Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... Tanaka K, Kawai M, TainakaK, Imada C, Okami Y & Inamori Y (1993) Cloningand sequence of an alkaline serine protease-encodinggene from the marine bacterium Alteromonas sp. strainO-7. Gene ... of the catalytic domain are under-lined. The preregion is indicated in red, the pro-region in black, catalytic domain in blueand the C-terminal domains in violet. The assumed start of the second ... ST, Terada I, Matsuzawa H & Ohta T (1988)Nucleotide sequence of the gene for aqualysin I (a ther-mophilic alkaline serine protease) of Thermus aquaticusYT-1 and characteristics of the deduced...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding site. The ligand binding activity of ASP3c was furtherinvestigated using displacement of ASA, a fatty acid ... recombinant protein. Binding of ligands assessed by the intrinsictryptophan ﬂuorescence The recombinant protein appeared therefore quite amena-ble to ligand -binding studies, as it was chemically ... CSP.EXPERIMENTAL PROCEDURESStrains and materialsEscherichia coli strain DH 5a was used for DNA subcloningand propagation of the recombinant plasmid. Pichiapastoris strain GS115 (his4) was used in the...

Báo cáo khoa học: Characterization of a thiamin diphosphate-dependent phenylpyruvate decarboxylase from Saccharomyces cerevisiae potx

... sequence,conﬁrming that the N-terminal Met and Ala wereindeed absent. Although cleavage of the terminal Metwas not unexpected, the loss of the alanine residue wasinitially surprising. However, the literature ... alternative pathways are avail-able, it is unlikely to play any signiﬁcant role in the catabolism of the branched-chain amino acids or of methionine.Identiﬁcation and mutation of residues affectingsubstrate ... transcription of Aro80target genes [14]. Therefore, potentially, ARO10 andits associated genes may be responsible for the catabo-lism of aromatic and branched-chain amino acids, aswell as...

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC...

Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt

... NorwayHaemerythrin proteins comprise a family of O2-carrry-ing proteins mainly found in a few phyla of marine invertebrates. Members of this family differfrom haemoglobin and haemocyanin in that they ... The amino acid sequence of hemerythrin fromSiphonosoma cumanense. Protein Seq Data Anal 3,141–147.43 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain ... (http://www.fruitﬂy.org/seq_tools/promoter.html) and has a probability of 0.98 (indicated by a redarrow in A) . Enlarged (T) indicates possible transcription start. Putativeribosomal binding site is enlarged in bold. The predicted terminationloop...

Báo cáo khoa học: Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus ppt

... known as a seed albumin [5], it was named PA1b for pea albumin 1b. PA1b is the result of the post-translational cleavage of the albumin proprotein PA1, also releasing a second peptide(PA 1a) . PA1b ... binding of PA1b to a proteinaceous component of a particulate fraction of S. oryzae extracts. The binding was saturable and reversible,and the binding site exhibits a high afﬁnity for the native3741 ... Characterization of a high-afﬁnity binding site for the pea albumin 1b entomotoxin in the weevil Sitophilus Fre´de´ric Gressent, Isabelle Rahioui and Yvan Rahbe´UMR 0203 INRA/INSA de...

Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase puriﬁed from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx

... concentrations. SEM values were calculated by ﬁtting data by a weighted linear regression using the software SigmaPlotÒ. AlabNA,L-alanine-b-naphthylamide; AlapNA, L-alanine-p-nitroanilide; ArgpNA, ... BmoAAX39866 Tni APN4AAK69605 SliAAF37559 Hpu APN2AAK58066 HviAAC36148 PinAAX39865 Tni APN3AAF01259 Pxy APN3Q11000 HviAAN75694 Har APN2AAF37560 Hpu APN3AAF99701 EpoAAD31183 Ldi APN1AAL83943 ... of trophic and toxic interactionsinvolving insects, comparative structural and func-tional data on insect aminopeptidases are lacking. In aphids, APN occurs in the apical network of lamellae,...

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... pH 7.2, containing 0.1 m NaCl. The reaction was started by the addition of 0.2 lg enzyme. The initial rate was determined by measuring the increase in A 346, the isobestic point of the p-nitrophenol ... 2387 Characterization of a novel long-chain acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial ... thioesterase may be involved in thisthermal regulation, if it is able to control the ratios of saturated and unsaturated fatty acyl-CoAs in a tem-perature-dependent manner. Vmax⁄ Kmvalues for palmi-toyl-CoA...

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identiﬁcation of kinase substrates doc

... 5’-TGCCCGCGGTCATAATATCACGGACCGCAT-3’ SacII stkP deletionCAT1 5’-CGCGGATCCGAAAATTTGTTTGATTTTTAA-3’ BamHI stkP replacementCAT2 5’-GCTCTAGAAAGTACAGTCGGCATTAT-3’ XbaI stkP replacementPRTI 5’-CAATTGACCAGCCTTGAGCA-3’ ... in vitro against a synthetic substrate RRA(pT)VA. Mutations in the invariant aspartate resi-dues implicated in the metal binding completely abolished PhpP activity.Autophosphorylated form of ... expressionUFKFP 5’-CGCGAATTCCGCAAGATATCGGATTAGGAA-3’ EcoRI stkP deletionUFKRP 5’-CGCGGATCCCTTGCCGATTTGGATCATTC-3’ BamHI stkP deletionDFKFP 5’-GCTCTAGAATCTACAAACCTAAAACAAC-3’ XbaI stkP deletionDFKRP...

Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

... ourresults that argue for a membrane DPP III in insectswhen it is mainly identiﬁed as a cytosolic peptidase in mammals. Furthermore, the analysis of the orientation of the two putative transmembrane ... to a Pharmacia AKTA FPLC system(Pharmacia, Uppsala, Sweden) delivering 5 mLÆmin)1. The cartridge was then rinsed with Hepes buffer (con-taining 0.1% w/v Chaps for the solubilized sample) andproteins ... only traces of proctolin and Arg-Tyr after5 min incubation. A signiﬁcant peak of tyrosine (about15 nmol) was detected and suggested a complete and rapiddegradation of the 65–70% internalized neuropeptidedespite...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP