grape cell cultures a potential source of raw material for pharmaceutical food and cosmetic industries
Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx
... months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year 18 First year post- drought data on range and mean of growth characters in the hot-spot region Characters ... Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, Vila Bella Provenance-wise conservation- India Introduced ... the availability of sufficient genetic variability 1981-IRRDB germplasm collection – a valuable reservoir of genes for various abiotic stresses Acre : Brasileia, Feijo, Sena Madureira, Tarauaca,...
- 23
- 573
- 0
báo cáo khoa học: " Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity" docx
... 5’-ggggAgCTCTCAATTgAATTgTggTTgTTCC-3’ SacI H4-H1 cloning H1*H4F 5’-gTTggAggTgTAAAAAATAgggAgCCAgC-3’ H1*H4R 5’-TATTTTTTTAgCACCTCCAACTgATTgAgTAgg-3’ H4-WCT-R 5’-CCCgAgTCTCTATTCTTCACCgCTgCCAC-3’ SacI ... performed with μg RNA and 200 units of M-MLV (Promega) PCR on cDNA was performed using oligonucleotides ATHB1F and ATHB1R for ATHB1, ATHB1F and ATHB1WCTR for ATHB1WCT, and ATH1CTF and ATHB1R for ... 5’-CAgTggACTCgTACTTgTTCTTgT-3’ Genomic DNA UBC9GENOM-F 5’-gTTTTggAAATgTTgACAggAC-3’ ATHB1F 5’ gCggAATTCATggAATCCAATTCgTTTTTC 3’ EcoRI ATHB1 and ATHB1WCT cloning ATHB1R 5’ gCgggATCCTAAggCCATCCCCAgAAAg...
- 19
- 355
- 0
báo cáo sinh học:" A systematic review of task- shifting for HIV treatment and care in Africa" potx
... Szumilin E, Kamoto K, Harries A: Nurses and medical assistants taking charge: task-shifting HIV care and HAART initiation in resource-constrained and rural Malawi Oral Abstract Session: AIDS 2008 ... randomized trial in Uganda [59] comparing home-based and facility-based care also found similar rates of viral load suppression, failure and mortality A community-based program offering home-based ART ... total average annual clinic-level cost per ART patient in Uganda and South Africa found that mean costs were almost a third less in the former ($US331 vs Page of Table 1: Characteristics and...
- 9
- 532
- 0
báo cáo khoa học: " Enhanced relapse prevention for bipolar disorder: a qualitative investigation of value perceived for service users and care coordinators" pdf
... Health Behaviour and Health Education: Theory, Research and Practice San Francisco: Wiley and Sons; 2002 May C: A rational model for assessing and evaluating complex interventions in health care ... recruit a representative sample, but rather to access the range of available views Participants were those who were already recruited for a training trial [18] and therefore had agreed to participate ... of anxiety CCs were aware of this being demanding, and one reported that looking at triggers and early warning signs had the potential to induce a relapse Page of 12 (page number not for citation...
- 12
- 382
- 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones
... challenges for small scale and micro-fuel cells in terms of design, materials, effective transport of reactants, and heat management The development of physically representative models that allow ... performance and design of air-breathing PEM fuel cells Litster and Djilali [1] developed a single-phase one-dimensional semi-analytical model of the membrane electrode assembly (MEA) of planar air-breathing ... density and lower cost The analysis offers valuable physical insight towards design of a cell and a cell stack, to be considered in a future study References [1] Litster S and Djilali N Mathematical...
- 18
- 549
- 0
Báo cáo y học: "Apoptotic cell-mediated suppression of streptococcal cell wall-induced arthritis is associated with alteration of macrophage function and local regulatory T-cell increase: a potential cell-based therapy" ppsx
... live animals and were approved by the Animal Care and Use Committee of National Institute of Dental and Craniofacial Research Acute and chronic joint pathology was clinically monitored and the articular ... statistical analyses with SigmaStat 3.11 software (Systat Software, Richmond, CA, USA) We tested data for normality and variance, and considered P < 0.05 significant Statistical analysis was assessed ... National Institute of Dental and Craniofacial Research, National Institutes of Health All animal studies were performed according to National Institutes of Health guidelines for use and care of...
- 8
- 310
- 0
Báo cáo khoa học: A biophysical view of the interplay between mechanical forces and signaling pathways during transendothelial cell migration doc
... also may take a transcellular route through the body of the cell; see Carman and Springer [100] for a recent review of transcellular migration of cells Both transmigration paths are available to ... 660–668 37 Kataoka N, Iwaki K, Hashimoto K, Mochizuki S, Ogasawara Y, Sato M, Tsujioka K & Kajiya F (2002) Measurements of endothelial cell- to -cell and cellto-substrate gaps and micromechanical properties ... reach peak activation, leading to cell respreading, elongation, and alignment in the direction of flow Both Cdc42 and Rac1 are required for cell elongation, whereas Rho and Rac1 regulate cell alignment...
- 14
- 513
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... C13 2A: 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA ... Merck (Darmstadt, Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), ... 2890 E Mattern-Dogru et al (Eur J Biochem 269) CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D21 6A: 5¢-G...
- 8
- 345
- 0
báo cáo hóa học:" Human fallopian tube: a new source of multipotent adult mesenchymal stem cells discarded in surgical procedures" potx
... Célia Koiffmann and Cláudia I E de Castro for karyotype analysis and pictures; Marta Cánovas for technical support; Page of 10 (page number not for citation purposes) Journal of Translational ... Mariz Vainzof for WB analysis and suggestions; Dr Irina Kerkis for antibodies supplying; Marcos Valadares and Maria Denise Fernandes Carvalho for the support with the cultures Mrs Constancia ... characterization of potential sources of adult stem cells [7,10,1215], the aim of this study was to isolate, expand, characterize and assess the differentiation potential of MSCs from hFTs Methods Human...
- 10
- 456
- 0
báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf
... labeled anti-beta2 microglobulin (L368) for sHLA-I and L.2.03 Mab for sHLA-II were added to each bead and incubated for an additional hour at 45°C After additional washes, the color reaction was started ... therapy, with a surrogate marker, may have additional value as particularly effective immunomodulatory activity, such as that observed with natalizumab, may have a potential downside [26] that ... well as at and months after treatment with IFN β- 1a Saliva sHLA-II concentrations pre and post-treatment were compared to the neurological status of the patient as well as to the MRI brain scan...
- 6
- 424
- 0
Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt
... with antipsychotic treatment Aripiprazole is an antipsychotic drug that acts as a partial agonist at dopamine D receptors and serotonin 5hydroxytryptamine (5-HT) 1A receptors, and an antagonist at ... (’moderate akathisia’) Fluvoxamine (50 mg, twice a day) was administered Substantial relief of akathisia was noted on day of fluvoxamine treatment The dose of aripiprazole was increased to 24 ... was increased to 12 mg His global score on the Barnes Akathisia Scale was Administration of fluvoxamine (50 mg, twice a day) rapidly improved the akathisia He showed no signs of akathisia after...
- 3
- 403
- 0
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot
... preparation EHG carried out statistical analysis and manuscript preparation TBG carried out patient referral, clinical data analysis and manuscript preparation MHP carried out patient referral, ... referral, data analysis and manuscript preparation All authors read and approved the final manuscript Acknowledgements This work was supported, in part, by NIH grant PO1 AR048929 (to AAG), by a grant ... 2002, 35:1-14 29 Yabuhara A, Yang FC, Nakazawa T, Iwasaki Y, Mori T, Koike K, Kawa H, Komiyama A: A killing defect of natural killer cells as an underlying immunologic abnormality in childhood...
- 8
- 365
- 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf
... increasing the safety and economic feasibility Our study will advance and extend the clinical application of MSC-based cell therapy for cartilage injury Materials and methods Rabbits Skeletally mature ... transplantation of cartilage In vivo analysis in rabbits repair by synovial mesenchymal stem cell transplantation in rabbits (a) Cell transplantation on a cartilage defect in a rabbit by the local adherent ... were analyzed using a grading system consisting of five categories (cell mor- 15 aTotal smooth area of the reparative cartilage compared with the entire area of the cartilage defect bAverage thickness...
- 10
- 470
- 0
Báo cáo y học: "Alkylating HIV-1 Nef - a potential way of HIV intervention" ppsx
... data analysis and revision of the manuscript All authors read and approved the final manuscript Jin et al AIDS Research and Therapy 2010, 7:26 http://www.aidsrestherapy.com/content/7/1/26 Acknowledgements ... interpretation of an anti HIV-1 activity Our finding suggests that TPCK can serve as a prototype of a class of drugs that retains the Cys55 modification activity but has desired pharmacodynamic and ... migration patterns of Nef mutant C142&206 /A (Cys55 modified) and C55&142 /A (Cys206 modified) were the same as that of C206 /A and C55 /A Taken together, the mutagenesis data suggest that Cys55 and...
- 10
- 428
- 0
Báo cáo y học: "Polyurethane sheet: A potential substitute of surgical cotton gauze" pps
... this article as: Shimamoto: Polyurethane sheet: A potential substitute of surgical cotton gauze Journal of Cardiothoracic Surgery 2011 6:26 Submit your next manuscript to BioMed Central and take ... polyurethane sheet This study indicates that the blood absorption power of the polyurethane sheet is equivalent to that of the cotton gauze even after repeated use, and it has the potential to decrease ... the total amount of sponge usage Further, accurately identifying the bleeding point might be easier with the polyurethane sheet Although a future study regarding the safety and feasibility of reuse...
- 2
- 237
- 0
Báo cáo y học: "Celiac disease as a potential cause of idiopathic portal hypertension: a case report" pdf
... patient had gained kg; and his hemoglobin, platelet count and white blood cell count were increased (Table 1) On physical examination there was mild peripheral edema, and only a small amount of ... interpretation of data and drafted the manuscript RS revised the paper AZ participated in the conception of the study and its design MM revised the manuscript and gave final approval of the version ... Sama SK, Bhargava S, Nath NG, Talwar JR, Nayak NC, Tandon BN, Wig KL: Noncirrhotic portal fibrosis Am J Med 1971, 51:160-169 Ichimura S, Sasaki R, Takemura Y, Iwata H, Obata H, Okuda H, Imai F: The...
- 4
- 270
- 0
báo cáo khoa học: " Exploring transcriptional signalling mediated by OsWRKY13, a potential regulator of multiple physiological processes in rice" pdf
... sequence TTGAC TTGAC(C/T) TTGACC TTGACT TTTGAC(C/T) TTGACA CACGTG TGACG ACCGACA (A/ G)CCGAC GCCGCC CC (A/ T)6CG CATGTG (A/ C)TCC (A/ T)ACC TAAC(G/C)GTT TAACTAAC A( A/C)C (A/ T )A( A/C)C GGATGTA CCAAT Observed ... bacterial blight caused by Xanthomonas oryzae pv oryzae (Xoo) and fungal blast caused by Magnaporthe grisea through activation of salicylic acid (SA)-dependent pathways and suppression of jasmonic acid ... biochemical and molecular analysis supports SW contributed to data interpretation and to writing the manuscript All authors read and approved the final manuscript Additional material Additional file...
- 12
- 182
- 0
Báo cáo khoa học:" Effective suppression of Dengue fever virus in mosquito cell cultures using retroviral transduction of hammerhead ribozymes targeting the viral genome" docx
... primer: 5' ATCGTCTAGAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAATTTTTTACTAGTCGTA 3', which also acted as a PCR template, and a reverse primer: 5' TACGACTAGTAAAAAATTTTTTTTTTTTT ... CCGGTTCGAACCCGGGCACTACAAAAACCAACAAg acacaCTGATGAGGCCGAAAGGCCGAAAcagtgaAC AATTGTTTTTTTGAATTCATC CCGGTTCGAACCCGGGCACTACAAAAACCAACAAtt cactgatCTGATGAGGCCGAAAGGCCGAAAcactatA CAATTGTTTTTTTGAATTCATC CCGGTTCGAACCCGGGCACTACAAAAACCAACAAtg ... CCGGTTCGAACCCGGGCACTACAAAAACCAACAAgt tgcacCTGATGAGGCCGAAAGGCCGAAActtttcctA CAATTGTTTTTTTGAATTCATC CCGGTTCGAACCCGGGCACTACAAAAACCAACAAat caggcCTGATGAGGCCGAAAGGCCGAAAcctaaaac ACAATTGTTTTTTTGAATTCATC CCGGTTCGAACCCGGGCACTACAAAAACCAACAAct...
- 17
- 233
- 0
Báo cáo y học: "Are platelets a ‘forgotten’ source of sepsis-induced myocardial depressing factor" pdf
... C, Payen D, Shah AM, Mebazaa A: Levosimendan restores both systolic and diastolic cardiac performance in lipopolysaccharide-treated rabbits: comparison with dobutamine and milrinone Crit Care ... cardiac contractile performance [10] Azevedo and coworkers suggested that platelets might also be the source of these mediators [1] In summary, platelets might be a forgotten source of mediators ... contractility [9] Of interest, we recently showed in an animal model of sepsis that other cardiovascular mediators, such as prostaglandins and endothelin, released by cardiac endothelium, may contribute...
- 2
- 152
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose