luận án tiến sĩ nghiên cứu dịch tễ học và biện pháp phòng trị bệnh giun tròn đường tiêu hóa trên chó tại một số tỉnh đồng bằng sông cửu long

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC CẦN THƠ NGUYỄN THỊ CHÚC MSHV: P1014006 NGHIÊN CỨU DỊCH TỄ HỌC VÀ BIỆN PHÁP PHÒNG TRỊ BỆNH GIUN TRÒN ĐƢỜNG TIÊU HÓA TRÊN CHÓ TẠI MỘT SỐ TỈNH ĐỒNG BẰNG SÔNG CỬU LONG LUẬN ÁN TIẾN SĨ NGÀNH: BỆNH LÝ HỌC VÀ CHỮA BỆNH VẬT NUÔI MÃ NGÀNH: 62 64 01 02 CẦN THƠ, 2022 TIEU LUAN MOI download : skknchat@gmail.com BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC CẦN THƠ NGUYỄN THỊ CHÚC NGHIÊN CỨU DỊCH TỄ HỌC VÀ BIỆN PHÁP PHÒNG TRỊ BỆNH GIUN TRÒN ĐƢỜNG TIÊU HĨA TRÊN CHĨ TẠI MỘT SỐ TỈNH ĐỒNG BẰNG SƠNG CỬU LONG LUẬN ÁN TIẾN SĨ NGÀNH: BỆNH LÝ HỌC VÀ CHỮA BỆNH VẬT NUÔI MÃ NGÀNH: 62 64 01 02 CÁN BỘ HƢỚNG DẪN PGS.TS NGUYỄN VĂN DIÊN CẦN THƠ, 2022 TIEU LUAN MOI download : skknchat@gmail.com LỜI CẢM TẠ Trong suốt q trình thực luận án, tơi nhận đƣợc nhiều giúp đỡ, động viên gia đình, thầy cơ, bạn bè, bạn sinh viên, số quan tổ chức hồn thành luận án Xin gửi lịng tri ân đến ba mẹ anh chị em gia đình thân yêu nguồn động lực thúc đẩy nỗ lực phấn đấu Cảm ơn chồng tạo điều kiện thuận lợi cho tơi có thời gian học tập thật tốt Tất ngƣời thân yêu dành cho tơi tất tình u, khuyến khích ủng hộ tơi chặng đƣờng học tập hoàn thành luận án tiến sĩ Xin đƣợc bày tỏ lòng biết ơn sâu sắc đến thầy PGS.TS Nguyễn Văn Diên tận tình hƣớng dẫn, giúp đỡ tơi suốt q trình học tập, thực đề tài hồn thành luận án Tơi khơng thể quên ủng hộ hƣớng dẫn tận tình cô Nguyễn Hồ Bảo Trân, Bộ môn Thú y, Khoa Nông nghiệp, Đại học Cần Thơ, suốt thời gian thực luận án Tôi luôn ghi nhớ cơng ơn tình cảm PGS.TS Nguyễn Hữu Hƣng ngƣời thầy dõi theo nâng đỡ suốt thời gian thực hoàn thành luận án Đặc biệt, thầy ngƣời truyền cho tơi lịng nhiệt huyết niềm đam mê khoa học, khơi dậy tự tin, nỗ lực, cố gắng không ngừng khơng chùn bƣớc trƣớc khó khăn suốt thời gian thực luận án tiến sĩ Xin gửi lời cảm ơn chân thành đến Ban Giám Hiệu Trƣờng Đại học Cần Thơ, Khoa Nông Nghiệp, Khoa Sau Đại học, Ban lãnh đạo Viện Nghiên cứu Phát triển Công nghệ Sinh học quan tâm giúp đỡ tạo điều kiện tốt cho tơi hồn thành tiến trình học tập nghiên cứu Xin ghi nhớ công ơn quý Thầy, Cô Khoa Nông nghiệp hết lòng truyền đạt kinh nghiệm kiến thức quý báu cho suốt thời gian học Xin cảm ơn chia sẻ nghiên cứu đến bạn, em sinh viên Bộ môn Thú Y, khoa Nơng nghiệp; phịng thí nghiệm Sinh học phân tử Viện Nghiên cứu Phát triển Công nghệ Sinh học, Đại học Cần Thơ Các anh, chị, bạn nghiên cứu sinh, học viên cao học em sinh viên Đại học đồng hành suốt trình học tập, nghiên cứu; chia sẻ khó khăn, khuyến khích động viên tơi suốt thời gian qua Các cán Chi cục Chăn nuôi Thú y tỉnh, trạm Chăn nuôi Thú y huyện, hộ chăn ni chó tỉnh An Giang, Bến Tre, Đồng Tháp, Sóc i TIEU LUAN MOI download : skknchat@gmail.com Trăng, Kiên Giang thành phố Cần Thơ tạo điều kiện giúp đỡ việc thu thập mẫu Xin chân thành cảm ơn Ban Giám Hiệu trƣờng Cao đẳng Cơ điện Nông nghiệp Nam Bộ, Ban Giám Hiệu trƣờng Đại học Tây Đô, Ban Chủ nhiệm Khoa Sinh học ứng dụng, trƣờng Đại học Tây Đô tạo điều kiện để đƣợc tham gia học tập nâng cao trình độ chun mơn, bạn đồng nghiệp không ngừng động viên giúp đỡ suốt thời gian học tập, nghiên cứu Cuối xin kính chúc tất ngƣời thật nhiều sức khỏe, hạnh phúc thành công! Nguyễn Thị Chúc ii TIEU LUAN MOI download : skknchat@gmail.com TÓM LƢỢC Đề tài đƣợc thực nhằm nghiên cứu dịch tễ học biện pháp phịng trị bệnh giun trịn đƣờng tiêu hóa chó số tỉnh Đồng sơng Cửu Long Qua phƣơng pháp kiểm tra 1.727 mẫu phân mổ khám 1.152 chó để tìm diện giun trịn chó tỉnh, thành nhƣ: An Giang, Đồng Tháp, Bến Tre, Sóc Trăng, Kiên Giang TP Cần Thơ Tỷ lệ nhiễm giun tròn qua xét nghiệm phân tỉnh khảo sát từ năm 2014-2018 62,77%, qua mổ khám 71,70% Có lồi giun trịn đƣợc tìm thấy thuộc giống Ancylostoma caninum, Ancylostoma ceylanicum, Ancylostoma braziliense, Uncinaria stenocephala, Toxocara canis, Toxascaris leonina, Trichocephalus vulpis Spirocerca lupi Trong A caninum tỷ lệ nhiễm cao (69,97%) Tỷ lệ nhiễm giun trịn giảm theo tuổi chó; chó từ 1-12 tháng tuổi có tỷ lệ nhiễm cao (66,48%), chó 13-24 tháng tuổi (62,33%) giảm thấp chó >24 tháng (55%) Chó nội lai có tỷ lệ nhiễm 72,59%, cao chó ngoại (51,20%), chó ni theo phƣơng thức thả rơng có tỷ lệ nhiễm (78,06%) cao ni nhốt (44,54%) Mùa mƣa chó nhiễm cao (74,30%) mùa nắng (52,12%) Phƣơng thức vệ sinh tắm chải định kỳ tẩy trừ làm hạn chế tỷ lệ nhiễm giun trịn Có mối tƣơng quan số trứng giun A caninum gram phân tổng số giun thể chó theo phƣơng trình hồi quy Y= 11.22+0,005X Định danh giun tròn kỹ thuật sinh học phân tử PCR-RFLP giải trình tự gene ITS-1, cox-1 phát loài A caninum, A ceylanicum A braziliense, T canis S lupi Phân tích phả hệ A caninum vùng ĐBSCL có quan hệ di truyền gần gũi với A caninum Trung Quốc (KJ840827) vùng hạ lƣu sông Mekong (LC177194) Lồi A ceylanicum vùng ĐBSCL có quan hệ di truyền gần gũi với A ceylanicum có nguồn gốc ngƣời vùng Đông Nam Á (Malaysia Thái Lan) Lồi S lupi lồi T canis có độ tƣơng đồng cao lần lƣợt 97,2% 99%-100 % so với mẫu tham chiếu loài Thời gian hồn thành vịng đời A caninum 27,7 ngày Chó nhiễm A caninum có triệu chứng gầy ốm, tiêu chảy có máu, nơn mửa Ở niêm mạc ruột xuất huyết, thành ruột non bị bong tróc lẫn với máu dịch ruột Các tế bào niêm mạc ruột bong tróc, lơng nhung ruột bị đứt nát, tăng bạch cầu toan ổ viêm Số lƣợng hồng cầu, hàm lƣợng huyết sắc tố tỷ khối hồng cầu giảm; số lƣợng bạch cầu tăng so với chó khơng nhiễm iii TIEU LUAN MOI download : skknchat@gmail.com Thuốc B (pyrantel) liều 120 -140 mg/kg thể trọng thuốc A (levamisol) liều 180mg/kg thể trọng, có hiệu cao tẩy trừ giun móc giun đũa sau 5-10 ngày Từ khóa: chó, ĐBSCL, giun đũa, giun móc, giun thực quản iv TIEU LUAN MOI download : skknchat@gmail.com ABSTRACT The study was carried out to study the epidemiology and prevention measures of gastrointestinal roundworm disease in dogs in some provinces of the Mekong Delta Through testing 1727 stool samples and dissecting 1152 dogs to find the presence of roundworms in dogs in provinces and cities such as: An Giang, Dong Thap, Ben Tre, Soc Trang, Kien Giang and Can Tho City The rate of roundworm infection in surveyed areas from 2014-2018 was 62.77% and through dissection was 71.70% There are species of roundworms, belonged to genera: Ancylostoma caninum, Ancylostoma ceylanicum, Ancylostoma braziliense, Uncinaria stenocephala, Toxocara canis, Toxascaris leonina, Trichocephalus vulpis and Spirocerca lupi Among them, A caninum has the highest infection rate of 69.97% The prevalence of roundworm infections in dogs decreased by age Dogs from 1-12 months old had the highest infection rate (66.48%), followed by dogs 13-24 months old (62.33%) and the lowest one was in dogs >24 months (55%) Domestic and crossbred dogs had the infection rate of 72.59% that was higher than foreign dogs (51.20%), free- ranging dogs had a higher infection rate (78.06%) than in captivity dogs (44.54%) Roundworm infection was recorded higher in rainy season (74.30%) than in dry season (52.12%) The method of cleaning, bathing, and periodically deworming reduced the rate of roundworm infection There was a correlation between the number of A caninum worm eggs in one gram of feces and the total number of female worms in the dog's body according to the regression equation Y= 11.22+0.005X Molecular identification of roundworms were performed by using PCR, PCR-RFLP techniques ITS-1, cox-1 gene sequencing, detected species of ITS-1 and cox-1 gene were sequenced to confirm the presence of species A caninum, A ceylanicum, A braziliense, T canis and S lupi Analysis of the phylogenetic tree showed that A caninum in the Mekong Delta had a close relation to A caninum in China (KJ840827) and the Lower Mekong River (LC177194) The species A ceylanicum in the Mekong Delta is genetically closely related to A ceylanicum which originated in humans in Southeast Asia (Malaysia and Thailand) S lupi and T canis showed a high similarity of 97.2% and 99%-100 %, respectively, compared with reference species in Genbank v TIEU LUAN MOI download : skknchat@gmail.com The life cycle of A caninum was 27.7 days Dogs infected with A caninum, that had symptoms of emaciation, bloody diarrhea, and vomiting In the intestinal mucosa hemorrhagic, the wall of the small intestine is sloughed off mixed with blood and intestinal fluid Intestinal mucosal cells are sloughed off, intestinal villi are severed, and eosinophils are increased in inflammatory foci Decreased red blood cell count, hemoglobin content and red blood cell mass; white blood cell count increased compared with uninfected dogs Drug B (pyrantel) at a dose of 120-140 mg/kg body weight and drug A (levamisole) at a dose of 180 mg/kg body weight, are highly effective in eradicating hookworms and roundworms after 5-10 days Keywords: dog, Mekong Delta, Ancylostoma, Toxocara canis, Spirocerca lupi vi TIEU LUAN MOI download : skknchat@gmail.com CỘNG HÒA XÃ HỘI CHỦ NGHĨA VIỆT NAM Độc lập - Tự - Hạnh phúc LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu nghiên cứu sinh Nguyễn Thị Chúc với hƣớng dẫn PGS.TS Nguyễn Văn Diên Các số liệu kết trình bày luận án trung thực chƣa đƣợc công bố tác giả khác cơng trình trƣớc Ngƣời hƣớng dẫn khoa học PGS.TS NGUYỄN VĂN DIÊN Tác giả luận án NGUYỄN THỊ CHÚC vii TIEU LUAN MOI download : skknchat@gmail.com MỤC LỤC Trang LỜI CẢM TẠ i TÓM LƢỢC iii ABSTRACT v LỜI CAM ĐOAN vii MỤC LỤC viii DANH SÁCH HÌNH xii DANH SÁCH BẢNG xiv CHƢƠNG GIỚI THIỆU 1.1 Tính cấp thiết đề tài 1.2 Mục tiêu nghiên cứu 1.3 Ý nghĩa khoa học 1.4 Ý nghĩa thực tiễn 1.5 Những đóng góp luận án CHƢƠNG TỔNG QUAN TÀI LIỆU 2.1 Tình hình nghiên cứu bệnh giun trịn chó giới nƣớc 2.1.1 Tình hình nghiên cứu giới 2.1.2 Tình hình nghiên cứu nƣớc 2.2 Phân loại lồi giun trịn ký sinh đƣờng tiêu hóa chó 13 2.2.1 Vị trí giun móc (Hookworm) hệ thống phân loại 13 2.2.2 Vị trí giun đũa (Roundworm) hệ thống phân loại 14 2.2.3 Vị trí giun tóc hệ thống phân loại 14 2.3 Đặc điểm sinh học lồi giun trịn 2.3.1 Đặc điểm sinh học giun móc 15 15 2.3.2 Đặc điểm sinh học giun đũa 21 2.3.3 Đặc điểm sinh học giun tóc 26 2.3.4 Đặc điểm sinh học giun đầu gai (Gnathostoma spinigerum) 28 viii TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Đuôi A caninum đực (X40) Đuôi A caninum (X40) Đầu A braziliense (X40) Đuôi A braziliense đực (X40) Đuôi A braziliense (X40) Đầu A ceylanicum (X40) 174 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Đuôi A.ceylanicum đực (X40) Trứng Trichuris vulpis (X10) Trứng T canis (X40) Trứng Toxascaris lenina (X40) Toxocara canis (X40) Đuôi Toxocara canis (X40) 175 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Đuôi Spirocerca