Báo cáo hóa học: "Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control study" potx

Báo cáo hóa học: "Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control study" potx

Báo cáo hóa học: "Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control study" potx

... this article as: Takahashi et al.: Prognostic impact of clinical course- specific mRNA expression profiles in the serum of perioperative patients with esophageal cancer in the ICU: a case control ... 11 RESEARC H Open Access Prognostic impact of clinical course-specific mRNA expression profiles in the serum of perioperative pa...

Ngày tải lên: 18/06/2014, 16:20

11 747 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAG CTGC-3' MCP-5: GenBank Accessions # AC012294, NC_000077 5'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3' 5'-CAACTACAG AATCGGCGTGTGCCA-3' 5'-TCACGTG CTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3' Journal ... confirm accuracy. A mutant sequence (5'-AAGCAGATTTG GTACCCT- TAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGT GACTCAGAAA AGGACAA...

Ngày tải lên: 19/06/2014, 22:20

15 541 0
Báo cáo hóa học: " Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells" pot

Báo cáo hóa học: " Prognostic impact of ZAP-70 expression in chronic lymphocytic leukemia: mean fluorescence intensity T/B ratio versus percentage of positive cells" pot

... along with the two clinical covariates (Table 1). Notably, regarding the prognostic impact of ZAP-70 expression in the three multivariate models, the highest value of hazard ratio (HR) was associated ... (Fix&Perm kit, Caltag, Burlingame, CA) according to the manufacturer’s instructions, and finally stained with the Alexa-488- conjugated anti-ZAP- 70 mAb (clone...

Ngày tải lên: 18/06/2014, 16:20

11 688 0
Báo cáo hóa học: "Prognostic Impact of MiR-155 in Non-Small Cell Lung Cancer Evaluated by in Situ Hybridization" pot

Báo cáo hóa học: "Prognostic Impact of MiR-155 in Non-Small Cell Lung Cancer Evaluated by in Situ Hybridization" pot

... et al: Prognostic significance of differentially expressed miRNAs in esophageal cancer. Int J Cancer 2011, 128:132-43. 37. Yamanaka Y, Tagawa H, Takahashi N, et al: Aberrant overexpression of microRNAs ... adenocarcinomas (ACs), 31 large cell carcino- mas and 18 bronchioloalveolar carcinomas. Due to nodal metastasis or non-radical surgical margins, 59 (18%) patients received adju...

Ngày tải lên: 18/06/2014, 16:20

9 663 0
Báo cáo hóa học: " cDNA targets improve whole blood gene expression profiling and enhance detection of pharmocodynamic biomarkers: a quantitative platform analysis" ppt

Báo cáo hóa học: " cDNA targets improve whole blood gene expression profiling and enhance detection of pharmocodynamic biomarkers: a quantitative platform analysis" ppt

... assisted with the data analysis and participated in drafting and editing of the manuscript. SL completed the analysis of the protocol selection study, participated in the analysis of the SAHA data and ... contributed to the study design, participated in the expression profiling assays and participated in the ex vivo dosing study. DA participated in the...

Ngày tải lên: 18/06/2014, 16:20

12 585 0
báo cáo hóa học: " Reduced inflammation accompanies diminished myelin damage and repair in the NG2 null mouse spinal cord" potx

báo cáo hóa học: " Reduced inflammation accompanies diminished myelin damage and repair in the NG2 null mouse spinal cord" potx

... kkucharo@sanfordburnham.org 1 Sanford-Burnham Medical Research Institute, La Jolla, CA 92037, USA Full list of author information is available at the end of the article Kucharova et al. Journal of Neuroinflammation 2011, ... 10 sections, and all 20 values were then summed to obtain the total volume of demyelination. For animals of the same genotype and s urvival period, an a...

Ngày tải lên: 19/06/2014, 22:20

13 480 0
Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf

Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf

... pathway by a 24-AA N-terminal targeting sequence. The resulting 60-AA prohepcidin is processed further into a mature C-terminal 25-AA active peptide. The maturation is facilitated by the serine ... that obtained in the case of bacterially expressed His-tagged prohepcidin with a molecular weight of 7760.08 Da. In the latter case, two major peaks appeared in the...

Ngày tải lên: 16/03/2014, 01:20

10 678 0
Báo cáo hóa học: " Prognostic significance of Oct4 and Sox2 expression in hypopharyngeal squamous cell carcinoma''''" doc

Báo cáo hóa học: " Prognostic significance of Oct4 and Sox2 expression in hypopharyngeal squamous cell carcinoma''''" doc

... examined by immunostaining using the primary antibodies overnight at 4°C in a humidity chamber. The avidin-biotin Table 1 The expressions of Oct4 and Sox2 and their relationships with clinicopathological ... pattern and lack of obvious early symptoms, hypopharyngeal squamous cell carcinoma is a cancer with the lowest survival rates among the head and neck subsites [3...

Ngày tải lên: 18/06/2014, 16:20

7 494 0
báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc

báo cáo hóa học: " Additional impact of concomitant hypertension and osteoarthritis on quality of life among patients with type 2 diabetes in primary care in Germany – a cross-sectional survey" doc

... manuscript. All authors read an approved the final manuscript. Acknowledgements The authors are grateful to the AOK Sachsen-Anhalt and the AOK Rhein- land-Pfalz for support in sending out the study material ... quality of life within a large sample of patients with type 2 diabetes in primary care. Methods: A cross-sectional survey within a large sample (3.546) of...

Ngày tải lên: 18/06/2014, 19:20

7 459 0
báo cáo hóa học:" Bioactivity-guided identification and cell signaling technology to delineate the immunomodulatory effects of Panax ginseng on human promonocytic U937 cells" potx

báo cáo hóa học:" Bioactivity-guided identification and cell signaling technology to delineate the immunomodulatory effects of Panax ginseng on human promonocytic U937 cells" potx

... Healthcare) to detect the target proteins. Data analysis All data are presented as the mean ± standard deviation (SD) obtained from at least three separate experiments and statistically analyzed ... on the inflammatory cascade. Ginsan, a polysaccharide extract from ginseng, enhances the phago- cytic activity of macrophages in mice infected with Staphy- lococcus aureus [9]. Gin...

Ngày tải lên: 18/06/2014, 15:20

10 500 0
w