báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

báo cáo sinh học:" Tracking working status of HIV/AIDS-trained service providers by means of a training information monitoring system in Ethiopia" pdf

... Central Page 1 of 8 (page number not for citation purposes) Human Resources for Health Open Access Methodology Tracking working status of HIV/AIDS-trained service providers by means of a training ... With that funding, Jhpiego supports a Training Information Monitoring System, which stores training information for all HIV/AIDS training events supported...

Ngày tải lên: 18/06/2014, 17:20

8 364 0
báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

... In Health Services and Systems Program Abt Associates Inc.: Bethesda, MD; 2006. 27. Tjoa A, et al.: Expanding health training institutions in Zambia: operational scale-up plans through individual ... from a 2008 joint Ministry of Health and Clinton Foundation assess- ment of all 39 medical training institutions in Zambia. The assessment determined graduation rates to be 90...

Ngày tải lên: 18/06/2014, 17:20

10 428 0
báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

báo cáo sinh học:" Tracking and monitoring the health workforce: a new human resources information system (HRIS) in Uganda" doc

... operate and sustain the new HRIS. A Local Area Network (LAN) was installed at the UNMC and staff received training about the administration and maintenance of the upgraded ICT system. Developing ... the development, maintenance, and continued use of the HRIS software, as well as general training on data qual- ity and project management. The goal of these one-on- one and group t...

Ngày tải lên: 18/06/2014, 17:20

10 535 0
Báo cáo sinh học: " HIV-1 Vpr activates the G2 checkpoint through manipulation of the ubiquitin proteasome system" doc

Báo cáo sinh học: " HIV-1 Vpr activates the G2 checkpoint through manipulation of the ubiquitin proteasome system" doc

... inactive in checkpoint activation and has dominant-negative character. In contrast, the mutation Q65R, in the leucine-rich domain of Vpr that mediates DCAF1 binding, results in an inactive Vpr ... resuspended in normal growth medium. Abbreviations Vpr: viral protein R; ATR: ataxia telangiectasia-mutated and Rad3-related protein; DCAF: DDB1-Cul 4A- associated factor 1; DDB1 and DDB...

Ngày tải lên: 18/06/2014, 18:20

8 427 0
Báo cáo sinh học: " Porcine adenovirus type 3 E1Blarge protein downregulates the induction of IL-8" doc

Báo cáo sinh học: " Porcine adenovirus type 3 E1Blarge protein downregulates the induction of IL-8" doc

... con- taining wild-type NF-κB (shown in boldface) motif (5'- CGTAGCCATCAGTTGCAAA TCGTGGAATTTCCTCT-3') or mutant NF-κB (mutated residues underlined) motif (5'CTAGGCCATCAGTTGCAAATCGTTT AATTTAATCT) [30] ... Lamaluddin M, Yu RK, Casola A, Ogra PL, Bra- sier AR: Transcriptional activation of the interleukin-8 gene by respiratory Syncytial virus infection in alveolar epitheli...

Ngày tải lên: 18/06/2014, 18:20

8 375 0
Báo cáo sinh học: " Prostate transglutaminase (TGase-4) antagonizes the anti-tumour action of MDA-7/IL-24 in prostate cancer" potx

Báo cáo sinh học: " Prostate transglutaminase (TGase-4) antagonizes the anti-tumour action of MDA-7/IL-24 in prostate cancer" potx

... Natl Acad Sci USA 2004, 101:1554-1559. 24. Gopalan B, Litvak A, Sharma S, Mhashilkar AM, Chada S, Ramesh R: Activation of the Fas-FasL signaling pathway by MDA-7/IL-24 kills human ovarian cancer ... Grant FJ, Taylor DA, Sheppard PO, Mathewes SL, Lint W, Vanaja E, Bishop PD, O’Hara PJ: Molecular cloning and characterization of a novel transglutaminase cDNA from a human prostate cDNA...

Ngày tải lên: 18/06/2014, 19:20

9 374 0
Báo cáo sinh học: "Resveratrol prevents inflammation-dependent hepatic melanoma metastasis by inhibiting the secretion and effects of interleukin-18" potx

Báo cáo sinh học: "Resveratrol prevents inflammation-dependent hepatic melanoma metastasis by inhibiting the secretion and effects of interleukin-18" potx

... of Medicine and Dentistry, Bizkaia, Spain. 3 Pharmakine Ltd, Bizkaia Technology Park, Bizkaia, Spain. 4 CEU-San Pablo Salado et al. Journal of Translational Medicine 2011, 9:59 http://www.translational-medicine.com/content/9/1/59 Page ... interleukin-18 Clarisa Salado 1 , Elvira Olaso 2 , Natalia Gallot 3 , Maria Valcarcel 3 , Eider Egilegor 3 , Lorea Mendoza 3 and Fernando Vidal-Vanacloc...

Ngày tải lên: 18/06/2014, 19:20

11 397 0
Báo cáo sinh học: " Hepatitis B virus X protein interacts with β5 subunit of heterotrimeric guanine nucleotide binding protei" pptx

Báo cáo sinh học: " Hepatitis B virus X protein interacts with β5 subunit of heterotrimeric guanine nucleotide binding protei" pptx

... Nijhara R, Jana SS, Goswami SK, Rana A, Majumdar SS, Kumar V, Sarkar DP: Sustained activation of mitogen-activated protein kinases and activator protein 1 by the hepatitis B virus X protein in ... tyrosine kinase and the G protein cou- pled receptor signaling pathways, it is likely that HBX plays a role in bridging and activating the Src-kinase and MAPK mediated pathways at the ear...

Ngày tải lên: 19/06/2014, 08:20

8 374 0
Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

... the following PCR primer sets: 5¢-GGAGATCTCCAGTGA TATCGACCA-3¢ and 5¢-ACGGCTTCTACGGATCGAA ACT-3¢ for PPARc ,5¢-AAGACAGCTCCTCCTCGAAGG TT-3¢ and 5¢-TGACCAAATCCCCATTTACGC-3¢ for aP2, 5¢-ATCCATGGATGGACGGTAACG-3¢ ... 5¢-GCGTCGGGTAGATCCAGTT-3¢ and 5¢-CTC AGTGGGGCTTAGCTCTG-3¢ for ACC, and 5¢-AACAC CCCAGCCATGTACGTAG-3¢ and 5¢-TGTCAAAGAAA GGGTGTAAAACGC-3¢ for b-actin. Expression levels of the target...

Ngày tải lên: 16/02/2014, 09:20

10 647 0
báo cáo sinh học:" HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania" pptx

báo cáo sinh học:" HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania" pptx

... in Swahili. A qualitative software programme 'Open code' assisted in sorting, classifying and coding the data [34]. The data was analysed using content analysis according to the qualitative ... counselling including VCT [13]. In spite of policy guidelines at the international and national level, infant feeding counselling remains a major challenge and a controversial i...

Ngày tải lên: 18/06/2014, 17:20

11 540 0
Từ khóa:
w