lupi đực (X40) Đuôi Spirocerca lupi (X40) Phụ lục F3 Các giai đoạn vòng đời phát triển giun móc Phƣơng pháp Mac-Master Trứng giun móc mơi trƣờng (X40) Ni ấu trùng giun móc Trứng giun móc phân chia thành phơi bào (X40) Trứng phân chia thành phôi bào (X40) 176 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Trứng phân chia thành nhiều phơi bào (X40) Trứng hình thành ấu trùng bên (X40) Ấu trùng L1 (X40) Môi thực quản ấu trùng L1,L2 (X40) Ấu trùng L2 (X40) Ấu trùng L3 (X40) Bao miệng ấu trùng L3 (X40) Môi thực quản ấu trùng L3 (X40) 177 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Ấu trùng chuẩn bị lột xác (X10) Vỏ ấu trùng L3 (X40) Đo kích thƣớc ấu trùng trắc vi thị kính (X10) Đo kích thƣớc trứng thƣớc trắc vi thị kính (X10) Gây nhiễm cho chó thí nghệm Vịng đời phát triển A caninum Phụ lục F4 Triệu chứn lâm sàng chó nhiễm giun móc Chó gầy ốm, hay nằm Phân có máu 178 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Phụ lục F5 Mổ khám bệnh tích đại thể làm tiêu vi thể Dụng cụ mổ Khám lâm sàng trƣớc mổ Mổ khảo sát chó bệnh Cơ quan nội tang chó Cơ ngực nhợt nhạt Gan chó bị xuất huyết Xuất huyết ruột non Xuất huyết ruột già 179 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Cắt mẫu bệnh phẩm Gắn mẫu vào quy trình Nhuộm mẫu Đọc tiêu vi thể 180 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long THÔNG TIN KẾT QUẢ ĐỊNH DANH Khách hàng: Tên mẫu: Chị Chúc A ceylanicum Phương pháp sử dụng: Khuếch đại vùng gene ITS1 cặp mồi AF/AR (Theo Nguyễn Thị Chúc, 2016) Giải trình tự kiểm tra định danh vùng ITS giun móc Chiều dài sản phẩm khuếch đại: ~400 bp Trình tự Mồi_AF_360bp (5’-3’): AGCTGCGTTTTTCATCGATACGCGAATCGACCGATCCATCGCTGAA GCTAGTCGATTGTGACATAAAGTCACGATTCTGCAAACATTAAACGTAA AAAGTTATTGCTGTACTGGCGTCCGCGTTAGCAGATCATTAAGGTTWCC TGACAGACAGGTGCCGCACTAGGCGTWAGCCTAATGCTCAACCACCAA CACAAGCAGTAAGGCGGCATTCATGCAATGCTCATCAAGTCTAAAGCTC AGCGAAACGCGAACTTCGCACAGCAATCACTGCCGCCACCCAGGAACG GCTCTTGCTGCACATAGACACCTCACGTAGGGCTGTAACGGGGGGCGAT ACTCCCAACCTTCCCGACAAGA Kết blast kiểm tra định danh 181 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Kết luận: Ancylostoma ceylanicum Can Tho, August 22th, 2017 182 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long THÔNG TIN KẾT QUẢ ĐỊNH DANH Khách hàng: Tên mẫu: Chị Chúc Ancylostoma canium Phương pháp sử dụng: Khuếch đại vùng gene ITS1 cặp mồi AF/AR (Theo Nguyễn Thị Chúc, 2016) Giải trình tự kiểm tra định danh vùng ITS giun móc Chiều dài sản phẩm khuếch đại: ~400 bp Trình tự Mồi_AF_363bp (5’-3’): CTAGCTGCGTTTTTCATCGATACGCGAATCGACCGATCCATCGCTG AAGCTAGTCGATTGTGACRTGAAGTCACGATTCTGCAAACATTAAACGT AAAAAGTTATTGCTGTACTGGCGTCCGCGTTAGCAGATCATTAAGGTTT CCTGACAGACAGGTGMCGCATCAGGCGTTAGCCTAATGCTCAACCACC AACACAAGCAGTAAGGCGGCATTCATGCAATGCTCATCAAGTCTAAAGC TCAGCGAAACGCGAACTTCRCACAGCAATCAYTGCCGCCACCCAGTAAC GACTCTTGCTGCACATAGACACCTTACRTAGGGCTGTAACGGTGGGYGA TACTCCCAACCTTCCCGACAAAGA Kết blast kiểm tra định danh 183 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Kết luận: Ancylostoma caninum Can Tho, August 22th, 2017 184 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long THÔNG TIN KẾT QUẢ ĐỊNH DANH Khách hàng: Tên mẫu: Chị Chúc Giun đũa Phương pháp sử dụng: Khuếch đại vùng gene ITS2 cặp mồi thiết kế Mồi xuôi: 5’AAGCTGCACACATGTGGTG-3’ Mồi ngƣợc: 5’-ACCCTCAGCCAGACGTGC-3’ Giải trình tự kiểm tra định danh vùng ITS giun Chiều dài sản phẩm khuếch đại: 564bp Trình tự Mồi_ITS1_527bp (5’-3’): CGTGCTCATGGCAGACATGGCATGTGGCTTGGTGCGTGTTGAG GGGAAATGGGTGACGTGCTGGGCAAGTTAGAAAGGCGCGTCGATA GCGCCCATTTTCTCGCTATTCTTAAACAACGRTGTCCAGTTTGGCGT CTGCGCCTCACCTAGCTATTGCCCGGACCGTCGGTAGCGATGAAAG GTGGGGAGAAAGCTCCTCGTTTCGAGTTGAGTAGACTTAATGAGCA TCAGCTGGGATGCCGCCAAAAACCAAAAACACAATCAGTTAAGTT GATGTTGTTGAATTGTCGAGGATGAGCGCTGTTCTCGTGCAACGCT GCGCAGCTTATGTTGTTGTTGCTAGTGAACATGCTCGAGTCGACGA AGTATGTACAAATCTTAGCGGTGGATCACTCGGTTCGTGGATCGAT GAAGAACGCAGCTAGCTGCGATAAATAGTGCGAATTGCAGACACA TTGAGCACTAAAATTTCGAACGCACATTGCGCCATCGGGTTCATTC CCGTTGGCACGTCTGGCTGAGGGTAMAC 185 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long Kết blast kiểm tra định danh Kết luận: Toxocara canis Can Tho, August 22th, 2017 186 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long THÔNG TIN KẾT QUẢ ĐỊNH DANH Khách hàng: Tên mẫu: Chị Chúc Giun thực quản Phương pháp sử dụng: Khuếch đại vùng gene cytochrome c oxidase subunit (cox1) cặp mồi thiết kế: Mồi xi:5’-TCTTTGTTGGTGGAGGTGCT- 3’ Mồi ngƣợc: 5’GACCCCACACAGAAGTACCC-3’ Giải trình tự kiểm tra định danh vùng gene cox1 giun Chiều dài sản phẩm khuếch đại: 520bp Trình tự Mồi xuôi_460bp (5’-3’): TCAGGGTGGATGGACAGCCAGAGATAGCTATGGATATTATGA TTTTGGGTCTTCATACTGTGGGTATTAGTTCTTTGTTAGGGGCTATT AATTTTATGGTTACTATCCAGAATATGCGTTCTACTGCTGTAACTTT GGATCATATTAGTATATTTATTTGAACTTCTTATTTAACTTCTTTGTT GTTGGTTTTGTCTGTGCCTGTTTTGTCTGGTTCTTTGTTGTTTTTATT GTTGGATCGTAATTTTAGAACTTCTTTTTATGATTATAAGAAAGGG GGTAATCCTTTGCTTTATCAGCATTTGTTTTGGTTTTTCGGGCATCCT GAGGTTTATATTATTATTTTGCCTGCTTTTGGTATTATTAGCGAGTG TGTTTTATTTTTAACTGATAAAGAGCGTTTGCTTGGTCATACTAGGA TGATTTTTGCTTCATTTTGGATTGC TATTTTGGGTACTTC 187 luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long TIEU LUAN MOI download : skknchat@gmail.com luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long luan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.longluan.an.tien.si.nghien.cuu.dich.te.hoc.va.bien.phap.phong.tri.benh.giun.tron.duong.tieu.hoa.tren.cho.tai.mot.so.tinh.dong.bang.song.cuu.long