysis. Total mRNA samples from U 6A- 2, U 6A- 2VV-II and U 6A cells either...
  • 13
  • 459
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM