Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis Emine Mattern-Dogru 1 , Xueyan Ma 1 , Joachim Hartmann 2 , Heinz Decker 2 and Joachim Sto¨ ckigt 1 1 Lehrstuhl fu ¨ r Pharmazeutische Biologie, Institut fu ¨ r Pharmazie, Johannes Gutenberg-Universita ¨ t Mainz, Germany, 2 Lehrstuhl fu ¨ r Molekulare Biophysik, Johannes Gutenberg-Universita ¨ t Mainz, Germany In the biosynthesis of the antiarrhythmic alkaloid ajmaline, polyneuridine aldehyde esterase (PNAE) catalyses a central reaction by transforming polyneuridine aldehyde into epi- vellosimine, which is the immediate precursor for the syn- thesis of the ajmalane skeleton. The PNAE cDNA was previously heterologously expressed in E. coli. Sequence alignments indicated that PNAE has a 43% identity to a hydroxynitrile lyase from Hevea brasiliensis,whichisa member of the a/b hydrolase superfamily. The catalytic tri- ad, which is typical for this family, is conserved. By site- directed mutagenesis, the members of the catalytic triad were identified. For further detection of the active residues, a model of PNAE was constructed based on the X-ray crys- tallographic structure of hydroxynitrile lyase. The potential active site residues were selected on this model, and were mutated in order to better understand the relationship of PNAE with the a/b hydrolases, and as well its mechanism of action. The results showed that PNAE is a novel member of the a/b hydrolase enzyme superfamily. Keywords: polyneuridine aldehyde esterase; active-site resi- dues; site-directed mutagenesis; modelling; a/b hydrolase enzyme superfamily. Polyneuridine aldehyde esterase (PNAE, EC 3.1.1) is a central enzyme in a 10-step biosynthetic pathway expressed in the medicinal plant Rauvolfia serpentina Benth. ex Kurz. The pathway delivers the antiarrhythmic monoterpenoid indole alkaloid ajmaline [1,2]. From the enzymatic point of view, this is presently one of the most detailed investigated examples of a pathway leading to a natural product. Reactions of this complex biosynthetic sequence are cata- lyzed by membrane-bound and soluble enzymes such as cytochrome P450-dependent hydroxylases, a synthase, sev- eral reductases, a methyltransferase and a set of hydrolases including a b-glucosidase, an acetylesterase and the herein described methylesterase PNAE [3]. These enzymes exhibit a high degree of substrate specificity, PNAE being the most specific. PNAE is located in the middle of the biosynthetic chain starting from tryptamine and secologanin and cata- lyses the conversion of polyneuridine aldehyde into the next stable pathway intermediate, epivellosimine (Fig. 1). The enzyme has been detected in and partially characterized from cell suspension cultures of R. serpentina [4,5]. PNAE has also been highly enriched from cultured plant cells and the cDNA was recently functionally expressed in Escherichia coli [6]. Sequence alignment studies showed highest homol- ogies to an esterase involved in pathogen defence in rice [7] that hydrolyses naphthol esters, and to hydroxynitrile lyases (HNLs) from Hevea brasiliensis [8] and Manihot esculenta [9]. The alignment suggested that PNAE is a new member of the a/b hydrolase superfamily that contains the putative catalytic triad serine, aspartic acid and histidine [10]. For the present communication, a more detailed charac- terization of PNAE was performed by testing the influence of various inhibitors, HNL substrates and by structure elucidation of a PNA derivative formed under in vitro conditions. Mechanistic aspects of the reaction catalyzed were investigated by site-directed mutagenesis, replacing the amino acids of the putative catalytic triad and individual cysteine residues by alanine in order to characterize the mutant enzymes and to localize essential cysteines. Model- ling experiments of PNAE based on the X-ray data of HNL from H. brasiliensis [11,12] are described, allowing for the first time a deeper insight into a particular step of Rauvolfia alkaloid biosynthesis. MATERIALS AND METHODS Materials The expression vector pQE-70 was obtained from Qiagen (Hilden, Germany). Restriction enzymes SphIandBglII were from New England Biolabs (Beverly, USA) and T4-DNA ligase was from Promega (Madison, WI, USA). Correspondence to J. Sto ¨ ckigt, Institut fu ¨ r Pharmazie, Johannes Gutenberg-Universita ¨ t Mainz, Staudinger Weg 5, 55099 Mainz, Germany. Fax: + 49 61313923752, Tel.: + 49 61313925751, E-mail: stoeckig@mail.uni-mainz.de Abbreviations: AEBSF, 4-(2-aminoethyl)-benzenesulfonyl-fluoride (trade mark name Pefabloc SC); DEPC, diethylpyrocarbonate; E-64, N-[N-( L -3-trans-carboxirane-2-carbonyl)- L -leucyl]-agmatine; HNL, hydroxynitrile lyase; PNAE, polyneuridine aldehyde esterase; TPCK, L -chloro-3-(4-tosyl-amido)-4-phenyl-2-butanone; TLCK, L -chloro-3-[4-tosyl-amido]-7-amino-2-heptanone; PNA, polyneuridine aldehyde; PMSF, phenylmethanesulfonyl fluoride. Enzyme: hydroxynitrile lyase (EC 4.2.1.39). (Received 14 January 2002, revised 19 April 2002, accepted 24 April 2002) Eur. J. Biochem. 269, 2889–2896 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02956.x The QuikChange TM in vitro Site-Directed Mutagenesis Kit was obtained from Stratagene (La Jolla, CA, USA). For purification of the His-tagged mutant enzymes, the nitril- otriacetic acid/Ni 2+ resins were supplied by Qiagen (Hilden, Germany). For the determination of molecular weight, a Superdex 75 HR30/10 column (Amersham Pharmacia, Freiburg, Germany) was used. For the inhibition studies, 4-(2-aminoethyl)-benzenesulfonyl-fluoride (AEBSF; trade name Pefabloc SC) and N-[N-( L -3-trans-carboxirane-2-car- bonyl)- L -leucyl]-agmatine (E-64) were purchased from Roche (Mannheim, Germany), L -chloro-3-(4-tosyl-amido)- 4-phenyl-2-butanone (TPCK) and L -chloro-3-[4-tosyl- amido]-7-amino-2-heptanone (TLCK) were purchased from Calbiochem (La Jolla, CA, USA), phenylmethane- sulfonyl fluoride (PMSF) was from Serva (Heidelberg, Germany), HgCl 2 from Merck (Darmstadt, Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany). All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen, Germany) or from Appli- Chem (Darmstadt, Germany). Site-directed mutagenesis Site-directed mutagenesis of (His) 6 PNAE was achieved using the QuikChange TM in vitro Site-Directed Mutagenesis Kit, according to the manufacturer’s recommendations. For generation of the mutant enzymes, the following oligonu- cleotides were used: C20A: 5¢-CTGGTACACGGCGGAT GTCTCGGAGCTTGGATCTGG-3¢. C132A: 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C170A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C257A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. H17A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-86A:5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGAGTTTGGG-3¢. S87A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢. H244A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D216A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-phosphorylated and of high purity salt free grade. The substituted nucleotides are underlined and written in bold script. Enzyme expression and purification For the expression of the mutated cDNAs, reading frames were amplified with the primer pair pQE70PErev and pQE70PEfor, which included the appropriate restriction sites (SphIandBglII) to enable the ligation into the expression vector pQE70. After ligation, the mutants were transformed into E. coli strain TOP 10, and were grown at room temperature for 64 h without shaking, in Luria– Bertani medium containing 100 lgÆmL )1 ampicillin. From these cultures, crude extracts were prepared by sonification at 4 °C with a Sonoplus Homogenisator HD 70 with sonotrode MS 73 and (Sonifier) HF-Generator GM 70 (70 W, 20 kHz) (Bachofer GmbH, Reutlingen, Germany) (6 · 10 s). Activities of the mutated enzymes with substrate were monitored by a standard HPLC assay as recently described [6]. The plasmids were purified by nucleospin mini preparation (Macherey–Nagel, Du ¨ ren, Germany), and sequenced by primer walking using the dideoxy chain termination method [13]. For protein purification, the mutated and the wild-type cDNAs were transformed into the E. coli strain M15[pREP4]. An inoculum of 50 mL was grown at 25 °C for 40 h in the above mentioned medium containing also kanamycin (25 lgÆmL )1 ), and was diluted 1 : 9 with the same medium. After growing for 1 h with shaking (100 r.p.m), isopropyl thio-b- D -galactoside was added (1 m M final concentration). After further cultivation at 25 °C until a D 600 ¼ 1.0–1.1 was reached, the cells were harvested by centrifugation (10 000 g,4°C). The pellet was re-suspended in 5 mL re-suspension buffer (50 m M NaH 2 PO 4 ,300m M NaCl, pH 7.0) containing 10 m M imidazole and was sonicated at 4 °C(6· 10 s). After centrifugation (10 000 g, 20 min) total PNAE activity was determined in the supernatant. (His) 6 PNAE wild-type protein and the muteins were purified on self packed Ni 2+ resin columns (0.7 cm internal diameter · 1cm).For the washing steps, the above mentioned buffer containing 20 and 50 m M imidazole, each of 20 mL was used and elution was performed with 250 m M imidazole. The purity of the eluted fractions was checked by SDS/PAGE. The fractions with the highest protein concentration were combined and dialysed against 50 m M Na phosphate buffer, pH 7.0, containing 20 m M 2-mercapoethanol for 20 h at 4 °C. After determination of the enzyme activity with the standard enzyme assay, the kinetic studies (K m , k cat ) were completed for the active muteins and for the wild-type enzyme. Enzyme and protein assays Protein concentrations of the muteins and the wild-type enzyme were determined with the Bradford reagent [14] using BSA (SERVA, Heidelberg, Germany) as standard. Fig. 1. The major steps of the ajmaline pathway. The biosynthesis of the antiarrhythmic alkaloid ajmaline, in Rauvolfia serpentina cell sus- pension cultures, involves the conversion of polyneuridine aldehyde into epi-vellosimine. This central reaction of the pathway is catalysed by the enzyme polyneuridine aldehyde esterase (PNAE). 2890 E. Mattern-Dogru et al. (Eur. J. Biochem. 269) Ó FEBS 2002 The enzyme activity in the pure fractions was assayed as follows: the incubation mixture with a total volume of 50 lL contained a final concentration of 0.01 m M poly- neuridine aldehyde (PNA) and 0.1 M sodium phosphate buffer (pH 7.0) with various enzyme concentrations. The mixture was incubated for 15 min at 30 °C. After the addition of 2 lLHCl(0.1 M ), 5 lLNaBH 4 solution (1% in 10 m M NaOH) and 0.1 mL MeOH, the mixture was centrifuged (18 000 g, 5 min) and the supernatant was analysed by the standard HPLC assay [6]. Assay for the production of the polyneuridine aldehyde ethylester derivative The incubation mixture with a total volume of 10 mL was divided into 10 · 1 mL aliquots. For the most efficient synthesis of the ethylester derivative, 0.1 m M of PNA was incubatedin50m M sodium phosphate buffer (pH 8.0) in the presence of 15% EtOH, with various enzyme concen- trations for 20 min at 30 °C. The conversion was tested by the standard HPLC method. The reaction products were extracted from the incubation mixture twice with 200 lL CHCl 3 and purified by preparative thin layer chromato- graphy with the following solvent system; CHCl 3 /MeOH/ 25% NH 3 (9 : 1 : 0.02). The products were identified by EI-mass spectrometry on a Finnigan MAT 44S quadrupole instrument (Bremen, Germany) by direct inlet and 70 eV. Molecular mass determination For the determination of the relative molecular mass, 100 lLof(His) 6 PNAE wild-type protein, obtained from E. coli M15 cells (0.68 mgÆmL )1 ) was loaded onto a superdex column and fractionated (each 0.5 mL) with a 50 m M Na phosphate buffer pH 7.0 containing NaCl (150 m M ). For comparison, the same procedure was repeated with 100 lL of the crude extract preparation of theenzyme(2.0mgÆmL )1 )fromRauvolfia plant cell suspension culture. Inhibition studies The effects of the following inhibitors, in the mentioned concentrations, were checked on the pure (His) 6 PNAE enzyme fractions that were dialysed against 50 m M sodium phosphate buffer before use (pH 7.0, for 20 h at 4 °C): AEBSF (1.0 m M ,4.0m M ), phenylmethanesulfonyl fluoride (1.0 m M ), TPCK (200 l M ), TLCK (120 l M ), E-64 (25 l M ), HgCl 2 (200 l M ), DEPC (0.8–1.2 m M ). The enzyme frac- tions, except DEPC, were preincubated with inhibitor for 1hat30°C. With DEPC, the enzyme was preincubated at 4 °C for 30 min. Then the activity of the enzyme was tested. Model-building A model of the three-dimensional structure of (His) 6 PNAE was constructed using a homology-modelling approach based on the precalculated alignment of the hydroxynitrile lyase to which PNAE has 43% identity. The X-ray structure of hydroxynitrile lyase from H. brasiliensis was used as a template structure [11]. (Protein Data Bank accession no. 1YAS). The model structures were calculated using the software MODELLER (version 4) [15], a program that models structures by satisfaction of spatial restraints. Fifteen models were created for wild-type PNAE. The CCP 4 program suite [16] was used for the superposition of the models and calculations. RESULTS Sequence analysis of recently expressed (His) 6 PNAE in E. coli placed this specific enzyme of ajmaline biosynthesis, as a new member, into the a/b hydrolase enzyme super- family. Most typical for this class of hydrolases are the three strictly conserved amino acids Ser, Asp, and His, which could represent the catalytic triad of PNAE [6]. Moreover, re-activation of an enzyme preparation by 2-mercapoetha- nol suggested free SH-groups to be necessary for hydrolytic activity of PNAE. In order to gain evidence for these suggestions, inhibitor studies, site-directed mutagenesis experiments and modelling of PNAE were performed. Inhibitor studies Several known inhibitors reacting with the amino acids Ser, Cys or His were tested on wild-type (His) 6 PNAE (Table 1). Pefabloc SC (AEBSF), a selective serine modifying agent [17], did not influence the enzyme activity at a variety of concentrations, which was also observed for the Cys selective inhibitor E-64 [18]. Partial inhibition of 20 and 12% of PNAE was measured with the Ser-Cys inhibitors phenylmethanesulfonyl fluoride and TLCK, respectively. TPCK had, however, no effect on catalytic activity. Incubation of purified (His) 6 PNAE wild-type enzyme in the presence of Hg +2 resulted in complete loss of catalytic activity, which was recovered (90%) after adding 60 m M 2- mercapoethanol. Complete inhibition occurred with DEPC, which is a strong histidine-modifying agent [19]. Extraordinarily high concentrations of 2-mercapoethanol (upto2 M ) did not reduce the activity of (His) 6 PNAE. Site-directed mutagenesis In this study, we have produced wild-type (His) 6 PNAE and 10 muteins of it. Four of six cysteine residues in positions 20, 132, 170 and 257 were changed to alanine and one (position 213) to serine. Histidine at position 17, 86 and 244, serine at 87 and aspartic acid at 216 were replaced by alanine. Among these, Ser87, Asp216 and His244 formed the putative catalytic triad of PNAE, analogous to H. brasiliensis HNL and most other a/b hydrolase enzyme superfamily members [10]. Table 1. Inhibition studies with pure (His) 6 PNAE. The experiments were performed with SH-group modifiers, selective serine-, cysteine- and histidine-inhibitors and serine-cysteine modifying agents. Inhibitor (m M ) Modified residue Inhibition (%) HgCl 2 (0.2) Cysteine 100 E-64 (0.025) Cysteine 0 AEBSF (1.0, 4.0) Serine 0 PMSF (1.0) Serine-Cysteine 20 TLCK (0.12) Serine-Cysteine 12 TPCK (0.2) Serine-Cysteine 0 DEPC (0.8–1.2) Histidine 100 Ó FEBS 2002 Potential active-site residues of PNA esterase (Eur. J. Biochem. 269) 2891 Expression of (His) 6 PNAE muteins in E. coli These muteins were expressed in E. coli M15 using the bacterial expression vector pQE-70. Purification of the wild- type enzyme and the individual muteins was facilitated by introduction of a His-tag at the N-terminus followed by step-gradient elution with imidazole from Ni 2+ -nitrilotri- acetic acid columns. Except for the inactive muteins, all the active enzyme preparations showed a purity of > 95%, based on SDS/PAGE and Coomassie-blue staining (Fig. 2). The degree of enzyme purity among the active muteins and the wild-type preparations was comparable. Enzyme activity and kinetics The enzyme activity tests using PNA as substrate were performed with the wild-type enzyme and its individual muteins after purification. The site-directed mutagenesis results verified that the strictly conserved amino acids identified by multiple sequence alignment [6], namely Ser87, Asp216 and His244, formed the catalytic triad of (His) 6 PNAE. After they were individually replaced by alanine, the activity of the enzyme was lost completely (Table 2). With the Cys muteins, the results were variable. After mutating Cys213 and 257, the specific activity of the enzyme was not considerably affected, even though the mutant enzyme C213S contained a second mutation that occurred fortuit- ously during PCR. The glycine at position 152 was exchanged for glutamic acid, which seemed not to have further influence on activity. Nevertheless, the specific activities of each of the muteins decreased. With the exchange of Cys132, there was a dramatic decrease (four- fold) in the specific activity, and in the case of Cys170, the decrease in the specific activity was even greater (approx. sevenfold). The exchange of Cys20 resulted in the total inactivation of the mutant enzyme. For the remaining two histidines, the results were also remarkable. When His17 was changed to Ala, the specific activity significantly decreased, but still the kinetic data could be determined. But in the case of His86, the activity was so low that it was not possible to perform further kinetic experiments. The specific activity could, however, be measured (Table 2). The kinetic parameters, such as K m ,andk cat , for the wild- type and the muteins are given in Table 2, together with the specific enzyme activities ranging from  32 to 24 pkatÆmg )1 for active preparations. The K m value of the wild-type enzyme is smaller than previously reported [6]. For muteins with low activity, up to  300-fold higher amounts of enzyme and prolongation of incubation periods from 10 min to 3 h were used, which were sufficient to determine relative activities equivalent to 0.1% compared to the wild- type PNAE. Substrate specificity experiments with racemic mandelonitrile The activity of wild-type (His) 6 PNAE was tested on racemic mandelonitrile, which is the natural substrate for the FAD dependent HNL from Prunus sp. (Rosaceae) [9] but accepted as well by H. brasiliensis HNL. The specific activity was measured by following the formation of Fig. 2. Gradient-step purification of (His) 6 PNAE and its muteins. The soluble protein extracts were in each case purified by step gradient elution with imidazole on Ni 2+ -nitrilotriacetic acid columns. The fractions were checked by SDS/PAGE and Coomassie-blue staining. The position of the purified proteins is marked with an arrow. The labelling of the lanes is as follows: (A) Marker protein, (B) crude E. coli extract, (C) pure wild-type (His) 6 PNAE, (D) H17A, (E) C20A, (F) H86A, (G) C132A, (H) C170A, (I) C213S, (J) C257A, (K) S87A, (L) H244A, (M) D216A. Table 2. Comparison of kinetic parameters of (His) 6 PNAE and its muteins expressed in E. coli. K m and k cat values were calculated from Lineweaver– Burk plots using PNA as substrate. Values of linear regression coefficients were >0.9 in all experiments. ND, not detectable. Enzyme K m (l M ) Specific activity (nkatÆmg protein )1 ) k cat (nkatÆmg protein )1 ) Protein conc. in incubation (lgÆmL )1 ) Wild-type 36 32.4 146.7 0.3 C257A 46 21.5 122.5 0.48 C213S/G152Q 33 22.5 98.56 0.46 C170A 34.5 4.9 20.58 0.9 C132A 108 8.1 73.0 1.26 C20A ND ND ND 6.2 H17A 273 0.2 5.75 12.0 H86A ND 0.024 ND 10.8 S87A* ND ND ND 98.4 D216A* ND ND ND 14.4 H244A* ND ND ND 62.4 2892 E. Mattern-Dogru et al. (Eur. J. Biochem. 269) Ó FEBS 2002 benzaldehyde (detection limit 0.5%) as described in the mandelonitrile assay for HbHNL [20]. But as expected, the highly substrate-specific PNAE did not accept the substrate of H. brasiliensis HNL, as in the case of earlier substrate specificity experiments with various methylesters [6]. Identification of a new intermediate of the PNAE reaction and first recognition of a novel substrate When the enzyme assay was performed in the presence of ethanol, a novel intermediate was detected by HPLC analysis showing a retention time of 7.3 min. This com- pound, which is the ethyl ester derivative of PNA, is accepted by the enzyme as shown by its conversion into vellosimine after prolonged incubation or when excessive amount of PNAE is added (data not shown). This is the only known compound that is accepted by the enzyme in addition to its natural substrate PNA. After optimization of assay conditions for its formation, the product was isolated and analysed by MS. EI-MS data were m/z (%): 366 (37, M + ), 365 (37, M + -1), 335 (17, M + -CH 2 OH), 249 [71, 365-C(CH 2 OH)CO 2 CH 2 CH 3 ], 235 (15), 182 (24), 168 (100), 156 (21), 143(12), 129 (15), 115 (21). Molecular mass determination PNAE was found to migrate on SDS/PAGE with a mobility corresponding to an apparent molecular mass of 30 000 Da [6]. After gel filtration of the recombinant and the native enzyme through a Superdex column, a relative molecular mass of 60 000 Da was determined, suggesting that the enzyme is a homodimer in aqueous solutions at pH 7.0. The dimer had not been observed earlier with an enriched PNAE preparation chromatographed on an AcA 54 column [4,5]. Modelling Based on the three-dimensional structure of HNL from H. brasiliensis, which is known from an X-ray analysis with 2.3 A ˚ resolution [11], a model of (His) 6 PNAE was con- structed. For this purpose, 15 different models were generated by the modeller program. The deviations between these models were generally small for the backbone atoms (rmsd from 0.2 to 0.6 A ˚ ). The model with the best stereochemistry was selected for the wild-type structure. All the measurements given in the text represent the C a –C a distances. DISCUSSION Indole alkaloid biosynthesis of the ajmaline/sarpagine group which occurs in the genus Rauvolfia, has been well- elucidated during the last decade. For a more detailed determination of enzyme properties and structures and for knowledge of the catalytic mechanisms, heterologous expression of the appropriate cDNAs is a prerequisite. Sequence alignments of PNAE with the other enzymes of the a/b hydrolase family showed identity up to 43% with HNL from H. brasiliensis. This can be considered as high in this particular enzyme family, suggesting that the two enzymes are closely related to each other [10,21]. Gel filtration showed that at neutral pH, PNAE forms a homodimer, as do HbHNL and acetylcholine esterase [22]. Due to recovery of enzyme activity with 2-mercapoethanol after HgCl 2 inhibition, a probable formation of an S–S bridge resulting in homo-dimerization was taken into consideration. However, high amounts of 2-mercapoetha- nol, which would lead to the dissociation of such a dimer into both subunits [23], did not affect the activity of PNAE. The dimerization obviously does not depend on cysteine residues, but most probably takes place via a contact area of apolar residues [12], as the sequence comparison between the HbHNL and PNAE gives a pronounced homology of 75% (Fig. 3) at these apolar sections. Also, as the dimeric nature was observed both for the native enzyme and the recombinant (His) 6 - PNAE, the His-tag has no apparent influence on dimer formation. In contrast, from the point of view of substrate accept- ance, there are no similarities between the enzymes. Whereas Fig. 3. Sequence alignment of PNAE and H. brasiliensis HNL. The gray shading indicates the sequence identity (43%) between the two enzymes. The yellow regions are the apolar sections which may be responsible for the dimerisation of PNAE. For HbHNL these regions are dark gray with white letters. There is a sequence similarity of 82% between the two apolar sections. The residues marked red with a star above form the catalytic triad. The mutations which reduce the activity are shown in blue and the mutations leading to complete loss of enzyme activity are marked in green. Ó FEBS 2002 Potential active-site residues of PNA esterase (Eur. J. Biochem. 269) 2893 HNLs have a rather broad substrate specificity, PNAE will only accept its natural substrate and the ethyl analogue. When the assays of PNAE were performed in presence of ethanol in order to dissolve PNA, a second conversion product was observed by HPLC. The addition of more enzyme to these incubations resulted in conversion of this compound to vellosimine. The structure determination of this intermediate by mass spectrometry proved the forma- tion of an ethyl ester, a PNA analogue, which is the only other substrate so far known to be accepted by the enzyme. The formation of this analogue, which is most probably formed by trans-esterification of the substrate, was previ- ously detected also for the enriched enzyme fractions from the plant cells. It can be speculated that an enzyme-bound, activated intermediate of the substrate, such as PNA acid bound as a thioester to a cysteine SH-group, might be involved in the mechanism. However, replacement of several cysteine residues of PNAE (see data below) by alanine did not influence the formation of the analogue. The mechanism of this process therefore remains to be elucidated. The results of the inhibition studies were also helpful to define potential active residues. The complete inhibition of the enzyme with HgCl 2 showed the importance of cysteine residues for the activity. However, at this stage it still remained unclear whether PNAE is a cysteine or serine hydrolase, regarding studies with cysteine and serine protease inhibitors. The next clear information obtained was the necessity of histidine groups which proved the active role of at least one histidine in substrate binding. The following site-directed mutation experiments were therefore designed to prove whether PNAE is indeed a member of the a/b hydrolase fold enzyme family, as we have suggested recently [6]. If so, PNAE must harbour the catalytic triad nucleophile-histidine-acid. Based on sequence alignment, Ser87 is a member of the consensus sequence Gly-X-Ser-X- Gly/Ala in PNAE, which defines this residue in serine hydrolases. It is most probable that PNAE can be classified among this group. Replacement of Ser87 by alanine formed a mutein that was unable to hydrolyse PNA even when 330- fold excess of enzyme was used compared to the wild-type. This result indicates an absolute involvement of Ser87 in the catalytic process. Exchange of His244 gave a mutein that was completely inactive in the PNA hydrolysing assay, even if a 200-fold excess of enzyme was used. This shows unequivocally that His244 belongs to the catalytic triad. Exchange of the last putative member of the catalytic triad, which from alignment studies is aspartic acid at position 216, also gave a mutein devoid of any PNA-hydrolytic activity. Even a 50-fold excess of this mutein gave no Fig. 4. Stereo pictures of the modelled structure of (His) 6 PNAE. Only the backbone and the side-chains of the mutated amino acids are shown. The amino acids of the catalytic triad, mutations which reduced the activity of (His) 6 PNAE and mutations with a complete loss of activity are drawn in red, blue and green, respectively. The direction of view is along the channel connecting the active site with the outside of the protein. (B) shows the view of (A) when rotated along the y axis by 90°.The pictures were generated using the programs MOLSCRIPT [24] and RASTER 3 D [25]. 2894 E. Mattern-Dogru et al. (Eur. J. Biochem. 269) Ó FEBS 2002 measurable conversion of PNA. The position of this particular aspartic acid in the sequence and in the model, is consistent with the complete inactivation of the mutant enzyme. This suggests that Asp216 does indeed represent the acidic residue in the active centre of PNAE. All these kinetic results and theoretical data given by sequence alignments support the assumption illustrated by the model (Fig. 4) that in PNAE, the typical catalytic triad of the a/b hydrolase family is conserved. The model also suggests that the active site is deeply buried inside the protein and is connected to the protein surface by a narrow channel (not illustrated). The mutation of two residues Cys20 and Cys132, which are located at the entrance of this narrow channel, gave interesting results. The complete loss of activity in the case of Cys20, which has a deeper location than Cys132, suggests its extraordinary function for cata- lysis. This may be related to its direct contribution via a free SH-group directed into the channel. Cys132 seems to also play an important role. When it was exchanged, a loss of 75% in specific activity was observed but more interestingly the K m value increased to threefold of that of the wild-type enzyme. This might indicate that the intake of the substrate is hampered supporting the location of Cys132 discussed above. To identify histidine residues in PNAE responsible for catalysis, His17 and His86 were replaced by alanine. In the case of His17, which is a very conserved residue in a/b hydrolases, there was a 162-fold decrease in the specific activity even though the imidazole ring seems to point outward, in the opposite direction of the active centre (Fig. 4). The eightfold increase in the K m value (Table 2) compared to wild-type may demonstrate a strong influence of this residue on maintaining the conformation in addition to its probable contribution to the hydrolysis mechanism. His86, which is a direct neighbour of the catalytic Ser87 (3.8 A ˚ ), with an imidazole ring directed towards the active centre, showed a 1600-fold decrease in specific activity. This suggests a strong change at least in the steric properties of the substrate binding site. However, it remains unclear as to how these histidines finally influence PNA hydrolysis. Another amino acid interesting for PNAE activity is cysteine. Therefore, additional cysteine mutation studies were carried at positions 213, 257 and 170. C213S and C257A showed almost 33% loss in their specific activities; for C170A this decreased to 85%. The models (Fig. 4) show how closely Cys213 is located to Asp216 (5.8 A ˚ ), whereas Cys257 is located further away (17.9 A ˚ ). Interestingly, the inhibition of the enzyme in both cases is almost identical. Cys170 is also located behind the catalytic triad member His244 at a distance of 9.3 A ˚ , but nevertheless exhibiting a great loss in the specific activity. The influence of these residues on the activity by modelling at this stage is not clear. On the other hand, the K m values for the three muteins are almost identical to that of the wild-type, indicating that these cysteines might not have a big influence on the binding of the substrate. In conclusion, we have identified by site-directed muta- genesis the residues of the catalytic triad Ser87, Asp216 and His244 of PNAE. The order of these catalytic amino acids corresponds to that of the a/b hydrolase family, which suggests that PNAE is indeed a novel member of this group. The locations of the mutated residues in the model and the kinetic results support the notion that the enzyme has a very similar topology to HbHNL. However, to gain more insight into the mechanism of hydrolysis and the conformation of PNAE, it would be necessary to perform X-ray diffraction analysis. ACKNOWLEDGEMENTS This work was supported by a grant of Deutsche Forschungsgeme- inschaft (Bonn, Bad-Godesberg, Germany), the Fonds der Chemischen Industrie (Frankfurt/Main, Germany) and by BMBF (Bonn, Germany). Dr Xueyan Ma acknowledges BASF (Ludwigshafen, Germany) for a scholarship. REFERENCES 1. Sto ¨ ckigt, J. (1995) Biosynthesis in Rauvolfia serpentina,modern aspects of an old medicinal plant. In The Alkaloids (Cordell, G.A., ed.), Vol. 47, pp. 115–172. Academic Press, San Diego, CA, USA. 2. Kleinsorge, H. (1959) Klinische Untersuchungen u ¨ ber die Wirkungsweise des Rauwolfia Alkaloids (Ajmalin) bei Herzrhy- thmussto ¨ rungen insbesondere der Extrasystole. Med. Klin. 54, 409–416. 3. Sto ¨ ckigt, J. (1998) Alkaloid metabolism in plant cell culture. In Natural Product Analysis (Schreier, P., Herderich, M. & Humpf, H M., eds), pp. 313–325. Vieweg, Braunschweig, Wiesbaden, Germany. 4. Pfitzner, A. & Sto ¨ ckigt, J. (1983) Polyneuridine aldehyde esterase: an unusually specific enzyme involved in the biosynthesis of sar- pagine type alkaloids. J. Chem. Soc. Chem. Commun. 459–460. 5. Pfitzner, A. & Sto ¨ ckigt, J. (1983) Characterization of poly- neuridine aldehyde esterase, a key enzyme in the biosynthesis of sarpagine/ajmaline type alkaloids. Planta Med. 48, 221–227. 6. Dogru, E., Warzecha, H., Seibel, F., Haebel, S., Lottspeich, F. & Sto ¨ ckigt, J. (2000) The gene encoding polyneuridine aldehyde esterase of monoterpenoid indole alkaloid biosynthesis in plants is an ortholog of the a/b hydrolase super family. Eur. J. Biochem. 267, 1397–1406. 7. Wa ¨ spi, U., Misteli, B., Hasslacher, M., Jandrositz, A., Kohlwein, S.D., Schwab, H. &Dudler, R. (1998) The defense-related rice gene Pir7b encodes an a/b hydrolase fold protein exhibiting esterase activity towards naphthol AS-esters. Eur. J. Biochem. 254, 32–37. 8. Hasslacher, M., Schall, M., Hayn, M., Griengl, H., Kohlwein, S.D. & Schwab, H. (1996) Molecular cloning of the full-length cDNA of (S)-hydroxynitrile lyase from Hevea brasiliensis. J. Biol. Chem. 271, 5884–5891. 9. Hughes, J., de Carvalho, F.J.P.C. & Hughes, M.A. (1994) Puri- fication, characterization, and cloning of a-hydroxynitrile lyase from cassava (Manihot esculenta Crantz). Arch. Biochem. Biophys. 311, 496–502. 10. Ollis, D.L., Cheah, E., Cygler, M., Dijkstra, B., Frolow, F., Franken, S.M., Harel, M., Remington, S.J., Silman, I., Schrag, J., Sussman, J.L., Verschueren, K.H.G. & Goldman, A. (1992) The a/b hydrolase fold. Protein Eng. 5, 197–211. 11. Gruber, K., Gugganig, M., Wagner, U.G. & Kratky, C. (1999) Atomic resolution crystal structure of hydroxynitrile lyase from Hevea brasiliensis. Biol. Chem. 380, 993–1000. 12. Wagner, U.G., Hasslacher, M., Griengl, H., Schwab, H. & Kratky, C. (1996) Mechanism of cyanogenesis: the crystal structure of hydroxynitrile lyase from Hevea brasiliensis. Structure 4, 811–822. 13. Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA Sequencing with chain-terminating inhibitors. Proc. Natl Acad. Sci. USA 74, 5463–5467. 14. Bradford, M. (1976) A rapid and sensitive method for the quan- titation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. 15. Sali, A. & Blundell, T. (1993) Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815. Ó FEBS 2002 Potential active-site residues of PNA esterase (Eur. J. Biochem. 269) 2895 16. Collaborative Computational Project Number, 4 (1994) The CCP4 suite: programs for protein crystallography. Acta Cryst. D50, 760–763. 17. Mintz, G.R. (1993) Technical note: an irreversible serine protease inhibitor. Biopharm. 6, 34–38. 18. Umezawa, H. & Aoyagi, T. (1983) In Protease Inhibitors: Medical and Biological Aspects. (Katunuma, N., ed.), pp. 3–15. Springer Verlag, Berlin. 19. Miles, E.W. (1977) Modification of histidyl residues in proteins by diethylpyro-carbonate. Methods Enzymol. 47, 431–442. 20. Hanefeld, U., Straathof, A.J.J. & Heijnen, J.J. (1999) Study of the (S)-hydroxynitrile lyase from Hevea brasiliensis: mechanistic implications. Biochim. Biophy. Acta. 1432, 185–193. 21. Heikinheimo, P., Goldman, A., Jeffries, C. & Ollis, D.L. (1999) Of barn owls and bankers: a lush variety of a/b hydrolases. Structure 7, R141–R146. 22. Sussman, J.L. & Silman, I. (1991) Atomic structure of acetyl- cholinesterase from Torpedo californica: a prototypic acetyl- choline-binding protein. Science 253, 872–879. 23. Esen, A. (1992) Purification and partial characterisation of maize (Zea mays L.) b-glucosidase. Plant Physiol. 98, 174–182. 24. Esnouf, R.M. (1999) Further additions to Molscript version 1.4. including reading and contouring of electron-density maps. Acta Cryst. D55, 938–940. 25. Merritt, E.A. & Bacon, D.J. (1997) Raster3D – photorealistic molecular graphics. Methods Enzymol. 277, 505–524. 2896 E. Mattern-Dogru et al. (Eur. J. Biochem. 269) Ó FEBS 2002 . Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis Emine. Mainz, Germany In the biosynthesis of the antiarrhythmic alkaloid ajmaline, polyneuridine aldehyde esterase (PNAE) catalyses a central reaction by transforming