Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Eur J Biochem 271, 4014–4025 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04338.x Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins Alden H Warner1, Ervin Pullumbi1, Reinout Amons2 and Liqian Liu1 Department of Biological Sciences, University of Windsor, Windsor, Ontario, Canada; 2Department of Molecular Cell Biology, Sylvius Laboratory, Leiden, the Netherlands We reported previously that the major cysteine protease in embryos and larvae of the brine shrimp, Artemia franciscana, is a heterodimeric protein consisting of a catalytic subunit (28.5 kDa) with a high degree of homology with cathepsin L, and a noncatalytic subunit (31.5 kDa) of unknown function In the study reported here the noncatalytic subunit, or cathepsin L-associated protein (CLAP), was separated from cathepsin L by chromatography on Mono S and found to contain multiple isoforms with pIs ranging from 5.9 to 6.1 Heterodimeric and monomeric cathepsin L showed similar activity between pH and 6.5, while the heterodimer was about twice as active as monomeric cathepsin L below pH The heterodimer was more stable than the monomer between pH and 7.4 and at 30–50 °C Artemia CLAP and cathepsin L are present in nearly equimolar amounts at all stages in the life cycle and most abundant in encysted eggs and embyros Moreover, CLAP, either free or as a complex with cathepsin L, was resistant to hydrolysis by cathepsin L Two clones coding for CLAP were isolated from an Artemia embryo cDNA library and sequenced Both clones have nearly identical open reading frames, but show differences at the 5¢- and 3¢-termini Each cDNA clone has an extensive 3¢-untranslated region containing 70–72% A+T The deduced amino acid sequence of CLAP cDNA revealed two domains which were very similar to domains in fasciclin I and other cell adhesion proteins The nucleotide sequences of clones and have been entered into the NCBI database (AY307377 and AY462276) This study supports the view that the noncatalytic subunit of the heterodimeric cysteine protease in Artemia stabilizes cathepsin L at various pH and temperatures normally inconsistent with cathepsin L from other organisms, and that CLAP serves as a docking mechanism for cathepsin L at nonlysosomal sites in Artemia embryos Cathepsin L (CL) is a ubiquitous cysteine protease in eukaryotes and essential for development in several organisms including Xenopus laevis [1], Caenorhabditis elegans [2], and Artemia franciscana [3] Inhibition of CL activity in these organisms, or deletion of the CL gene, leads to severe abnormalities and even death Developmental events dependent on cysteine protease activity are numerous and include yolk utilization [3–5], activation of latent enzymes [6], gastrulation [1], differentiation [7–9], tissue remodelling [10], implantation [11], and molting [3,12,13] In developing embryos, cysteine proteases are often found in the cytoplasm and extracellular matrix where they may have regulatory functions, unlike in somatic cells of multicellular organisms where these enzymes are primarily lysosomal and thought to play a role in intracellular protein turnover and degradation [14,15] In mammals, cysteine proteases may function in transcription factor regulation [16], in antigen processing [17], and in several parasitic organisms cysteine proteases are considered to be virulence factors because they are secreted at the site of invasion [18,19] Over-expression and secretion of cysteine proteases is also common in various pathological conditions [20–22] In embryos and larvae of the brine shrimp, A franciscana, the major protease is a heterodimeric cathepsin L-like protease (CLP) consisting of a catalytic subunit (CL) of 28.5 kDa and noncatalytic subunit of 31.5 kDa with a total molecular mass of 60 kDa [23,24] The catalytic subunit of the complex has a high degree of homology with cathepsin L from several sources [24] The noncatalytic subunit (cathepsin L-associated protein; CLAP) has, in vitro, a high affinity for monomeric CL, and together, they form a heterodimeric protease which has been resolved into seven isoforms with pI values ranging from 4.6 to 6.2 [24] Both subunits of CLP are glycosylated; the catalytic subunit contains O-linked carbohydrates and the noncatalytic subunit contains N-linked carbohydrate [24] Cell fractionation and immunocytochemical studies of Artemia embryos and larvae indicate that about 85% of the protease is nonlysosomal with considerable antibody stain appearing at the surface of yolk platelets and in the extracellular matrix [3,25] cDNAs encoding the CL subunit of Artemia CLP have been isolated and sequenced and their amino acid Correspondence to A H Warner, Department of Biological Sciences, University of Windsor, Windsor, Ontario, N9B 3P4, Canada Fax: + 519 971 3609, E-mail: warner1@uwindsor.ca Abbreviations: CL, cathepsin L, catalytic subunit, monomer; CLP, cathepsin L-like protease, dimer; CLAP, cathepsin L-associated protein; PI-PLC, phosphatidylinositol-specific phospholipase C; GPI, glycosyl-phosphatidylinositol; CNBr, cyanogen bromide; TNBS, trinitrobenzenesulfonic acid (Received 23 April 2004, revised 19 July 2004, accepted 19 August 2004) Keywords: Artemia; cathepsin L; cell adhesion proteins; fasciclins Ó FEBS 2004 Cathepsin L and cell adhesion protein in Artemia (Eur J Biochem 271) 4015 composition deduced [24] At the amino acid level, Artemia CL has 73.9% identity with Drosophila CL and 68.7% identity with human CL Despite the high degree of similarity with Drosophila, human and other cathepsin Ls, Artemia CL appears to function as a heterodimer (i.e., CLP) of 60 kDa and not as a monomeric protein like in other eukaryotes Until now the noncatalytic subunit of CLP (i.e., CLAP) has received little attention This report focuses mainly on characterization of CLAP and its potential role in the function of CL Herein, we present evidence that CLAP enhances the stability of CL to temperatures and pH normally inconsistent with CL activity Primary sequence analysis of CLAP and cDNA clones coding for CLAP show it to be a cell adhesion protein and member of the fasciclin I family of proteins These results support the hypothesis that CL in Artemia embryos is unique and functions outside lysosomes, in the cytoplasm and extracellular matrix, unlike CL in many other higher eukaryotes Materials and methods Purification of cathepsin L-like protease The cathepsin L-like protease (CLP) in embryos of the brine shrimp, A franciscana was purified using a modification of a published method [24] Fifty grams of fully hydrated Artemia cysts were homogenized in ice-cold homogenization buffer (50 mM Tris/HCl, pH 7.2, mM KCl, mM dithiothreitol and 10 mM MgCl2) using a motorized mortar and pestle (Torsion Balance Co, Clinton, NJ, USA) Following centrifugation to remove nuclei, yolk platelets, mitochondria (10 000 g, 20 min) and ribosomes (105 000 g, 2.5 h), the soluble material was treated with solid ammonium sulfate to obtain the 35–75% ammonium sulfate insoluble material The latter was collected by centrifugation, dissolved in Buffer A [15 mM potassium phosphate, pH 6.8, 25 mM KCl and 10% (w/v) glycerol], then desalted on a column of Sephadex G-25 using Buffer A as the eluent The protease was purified to near homogeneity by sequential chromatography on DEAE–Sepharose, Concanavalin A–Sepharose, Superose 12 and Mono Q [23,24] The major isoforms of Artemia CLP that eluted from the Mono Q column were combined and concentrated to about mL using Centricon 10 filters (Amicon Canada, Oakville, ON, Canada) All chromatographic media were from Amersham Pharmacia Biotech (Baie d’Urfe, QC, Canada) Protein and protease assays The protein content of all column fractions was determined by the Bio-Rad microassay [26] or bicinchoninic acid assay [27] using BSA as the protein standard Cysteine protease activity of column fractions was determined using protamine sulfate as substrate and the trinitrobenzene sulfonic acid (TNBS) method [23] One unit of protease activity was defined as the release of micromole of amino peptide per minute from the substrate at pH 4.0 and 40 °C CL assays were carried out using a modified method of Barrett & Kirschke [28] All reaction vessels contained the following: 0.2 mM Cbz-Phe-Arg-4-methoxy-b-naphthylamide, 83 mM potassium phosphate, pH 5.0, 0.67 mM EDTA, 0.5 mM dithiothreitol, and 35–100 pmol of enzyme The reaction also contained dimethylsulfate (1.0–1.5%) in which the substrate was dissolved At the desired incubation time an aliquot of the reaction mixture was added to an equal volume of coupling buffer [5 mM mersalyl acid, 30 mM NaOH, 2% (v/v) Brij and 0.81 mM EDTA, adjusted to pH 4.0 with M HCl] to which was added an additional volume of coupling buffer containing 0.5 mgỈmL)1 Fast Garnet (Sigma, Mississauga, ON, Canada) After 15 incubation at room temperature, the complex was extracted with mL n-butanol and the color intensity determined by analysis at 520 nm The number of pmoles of cathepsin L were determined by titration of the active site with E-64 as described previously [29] The concentration of heterodimeric cathepsin L was 64–65% of that calculated from the protein concentration, while monomeric cathepsin L was 60–61% of the calculated value based on protein content Rate constants were calculated as pmol b-naphthylamine released per minute per pmol of active protease at pH 5.0 and temperature indicated Artemia p26 protein was a gift of T MacRae (Dalhousie University, Halifax, NS, Canada), while the protein artemin was prepared from Artemia cysts [30] Isoelectric focussing and sodium dodecylsulfate polyacrylamide gel electrophoresis Isoelectric focussing (IEF) was performed in glass tubes (0.5 · 12 cm) containing 6% (w/v) acrylamide, 2% (v/v) 4/6 ampholytes (Bio-Lyte; Bio-Rad, Mississauga, ON, Canada), 1% (v/v) 3/10 ampholytes (Bio-Lyte), and 12.5% (v/v) glycerol using a Haake–Buchler unit (Baxter, McGraw Park, IL, USA) The protein samples contained 10% (v/v) glycerol, 0.1% (v/v) 3/10 ampholyte, 0.002% (w/v) bromphenol blue and either CLAP or IEF standards (pI 4.45–9.6) in a final volume of 0.1 mL The top buffer (catholyte) was 100 mM NaOH and the bottom buffer (anolyte) was mM indole-acetic acid Isoelectric focussing was initiated at 350 V and 1.5 mA per gel column, and the focussing was completed by 18 h at °C The ampholytes and IEF standards were from Bio-Rad Following electrophoresis, the gels were soaked in several changes of distilled water for about 10 then stained with the Bio-Rad silver reagent as recommended by the supplier A control gel containing buffer in place of protein was washed briefly in distilled water, then 0.5 cm sections were placed in 1.0 mL distilled water for pH measurement Gels containing the IEF standards and buffer only gave identical linear responses with gel length In a separate experiment, CLAP was treated with phosphatidylinositol-specific phospholipase C (PI-PLC) (Sigma) prior to analysis by IEF to test for glycosyl-phosphatidylinositol (GPI) units in the protein [31] SDS/PAGE was performed in 12% (w/v) acrylamide gels [32] Following electrophoresis, gels were stained for h with 0.1% (v/v) Coomassie blue R-250 in 40% (v/v) methanol and 10% (v/v) acetic acid then destained overnight in 5% (v/v) methanol and 7.5% (v/v) acetic acid Acrylamide gels containing various preparations of CLP and its subunits were also stained with Pro-Q Diamond phosphoprotein stain (Molecular Probes, Eugene, OR, USA) according to the manufacturer’s instructions Ó FEBS 2004 4016 A H Warner et al (Eur J Biochem 271) Cysteine protease analysis at different stages in the Artemia life cycle Harvested organisms were reared in the laboratory to the desired stage in their life cycle [3,33] At the desired stage, intact organisms were washed with distilled water, blotted of excess water then frozen by immersion in liquid nitrogen Ovisacs from adult females containing encysted embryos or nonencysted embryos were removed with a scalpel while frozen in liquid N2 Gravid females from which the ovisacs had been removed were saved for analysis Immature, nongravid females containing no visible signs of eggs, and adult males, were collected, washed and frozen in liquid N2 All tissues were stored at ) 70 °C until needed The frozen tissues were homogenized in a buffer containing 50 mM sodium phosphate, pH 7.4, mM EDTA and 5% (w/v) SDS (at 70 °C) using small glass homogenizers The insoluble material was removed by centrifugation, and aliquots were taken for protein measurement and analysis in 7–18% SDS/PAGE gels The amounts of catalytic and noncatalytic subunits of CLP in each tissue extract were determined by densitometry as described previously [25] and from information in the Bluescript phagemid Sequencing was performed on a Visible Genetics (Suwanee, GA, USA) instrument using the Thermo Sequenase Cy5.5 Terminator Cycle Sequencing Kit (Amersham Pharmacia) Results Separation of Artemia CLP subunits by HPLC on Mono S Various fractionation methods have been attempted to separate the catalytic and noncatalytic subunits of Artemia CLP without loss of protease activity, but none has been successful except cation-exchange chromatography However, partial separation of Artemia CLP subunits was achieved by chromatography on Mono S following preincubation of the complex at pH for at least 2.5 h at 0–4 °C, including dialysis (Fig 1A) This step resulted in two, partially separated, fractions of CLAP (e and f) which could not be resolved completely by re-chromatography on Mono S (Fig 1B,C) Amino acid sequencing of CLAP and CLAP fragments Mono S purified and untreated CLAP was subjected to Edman sequencing on a Hewlett–Packard G1005A protein sequencer A cyanogen bromide (CNBr) generated peptide of CLAP of about 25 kDa was purified by SDS/ PAGE, transferred to a poly(vinylidene difluoride) membrane and sequenced by Edman degradation along with five peptides obtained by Lys-C treatment of CLAP (Eastern Quebec Peptide Sequencing Facility, Ste-Foy, QC, Canada) In addition, pool sequencing, i.e sequencing of the complete mixture of CNBr-generated peptides, was also performed Isolation and sequencing of cDNA clones encoding CLAP A cDNA library prepared from cysts of A franciscana was a gift from T MacRae (Dalhousie University, Halifax, NS, Canada) prepared originally by L Sastre (Instituto de ´ Investigaciones Biomedicas, CSIC/UAM, Madrid, Spain) The library was constructed in phage kZAP II (Stratagene, La Jolla, CA, USA) with the cDNAs were inserted between the EcoRI and XhoI sites in the multiple cloning region of the vector The phage were amplified in XL1-Blue-MRF¢ (Stratagene) then probed with a 32P-labeled 564 bp PCR product generated using primers constructed from amino acid sequence data of CLAP, and cloned into pCR2.1 (Invitrogen, Burlington, ON, Canada) Approximately · 106 plaques were screened using standard protocols [34], and six plaques, identified by hybridization to the 564 bp PCR product, were chosen for further analysis The isolated phage were converted to Bluescript phagemids using ExAssist helper phage and a protocol provided by the supplier (Stratagene) Six cDNA clones were grown overnight in the presence of ampicillin (50 lgỈmL)1) and the DNA was isolated using the Wizard Miniprep Kit (Promega, Madison, WI, USA) All clones showed identical restriction maps, and two were sequenced by cycle sequencing using primers constructed from the original 564 bp PCR product Fig Fractionation of Artemia cathepsin L subunits by HPLC on a Mono S column Prior to chromatography on Mono S  0.9 mg of purified heterodimeric Artemia cathepsin L was adjusted to pH 5.0 with M sodium acetate, pH 4, incubated for h at °C, then dialyzed against Buffer A (A) Elution profile of the Artemia cathepsin L subunits monitored at 280 nm and expressed in mV on the y axis Column fractions in the region of a–f were concentrated for protease assays and subunit analysis by SDS/PAGE (Fig 2A,B) (B,C) Fractions e and f were re-chromatographed on the Mono S column under conditions identical to those used initially Ó FEBS 2004 Cathepsin L and cell adhesion protein in Artemia (Eur J Biochem 271) 4017 A B Fig SDS/PAGE analysis of Artemia cathepsin L fractions from Mono S column (A) Approximately 4.5 lg of Mono S fractions a–f shown in Fig were applied to individual lanes of a 12% polyacrylamide gel, and following electrophoresis, the gel was stained with Coomassie blue The protease activity of fractions a–f was determined prior to electrophoresis using the TNBS assay, and the results (protease activity per mg protein) are shown in brackets below each lane The migration position of CL and CLAP, the catalytic and noncatalytic subunits, respectively, of the protease are shown on the right, while protein standards are shown on the left (B) Lanes labelled e (1.5 and 3.0 lg) and f (1.5 and 3.0 lg) show the electrophoretic position of CLAP fractions e and f, respectively, after re-chromatography on Mono S (Fig 1B,C) The (0) at the bottom shows the absence of protease activity in e and f after re-chromatography Mw, molecular mass marker The protein composition of Mono S fractions a–f were analyzed by SDS/PAGE (Fig 2) The main protein in fraction a was the catalytic subunit of 28 kDa, while peaks or areas labelled b, c and d contained both subunits Column fractions b, c and d probably represent specific undissociated isoforms of the heterodimeric CLP, as each contained both subunits of the native protease Gel lanes e and f contained mainly CLAP of molecular mass 31.5 kDa The residual protease activity in peaks e and f disappeared during re-chromatography on Mono S (Fig 2B) Treatment of an SDS/PAGE gel containing CLP and CLAP with a phosphoprotein stain did not reveal phosphate additions to these proteins Only lanes in the gel containing the known phosphoproteins ovalbumin, b-casein and pepsin gave a reaction Thus, while Artemia CLAP fractions e and f are clearly distinguishable on Mono S, they have identical molecular masses (31.5 kDa), and they are devoid of phosphate linked to Ser, Thr and Tyr Analysis of Artemia CLAP by isoelectric focussing CLAP fractions e and f (Fig 1B,C) were analyzed by IEF Fractions e and f showed three and four bands, respectively, on IEF gels with pI values ranging from 5.9 to 6.1 (Fig 3) Fig Isoelectric focusing of CLAP Twenty-five micrograms of CLAP fractions e and f (Fig 1B,C) in a volume of 100 lL were applied to the top of separate glass tubes containing 6% acrylamide as described in Materials and methods Tubes containing pI standards and column buffer only were prepared After the proteins reached their equilibrium positions, the gels containing the CLAP e, f, pI standards, and buffer only were removed from their glass tubes, soaked in distilled water for 5–10 then stained with silver reagent The pI values assigned to bands in columns e and f were determined from both IEF standards (Std) and buffer control gel run in parallel The numbers at the right represent the pI values of the major bands in e and f, while the numbers at the left are the pI values of standard proteins The arrow at the right represents the pI value of 6.84 calculated for the unmodified CLAP protein based on its deduced amino acid composition Fractions e and f have at least one unique isoform each (pI 5.9 for e and pI 6.1 for f), while two bands of pI 5.95 and pI 6.0 were common to each of the major CLAP fractions, although this does not mean that these are identical isoforms Overall, Artemia CLAP appears to contain four isoforms in nearly equal amounts, but these isoforms were not resolved by chromatography on a C-18 reverse phase column in which fractions e and f showed identical elution characteristics using acetonitrile/trifluoroacetic acid as the eluent (data not shown and [24]) Activity of dimer and monomer forms of Artemia CLP at different pH and temperatures Freshly prepared Artemia CLP (60 kDa, dimer) and CL (28.5 kDa, monomer) (Fig 1A, peak a) were assayed for CL activity in parallel reaction vessels at 30 °C and various pH (Fig 4A) The monomer showed maximum activity at pH 5.0, while the dimer showed a slightly different activity profile with the maximum around pH 4.7 The rate constants for CLP (dimer) and CL (monomer) were similar between pH 5.0 and 6.5, whereas the dimer had about 4018 A H Warner et al (Eur J Biochem 271) Ó FEBS 2004 Fig Sensitivity of various proteins to Artemia cathepsin L monomer Reaction vessels contained 50 mM sodium acetate, pH 5.0, 0.5 mM dithiothreitol, 2.4 lg of CL (monomer), and 12–14 lg of CLAP, BSA, artemin or p26 in a final volume of 40 lL After and 60 incubation at 30 °C, 10 lL were taken from each reaction vessel for analysis by SDS/PAGE on a 12% gel The numbers above each lane represent the incubation time of the monomer with proteins shown above each lane Left lane (mw) contains molecular mass standard proteins with their molecular mass (kDa) shown at the left The migration position of the Artemia cathepsin L monomer is shown at the right (ACL) Faint bands at 16–18 kDa in the 60 lanes represent CL autodegradation products observed in similar experiments using Western blotting activity were observed at all incubation temperatures between 40 and 53 °C (data not shown) Overall, the CLP complex is more stable than CL below pH 5, and between pH 6.0 and 7.4 at temperatures exceeding that found in Artemia’s natural environment [6] Resistance of CLAP to degradation by Artemia cathepsin L monomer Fig Activity of the monomeric and dimeric forms of Artemia embryo cathepsin L at different pH and temperatures (A) CLP (dimer) and CL (monomer) were assayed at different pH for cathepsin L activity (rate constants) Each reaction vessel contained 40–60 pmoles of the active protease (B) Different forms of the protease (solid bars, CLP; unfilled bars, CL) were incubated for h at 30 °C in 25 mM KCl, 10 mM sodium phosphate, 10% glycerol and 0.2 mgỈmL)1 BSA at the pH indicated, then assayed for cathepsin L activity at pH 5.0 and 30 °C and the rate constants determined The control represents CL (monomer) and CLP (dimer) maintained at °C and pH 6.8 prior to the assay (C) Incubation vessels were set up to contain 80–100 pmoles of CL (monomer) and CLP (dimer) in pH 6.8 buffer as described in (B) The vessels were incubated at 40 °C and aliquots were removed at 30 intervals, assayed for cathepsin L activity at pH 5.0, and their rate constants determined 2-fold higher activity at pH 4.3–4.7 Preincubation (1 h at 30 °C) of Artemia CL at pH 6.0 and 7.4 resulted in 85% and 95% loss of cathepsin L activity, respectively, compared to CLP which was less affected by these treatments (Fig 4B) Also, the monomer was completely inactivated after h preincubation at 40 °C and pH 6.8, whereas the dimer retained about 70% of its initial activity under these conditions (Fig 4C) Similar differences in cathepsin L Early research on the Artemia cysteine protease demonstrated that native CLP undergoes autodegradation when stored below pH irrespective of temperature [23] In the present study we tested the sensitivity of CLAP and BSA, artemin, and p26 to the Artemia CL Results showed that CLAP is resistant to hydrolysis by CL at 30 °C and pH 5.0, while BSA and two abundant proteins in Artemia embryos, artemin and p26, are degraded by Artemia CL after 60 incubation (Fig 5) Abundance of the catalytic and noncatalytic subunits of CLP at various stages in the Artemia life cycle Artemia grown in the laboratory were collected at different stages in the life cycle, and total protein isolated from different tissues or whole animals was analyzed for the catalytic and noncatalytic subunits using Western blotting after SDS/PAGE separation of the proteins Ovisacs with encysted embryos contained the largest amount of both protease subunits (about 0.15% of total protein) in nearly equimolar amounts (Fig 6) Ovisacs containing nonencysted embryos contained considerably less of the Artemia CLP subunits (0.038% of the total protein in the extract), while somatic tissues in gravid females and immature females had still smaller amounts of each subunit Ó FEBS 2004 Cathepsin L and cell adhesion protein in Artemia (Eur J Biochem 271) 4019 Fig Relative abundance of the catalytic and noncatalytic subunits of CLP at different stages in the life cycle of Artemia Protein extracts were prepared from various tissues or whole organisms at different stages in the life cycle of Artemia, then 33–135 lg were subjected to SDS/PAGE and Western blot analyses along with five different concentrations of purified Artemia cathepsin L in separate lanes The solid bars represent the noncatalytic subunit (CLAP), while the unfilled bars represent the catalytic subunit (CL) EE, ovisacs containing encysted embryos (33 lg protein); NEE, ovisacs containing nonencysted embryos (34 lg protein); GF, gravid females somatic tissue (126 lg protein); NGF, nongravid adult females (135 lg protein); M, adult males (135 lg protein) ( 0.01%) Adult males had the lowest level (< 0.01%) of CL and CLAP of any tissue tested Amino acid sequence of cathepsin L-associated protein Early attempts to sequence CLAP by Edman degradation yielded no results, suggesting that the N-terminus of the protein was blocked However, amino acid sequence was obtained from a 25 kDa fragment generated by CNBr treatment of CLAP (DNVIDHEGKFTLFAPTNEAF), and from a peptide (KSLIFSIK) generated by Lys-C treatment of CLAP More recently, we obtained the sequence EAKNLVDLAESLGLSILVKALE from Edman degradation of an untreated preparation of CLAP indicating that the N-terminus of the mature protein begins with a glutamic acid residue To obtain the full amino acid sequence of CLAP, an Artemia cDNA library in phage kZAP II was screened with a PCR derived probe and six clones potentially coding for the CLAP were isolated Following excision of Bluescript phagemid from kZAP II, two cloned cDNAs were amplified and sequenced (Fig 7) Clone contained 1888 nucleotides with two potential start codons (nucleotides 38–40 and 92–94) and an open reading frame of 996 nucleotides Clone contained 1870 nucleotides with one potential start codon (nucleotides 24–26) and an open reading frame spanning 945 nucleotides Clone differed from clone mainly in that it lacked a 68 nucleotide sequence at the 5¢ end, including sequence coding for the first 15 amino acids in clone Also, at position 568 in clone an A was substituted for a G changing the amino acid from R to K Both cDNA clones have a short 5¢ untranslated region, and extensive 3¢ untranslated regions rich in A + T, representing nearly 45% of the mature transcripts The 3¢ UTR of clones and are composed of about 72% A + T and differed from each other by 2.1% Also, clone contains seven consensus AT-rich motifs, while clone contains five AT-rich motifs Both clones contain several putative poly(A) addition signals (AAT AAA and ATTAA) The nucleotide sequences of clone and have been entered into the NCBI database with accession numbers AY307377 and AY462276, respectively Starting from the amino terminus of the mature protein (E44) (Fig 7), a calculated molecular mass of 32.3 kDa and pI of 8.0 were obtained using EXPASY (http://www expasy.org/) if the mature protein terminated at Q332 While the calculated molecular mass is close to that observed by SDS/PAGE (31.5 kDa), the pI value is distinctly different from the values (5.9–6.1) obtained by IEF for mature CLAP These observations suggested further post-translational modifications occur, leading to mature CLAP A possibility could be that the protein is also shortened at its C-terminus, which contains an excess of basic residues (Fig 7) Indeed, truncation of the C-terminus by 16–26 residues leads to a predicted IEF for CLAP which fits the observed data nicely The conclusion that part of the C-terminus is indeed missing is also supported by direct amino acid sequence analysis of CLAP being cleaved by CNBr because we could follow the sequences of all five CNBr peptides expected (not shown), beginning with E44, D70, K124, E264 and Q269, respectively The C-terminal CNBr peptide beginning with Q269 could be followed until V301 (in cycle 33), suggesting that the C-terminus of the deduced protein has been truncated at or a few residues after V301 (see below) A high stringency search of the NCBI Conserved Domain Database (http://www.ncbi.nlm.nih.gov/) revealed two domains in Artemia CLAP with a high degree of homology with fasciclin I, an extracellular protein found in numerous organisms The first Fas I domain in clone spans 128 amino acids (45–173), while the second Fas domain spans 132 amino acids (177–309) (Fig 7) Analysis of CLAP cDNA (clone 1) using EXPASY revealed potential GTP binding sites at positions 99–202 (DRAG) and 265–272 (GTTMQGKS) [35] Having recognized CLAP as a member of the fasciclin family of proteins, we were interested to know whether the protein – like many other fasciclins – has been modified C-terminally with a GPI moiety [36] The presence of such a moiety would possibly account in part for the protein’s observed heterogeneity when analyzed by IEF Moreover, the truncation of the protein chain beyond the site of GPI modification would be in line with the pool sequencing results, which suggest only a few additional residues after V301 (see above) In one experiment, treatment of CLAP (fraction f) with PI-PLC altered the band pattern on an IEF gel (data not shown) suggesting that at least one isoform terminated with a GPI unit Overall, the combined data indicate that the primary translation product (prepro-CLAP) is processed at the N-terminus between G43 and E44, and probably at the C-terminus at D306, the latter being one of the two weak sites indicated by the GPI prediction tool (Discussion) A similar result would be expected to occur during the processing of CLAP clone translation product Post-translational processing of proCLAP at both the N- and C-termini is required to achieve the properties observed for mature CLAP Ó FEBS 2004 4020 A H Warner et al (Eur J Biochem 271) CLAP_1:AATTCGGCACGAGGCAAAAACAAATAAATGCTTAATTATGTTGTATATTATTCCATTATTTCTTATTATTGGCTGCTCAAATGCCATATGGATGTTAAAT CLAP_2:AATTCGGCACGAGG GCCATATGGATGTTAAAT M L Y I I P L F L I I G C S N A I W M L N 100 32 21 CLAP_1:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC CLAP_2:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC L N A V T T E P E A K L E H A A I P I K D G E A K N L V D L A E S L 200 132 55 CLAP_1:TTGGACTGTCCATCCTTGTCAAGGCTCTTGAAGAAACTGGAATGGATAATGTGATTGATCATGAAGGTAAATTTACTTTATTTGCTCCAACTAATGAAGC CLAP_2:TTGGACTGTCCATCCTTGTCAAGGCTCTTGAAGAAACTGGAATGGATAATGTGATTGATCATGAAGGTAAATTTACTTTATTTGCTCCAACTAATGAAGC G L S I L V K A L E E T G M D N V I D H E G K F T L F A P T N E A 300 232 88 CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP_2:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT F K R I P E W A K D L P L K E V L R Y H I A R G L Y Y D K D L Q N 400 332 121 CLAP_1:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT CLAP_2:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT D M K L R T L L T K R D L R I N L Y D N G Q T I L A G G K R I N G S 500 432 155 CLAP_1:CAAATTATGAAGCTCACAATGGTGTTCTGCATCTCCTTGAAGATGTGATTGTCTCTATACCAGCACGACATGGAACAGTGATTCACCAGCTGAGAAGATG CLAP_2:CAAATTATGAAGCTCACAATGGTGTTCTGCATCTCCTTGAAGATGTGATTGTCTCTATACCAGCACGACATGGAACAGTGATTCACCAGCTGAGAAGATG N Y E A H N G V L H L L E D V I V S I P A R H G T V I H Q L R R C 600 532 188 CLAP_1:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAGAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT CLAP_2:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAAAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT P V F S D L V E L I D R A G L D E A L Q T H G P I T F F A P S N D K CLAP_1:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT CLAP_2:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT V I R K L P P D V I K H L V D D P A L L K E V L T Y H V L S G T F Y 700 632 221 CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC S P G I K D G M E G T T M Q G K S L I F S I K D G E V I I N S K T 900 832 288 800 732 255 CLAP_1:TAAGGTTACCAGTGCTGATTCCAACGCATCTAATGGTGTAATTCACAGCATTGATAATGTTCTAATTCCACCACAAATTCAAGCTAAGCTGAAGCGTCGA 1000 CLAP_2:TAAGGTTACCAGTGCTGATTCCAACGCATCTAATGGTGTAATTCACAGCATTGATAATGTTCTAATTCCACCACAAATTCAAGCTAAGCTGAAGCGTCGA 932 K V T S A D S N A S N G V I H S I D N V L I P P Q I Q A K L K R R 321 CLAP_1:ATTCTGAAGAAATCGAGAGCATTTAGCTTCCAGTAGAAAACGGTGGTTTCGTAGTGCTTTTCTTTTCCATGGGCGTGAATGTTTCTCATTTCTCTGGTGA 1100 CLAP_2:ATTCTGAAGAAATCGAGAGCATTTAGCTTCCAGTAGAAAACGGTGGTGTCGTAGTGCTTTTCTTTTCCATGGGCGTGAATGTTTCTCATTTCTCTGGTGA 1032 I L K K S R A F S F Q * 332 CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1200 1132 1300 1232 CLAP_1:TTGCTTGGGGGGAAGACTCGTTACAATTCTTTTTCTTTATTTTCTTTTTAGGTAGCTTCTTTATTTTATTTTTTT-ATCTCTTTCTTGATTTTCTTTTCT 1399 CLAP_2:TTGCTTGGGTG-AAGACTCGTTACAATTCTTTTTCTTTATTTTCTTTTTAGGTAGCTTCTTTATTTTATTTTTTTTATCTCTTTCTTGATTTTCTTTTCT 1331 * * * CLAP_1:GGCAACTTCTTTATATTTTTCTTATTTCTGTTCTTTATTTCTTTATTTTTTGAATAGTTTCTATTGCTATAGGATTAGCTTGTCTAAGTAAATTCTAAGT 1499 CLAP_2:GGCAGCTTCTTTATATTTTTCTTATTTCTGTTCTTTATTTCTTTATTTTTTGAATAGTTTCTATTGCTATAGGATTAGCTTGTCTAAGTAAATTCTAAGT 1431 * CLAP_1:TTTTTTTTTTTTTTAATCAGAAAAACACTAGATTTCGTAAGATTAATGTGGGTTTCATGAAAACCTTTTTATTGACATT-TAAATAAATTGGGTTTTGCA 1598 CLAP_2:TTTTTTTTTTTTTAAATCAGAAAAACACTAGATTTCGTAAGATTAATGTGGGTTTCATGAAAACCTTTTTATTGACATTCTAAATAAATTGGGTTTTGCA 1531 * * CLAP_1:CAAGTTTCTTGGACTTTA-GAAAAGTATGTTTAATTTTTCATAAGAATGTCTAAGGTTTCGTATTTTTTTACACAAATACTTCAACCGAGAGGATTCCAT 1697 CLAP_2:CAAGTTTCTTAGACTTTAAGAAAAGTATGTTTAATTTTTCATAAGAATGTCTAAGGTTTCGTAATTGTT-ACACAAATACTTCAATCGAGAGGACTCCGT 1630 * * * * * * * * CLAP_1:ATTAGTGCTATAGTTTGGGAAATATTTAGCCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1797 CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA(A)48 1870 Fig Nucleotide and deduced amino acid sequence of two cDNA clones coding for CLAP Clones and were found to be 95% identical except for a gap of 68 nucleotides near the 5¢-end of clone Amino acid sequences determined by Edman degradation are shown in bold, and each is a perfect match with the deduced amino acid sequence The putative start (ATG) and stop (TAG) translation sites are double-underlined Two fasciclin I-like domains are underlined, and two potential N-glycosylation sites are boxed The double-underlined and bold sequence near the 3¢-end of clones and (ATTAA) are putative poly(A) recognition sites Two potential GTP binding sites are present at 199–202 (DRAG) and 265–272 (GTTMQGKS) in clones and Putative destabilizing elements (AU/T-rich) in the 3¢ UTR are underlined The arrowheads represent putative cleavage sites in prepro-CLAP The asterisks represent sites in the noncoding region of clones and where mismatched nucleotides are present Higher order structure of CLAP The secondary structure of CLAP was predicted according to PREDICTPROTEIN available at Columbia University Bioinformatics Center (http://www.predictprotein.org/) (Fig 8) For comparison the same figure includes the secondary structure of chain A, a fasciclin I domain of Drosophila melanogaster, derived from its observed spatial structure [37] Both proteins were aligned using the CLUSTALW program; they share substantial amounts of secondary structural elements, and they are clearly related to each other regarding their amino acid sequences (Fig 9) Whether this correspondence points to similar roles in extracellular function of both proteins remains to be seen although they probably have a common evolutionary origin Discussion Previous attempts to obtain Artemia cathepsin L-associated protein (CLAP) in an undenatured form had not been Ó FEBS 2004 Cathepsin L and cell adhesion protein in Artemia (Eur J Biochem 271) 4021 Fig Structural comparisons between Drosophila fasciclin I and CLAP The amino acid sequence of Drosophila fasciclin chain A (NCBI database entry 1070), was aligned with the proposed (mature) translation product, i.e with polypeptide 44–306, of clone of CLAP using the CLUSTALW multiple alignment program The determined secondary structure (alpha helices and beta strands), as based on the spatial structure of the Drosophila protein [37], is indicated by single and double underlining, respectively The predicted secondary structure of CLAP according to PREDICTPROTEIN is presented in the same way successful [6,23,24] In the present study we found that chromatography of the CLP complex on a high performance cation matrix (Mono S) yielded both CL and CLAP in a high state of purity However, dissociation of CLP to its subunits (CL and CLAP) required incubation of CLP at pH for at least h at °C prior to chromatography on Mono S Dissociation of CLP could be blocked by inclusion of Z-Phe-Ala-CH2F, a reversible cysteine protease inhibitor, in CLP preparations, suggesting that CLAP was modified in the process of its separation from CL Attempts to recombine CL and CLAP into an active CLP complex after purification on Mono S have not been successful Thus the mechanism of CLAP binding to the catalytic subunit resulting in CL stabilization appears to be complex and not yet understood CLAP might prevent ÔunzippingÕ or destablization of the active site region of cathepsin L at higher than normal temperature and pH as suggested for cathepsin B [38] The increased stability of CL in the CLP complex is consistent with the adaptive nature of Artemia embryos which have the ability to survive harsh environmental conditions [39] Analyses of CLAP on IEF gels revealed four isoforms with pI values ranging from 5.9 to 6.1 Staining for phosphate adducts on the Artemia CLP (heterodimer) and purified CLAP were negative (data not shown) The presence of N-linked carbohydrates in CLAP demonstrated previously could generate CLAP isoforms [24], but this idea needs further experimentation Another possible reason for the isoforms is that the C-terminus of mature CLAP contains heterogeneous GPI units resulting from a posttranslational event as discussed below As demonstrated in this study the activity of CLP and CL was similar between pH and 6.5, while CLP showed about twofold greater activity below pH CLP was also more stable than CL near neutral pH and 30–40 °C Addition of purified CLAP, in equimolar amounts, to reaction mixtures containing CL did not affect the protease activity at pH 4, or Reasons for these observations are not clear, but they may be due to modifications in CLAP during incubation of CLP at pH prior to chromatography on Mono S The fact that we have not been able to achieve recombination of CL and CLAP to form the naturally occurring CLP complex in vitro is consistent with the latter observation A search of the literature has revealed that heterodimeric CLP in Artemia is functionally similar to a novel cysteine protease in Entamoeba histolytica known as adhesin [40] Adhesin is a heterodimer composed of a cathepsin L-like protease and a protein with an adherence domain containing four glycosylation sites Adhesin promotes the binding of E histolytica phagocytic trophozoites to target (host) cells such as erythrocytes, which are then consumed by phagocytosis and degraded by the associated cathepsin L Cysteine proteases such as CL are used frequently by parasitic organisms to promote invasion and destruction of target organisms [19] From a search of he Conserved Domain Database (NCBI) the similarity of the two fasciclin domains in CLAP with other fasciclin I containing proteins is clear (Fig 9) Using BLAST (http://www.ncbi.nlm.nih.gov/BLAST) to identify related proteins, a putative cell adhesion protein from the sea anemone Anthopleura elegantissima showed the highest identity with CLAP Other proteins of relevance were HLC-32, a protein secreted into the extra-embryonic matrix of sea urchins at fertilization [41], and a 30 kDa yolk granule protein in sea urchins [42] However, the sea urchin protein self-dimerizes, while CLAP, as a component of the 4022 A H Warner et al (Eur J Biochem 271) Ó FEBS 2004 β β β β Fig Comparison of the fasciclin I domains in CLAP with selected proteins in the protein database The Conserved Domain Database of NCBI was screened with the protein coding sequence of clone of CLAP and the Fas I domains in the protein compared with 10 other fasciclin I-containing proteins The most highly conserved sequences (containing more than four amino acids) are boxed, and the number below each highly conserved sequence indicates the percent identity to Artemia CLAP with the consensus sequence for each region of the fasciclin domains Because the fasciclin domains in the Conserved Domain Database are compared with only one of the four domains present in the Drosophila protein [37], its sequence 501–616 appears twice in the figure In addition, it should be noted that the alignment between Artemia and Drosophila proteins also differs from Fig 8, because, in the latter figure, a different computer program (CLUSTALW) was used Details of each sequence above can be found in the NCBI protein sequence database as follows: Art-clap1 (Artemia cathepsin L-associated protein, clone 1, AAP69998), Dros-fasI (Drosophila fasciclin I, NP_732166), Ory-big-H3 (Oryctolagus, rabbit, transforming growth factor-b induced protein precursor, Q95215), Homo-osf2 (Homo sapiens, osteoblast specific factor 2, S36111), Antho-cap (Anthopleura elegantissima putative cell adhesion protein Sym32, AAF65308), Scoel-lipo (Streptomyces coelicolor A3 putative lipoprotein, NP_624948), Rdur-osf2 (Deinococcus radiodurans osteoblast specific factor-2 related protein, NP_294122), Lyt-30kDaYP (Lytechinus variegatus 30 kDa yolk granule protein, AAG02421), Mus-tgf-bi (Mus musculus transforming growth factor-b induced protein IG-H3 precursor, Q95215), Mus-osf2 (Mus musculus osteoblast specific factor-2 pending protein, AAH31449), Smel-indpr (Sinorhizobium meliloti Nex 18 symbiotically induced conserved protein, NP_435828), and Syn-hypo-pp (Synechocystis sp hypothetical protein s111483 precursor, P74615) Ó FEBS 2004 Cathepsin L and cell adhesion protein in Artemia (Eur J Biochem 271) 4023 heterodimeric CLP at the surface of yolk platelets [3], appears to dimerize (in vivo) only with CL The function of the Fas I domains in CLAP is unknown, but generally Fas I domains are thought to represent ancient cell adhesion domains [37] Of importance to understanding the structure and function of CLAP, is that most proteins containing Fas I domains are anchored to cell membranes through a GPI unit at the C-terminus of the protein [36] Thus, while the GPI Predictor tool (http://mendel.imp univie.ac.at/sat/gpi/gpi_server.html) did not show a GPI attachment site near the C-terminus of pro-CLAP, the possibility exists that mature CLAP is terminated with a GPI unit at N299 or D306, weak sites identified by the GPI Predictor tool The observation that PI-PLC produced an altered band pattern in CLAP suggests that a GPI unit is present at the C-terminus Addition of GPI, if it occurred, would be accompanied by cleavage of the highly basic peptide chain behind the modified residue [43] Such a modification of pro-CLAP would result in a predicted molecular mass closer to that observed for mature CLAP by SDS/PAGE (31.5 kDa), and an isoelectric point in the range of values observed by IEF (pI 5.9–6.1) Processing of the pro-CLAP C-terminus is essential to lower the molecular mass and pI of the protein to values observed by SDS/ PAGE and IEF Interestingly, pool sequencing of the mixture of CNBr peptides generated from CLAP revealed in the C-terminal CNBr peptides, the presence of N299, G300, and V301 in sequence cycles 31–33, with V301 being the last visible residue of this peptide Thus, because N299 is observed in the C-terminus in an internal position, we infer that the other candidate, D306, is the target for GPI modification and site of C-terminus truncation In some systems, the addition of GPI to the C-terminus of a protein is an energy dependent process requiring ATP and/or GTP [43] The fact that CLAP contains an intrinsic ATP/GTP binding site near its C-terminus might support this type of post-translational modification The presence of GPI at the C-terminus of CLAP provides a mechanism to anchor heterodimeric CLP at various sites where it is found in embryos and newly hatched larvae [3] Previous analysis of cDNA clones coding for cathepsin L, and the sequence of clone coding for CLAP from the first AUG codon onward, indicate that the preproform of both CL and CLAP have well defined hydrophobic signals in their N-terminus (Fig 7) [24] Thus prepro-CL and prepro-CLAP probably enter the endoplasmic reticulum where post-translational modifications occur The assembly of CL and CLAP to form the heterodimer could also occur in the ER, although the bonds or motifs linking the two subunits have not been determined Modifications to the predicted amino acid sequence of prepro-CLAP, including removal of N- and C-terminal peptides, would probably be achieved along the ER/Golgi pathway Alternatively, prepro-CLAP could avoid the ER by using an alternate start codon in the mRNA (positions 92–94, clone 1), but this is unlikely as both the N- and C-termini of prepro-CLAP must undergo post-translational modifications that are normally accomplished along the ER/Golgi pathway However, translation of clone from the first start codon (positions 22–24) would result in a pro-CLAP that would avoid trafficking through the ER/Golgi complex Immunocytochemical and cell fractionation methods demonstrated that considerable amounts of CLP reside at the surface of yolk platelets in Artemia, but that the pathway that CLAP, CL or CLP takes to the surface of platelets is unknown While we can only speculate at this time about the mechanism of CLP attachment to yolk platelets, neither lysosomes nor transport vesicles are visible at the surface of mature platelets [44] However, electron microscopy has shown that yolk platelets acquire a vesiculated periphery during vitellogenesis which may represent the uptake of vesicles containing CLP derived from the ER/Golgi pathway [3,44] The fact that yolk platelets in sea urchin possess a 30 kDa fasciclin-containing protein with a high degree of homology with Artemia CLAP is noteworthy [42] Considerable CLP has been detected in extracellular regions of embryos and in tissues of larvae, especially in the developing gut [3] Transport of CLP to extracellular sites probably requires molecular signals different from those that direct transport of CLP to the surface of yolk platelets How this might occur is speculative, but it should be noted that the C-terminus of Artemia CL contains a secretion signal (ASYPLV) nearly identical to signals that promote CL secretion in mammalian tissues [24,45] and parasitic nematodes [2] Localization of CLP in the extracellular matrix could occur through the Fas I domains or putative GPI unit, if one exists in CLAP as it does in Drosophila fasciclin I and many other fasciclin-containing proteins [36,46] Fas I domains in proteins are almost always found in the extracellular compartment of tissues, where they are believed to promote intermolecular and homotypic adhesion Thus CLAP, through its Fas I domains, may promote docking and stabilization of CL at various extracellular sites The resistance of mature CLAP to destruction by CL and serine proteases appearing in third and fourth instar larvae of Artemia suggests that CLAP plays an important role in CL stability and localization outside lysosomes during embryonic and early larval development [12] Analysis of the cDNA clones coding for CLAP indicated that each clone has an extensive, but slightly different 3¢ UTRs rich in AT-residues, representing AU-rich regions in CLAP mRNA AU-rich sequences in eukaryotic mRNA are thought to represent destabilizing elements leading to rapid deadenylation and messenger breakdown [47,48] Thus, while CLAP appears to be somewhat refractory to protease degradation, its mRNAs may be degraded rapidly due to AU-rich sequences in their 3¢-UTR Preliminary evidence from our laboratory on CLAP mRNA levels in developing embryos and larvae of Artemia supports the view that CLAP mRNA is unstable during development In addition, we have observed that the 3¢ UTR of CLAP mRNA contains over 125 transcription factor binding sites as determined by the molecular tool MATINSPECTOR (http:// www.genomatrix.de/) [49] Whether these sites participate in formation of a functional promoter for transcription of the CLAP gene or in transcription regulation of downstream genes remains to be determined Finally, we have not yet investigated the potential importance of the nucleotide binding domain in CLAP, but the presence of this domain suggests an energydependent mechanism for CLP translocation to various sites in embryos and larvae or for C-terminus modification [43] Fas I containing proteins generally lack nucleotide Ó FEBS 2004 4024 A H Warner et al (Eur J Biochem 271) binding domains, so the presence of a GTP/ATP binding region in CLAP may indicate an energy dependent mechanism for pro-CLAP processing or cathepsin L docking and stabilization not found in other organisms 14 15 Acknowledgements The authors wish to thank the Natural Sciences and Engineering Research Council of Canada for their financial support of this study We also wish to thank Dr Thomas MacRae of Dalhousie University and Dr Dora Cavallo-Medved of Wayne State University for their critical reading and comments of an earlier version of this work References Miyata, S & Kubo, T (1997) Inhibition of gastrulation in Xenopus embryos by an antibody against cathepsin L-like protease Dev Growth Differ 39, 111–115 Britton, C & Murray, L (2002) A cathepsin L protease essential for Caenorhabditis elegans embryogenesis is functionally conserved in parasitic nematodes Mol Biochem Parasitol 122, 21–33 Warner, A.H., Perz, M.J., Osahan, J.K & Zielinski, B.S (1995) Potential role in development of the major cysteine protease in larvae of the brine shrimp Artemia franciscana Cell Tissue Res 282, 21–31 Fagotto, F (1990) Yolk degradation in tick eggs II Evidence that cathepsin L-like proteinase is stored as a latent, acid-activable proenzyme Arch Insect Biochem Physiol 14, 237–252 Wood, A.W & Van Der Kraat, G (2003) Yolk proteolysis in rainbow trout oocytes afterserum-free culture: evidence for a novel biochemical mechanism of atresia in oviparous vertebrates Mol Reprod Dev 65, 219–227 Warner, A.H (1987) The role of proteases and their control in Artemia development In Artemia Research & its Applications Physiology, Biochemistry, Molecular Biology (Decleir, W., Moens, L., Slegers, H., Jaspers, E & Sorgeloos, P., eds), Vol pp 203– 219 Universa Press, Wetteren, Belgium Matsumoto, I., Watanabe, H., Abe, K., Arai, S & Emori, Y (1995) A putative digestive cysteine proteinase from Drosophila melanogaster is predominantly expressed in the embryonic and larval midgut Eur J Biochem 227, 582–587 Homma, K., Kurata, S & Natori, S (1994) Purification, characterization, and cDNA cloning of procathepsin L from the culture medium of NIH-Sape-4, an embryonic cell line of Sarcophaga peregrina (flesh fly), and its involvement in the differentiation of imaginal discs J Biol Chem 269, 15258–15264 Tobin, D.J., Foitzik, K., Reinbeckel, T., Mecklenburg, L., Botchkarev, F.A., Peters, C & Paus, R (2002) The lysosomal protease cathepsin L is an important regulator of keratinocyte and melanocyte differentiation during hair follicle morphogenesis and cycling Am J Pathol 160, 1807–1821 10 Vogel, A.M & Gerster, T (1997) Expression of a zebrafish cathepsin L gene in anterior mesendoderm and hatching gland Dev Genes Evol 206, 477–479 11 Cheon, Y.P., DeMayo, F.J., Bagchi, M.K & Bagchi, I.C (2003) Induction of cytotoxic T-lymphocyte antigen-2 beta, a cysteine protease inhibitor in deciduas: a potential regulator of embryo implantation J Biol Chem 144, 5623–5630 12 Warner, A.H & Matheson, C (1998) Release of proteases from larvae of the brine shrimp Artemia franciscana and their potential role during the molting process Comp Biochem Physiol 119B, 255–263 13 Hashmi, S., Britton, C., Lie, J., Guiliano, D.B., Oksov, Y & Lustigman, S (2002) Cathepsin L is essential for embryogenesis 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 and development of Caenorhabditis elegans J.Biol Chem 277, 3477–3486 Kirschke, H (1998) Cathepsin L In Handbook of Proteolytic Enzymes (Barrett, A.J., Rawlings, N.D & Woessner, J.F., eds), pp 617–624 Academic Press, San Diego Chauhan, S.S., Popesco, N.C., Ray, D., Fleischmann, R., Gottesman, M.M & Troen, B.R (1993) Cloning, genomic organization, and chromosomal localization of human cathepsin L J Biol Chem 268, 1039–1045 Goulet, B., Baruch, A., Moon, N.-S., Poirier, M., Sansregret, L.L., Erickson, A., Bogyo, M & Nepveu, A (2004) A cathepsin L isoform that is devoid of a signal peptide localizes to the nucleus in S phase and processes the CDP/Cux transcription factor Mol Cell 14, 207–219 Lennon-Dumenil, A.M., Roberts, R.A., Valentijn, K., Driessen, C., Overkleeft, H.S., Erickson, A., Peters, P.J., Bikoff, E., Ploegh, H.L & Wolf, B.P (2001) The p41 isoform of invariant chain is a chaperone for cathepsin L EMBO 20, 4055–4064 Que, X & Reed, S.L (2000) Cysteine proteinases and the pathogenesis of amebiasis Clin Microbiol Rev 13, 196–206 Mundodi, V., Somanna, A., Farrell, P.J & Gedamu, L (2002) Genomic organization and functional expression of differentially regulated cysteine protease genes of Leishmania donovani complex Gene 282, 257–265 Deval, C., Mordier, S., Obled, C., Bechet, D., Combaret, L., Attaix, D & Ferrara, M (2001) Identification of cathepsin L as a differentially expressed message associated with skeletal muscle wasting Biochem J 360, 143–150 Bervar, A., Zajc, I., Sever, N., Katunuma, N., Sloane, B.F & Lah, T.T (2003) Invasiveness of transformed human breast epithelial cell lines is related to cathepsin B and inhibited by cysteine proteinase inhibitors Biol Chem 384, 447–455 Stypmann, J., Glaser, K., Roth, W., Tobin, D.J., Petermann, I., Matthias, R., Monnig, G., Haverkamp, W., Breithardt, G., Schmahl, W., Peters, C & Reinheckel, T (2002) Dilated cardiomyopathy in mice deficient for the lysosomal cysteine peptidase cathepsin L Proc Natl Acad Sci USA 99, 6234–6239 Warner, A.H & Shridhar, V (1985) Purification and characterization of a cytosol protease from dormant cysts of the brine shrimp Artemia J Biol Chem 260, 7008–7014 Butler, A.M., Aiton, A.L & Warner, A.H (2001) Characterization of a novel heterodimeric cathepsin 1-like protease and cDNA encoding the catalytic subunit of the protease in embryos of Artemia franciscana Biochem Cell Biol 79, 43–56 Lu, J & Warner, A.H (1991) Immunodetection of thiol proteinase levels in various populations of Artemia cysts and during development Biochem Cell Biol 69, 96–101 Bradford, M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem 72, 248–254 Smith, P.K., Krohn, R.J., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano, M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J & Klenk, D.C (1985) Measurement of protein using bicinchoninic acid Anal Biochem 150, 76–85 Barrett, A.J & Kirschke, H (1981) Cathepsin B, cathepsin H and cathepsin L Methods Enzymol 80, 535–561 Barrett, A.J., Kembhavi, A.A., Brown, M.A., Kirschke, H., Knight, C.G., Tamai, M & &Hanada, K (1982) 1-trans-Epoxysuccinyl-leucylamido (4-guanidino) butane (E-64) and its analogues as inhibitors of cysteine proteinases including cathepsins B, H and L Biochem J 201, 189–198 Warner, A.H., Brunet, R.T., MacRae, T.H & Clegg, J.S (2004) Artemin is an RNA-binding protein with high thermal stability and potential RNA chaperone activity Arch Biophys 424, 189–200 Ó FEBS 2004 Cathepsin L and cell adhesion protein in Artemia (Eur J Biochem 271) 4025 31 Takos, A.M., Dry, I.B & Soole, K.L (2000) Glycosyl-phosphatidylinositol-anchor addition signals are processed in Nicotiana tabacum Plant J 21, 43–52 32 Laemmli, U.K (1970) Cleavage of structural proteins during assembly of the head of bacteriophage T4 Nature 227, 680–685 33 Warner, A.H & McClean, D.K (1968) Studies on the biosynthesis and role of diguanosine tetraphosphate during growth and development of Artemia salina Dev Biol 18, 278–293 34 Sambrook, J., Fritsch, E.F & Maniatis, T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 35 Sprang, S.R (1997) G protein mechanisms: insights from structural analysis Annu Rev Biochem 66, 639–678 36 Wang, W.C., Zinn, K & Bjorkman, P.J (1993) Expression and structural studies of fasciclin I, an insect cell adhesion molecule J Biol Chem 268, 1448–1455 37 Clout, N.J., Tisi, D & Hohenester, E (2003) Novel fold revealed by the structure of a FAS domain pair from the insect cell adhesion molecule fasciclin I Structure 11, 197–203 38 Turk, B., Dolene, I., Zerovnik, E., Turk, D., Gubensek, F & Turk, V (1994) Human cathepsin B is a metastable enzyme stabilized by specific ionic interactions associated with the active site Biochemistry 33, 14800–14806 39 Clegg, J.S & Trotman, C.N.A (2002) Physiological and biochemical aspects of Artemia ecology In Artemia Basic and Applied Biology (Abatzopoulos, T.J., Beardmore, J.A., Clegg, J.S & Sorgeloos, P., eds), pp 129–170 Kluwer, Dordrecht, the Netherlands 40 Garcia-Rivera, G., Rodriguez, M.A., Ocadiz, R., MartinezLopez, M.C., Arroyo, R., Gonzalez-Robles, A & Orozco, E (1999) Entamoeba histolytica: a novel cysteine protease and an adhesin form the 112 kDa surface protein Mol Microbiol 33, 556–568 41 Brennan, C & Robinson, J.J (1994) Cloning and characterization of HLC-32, a 32-kDa protein component of the sea urchin extraembryonic matrix, the hyaline layer Dev Biol 165, 556–565 42 Wessel, G.M., Zaydfredim, V., Hsu, Y.I., Laidlaw, M & Brooks, J.M (2000) Direct molecular interaction of a conserved yolk granule protein in sea urchins Dev Growth Differ 42, 507–517 43 Amthauer, R., Kodukula, K., Brink, L & Udenfriend, S (1992) Phosphatidylinositol-glycan (PI-G)-anchored membrane proteins: requirement of ATP and GTP for translation-independent COOH-terminal processing Proc Natl Acad Sci USA 89, 6124–6128 44 Warner, A.H., Chu, P.P.Y., Shaw, M.F & Criel, G (2002) Yolk platelets in Artemia embryos: are they really storage sites of immature mitochondria? Comp Biochem Physiol B 132, 491–450 45 Chauhan, S.S., Ray, D., Kane, S.E., Willingham, M.C & Gottesman, M.M (1998) Involvement of carboxy-terminal amino acids in secretion of human lysosomal protease cathepsin L Biochemistry 37, 8584–8594 46 McAllister, L., Goodman, C.S & Zinn, K (1992) Dynamic expression of the cell adhesion molecule fasciclin I during embryonic development in Drosophila Development 115, 267–276 47 Chen, C.-Y.A & Shyu, A.-B (1995) AU rich elements: characterization and importance in mRNA degradation Trends Biochem Sci 20, 465–470 48 Neininger, A., Kontoyiannis, D., Kotlyarov, A., Winzen, R., Eckert, R., Volk, H.-D., Holtmann, H., Kollias, G & Gaestel, M (2002) MK2 targets AU-rich elements and regulates biosynthesis of tumor necrosis factor and interlukin-6 independently at different post-transcriptional levels J Biol Chem 277, 3065–3068 49 Quandt, K., Frech, K., Karas, H., Wingender, E & Werrner, T (1995) MatInd and MatInspector – new fast and versatile tools for detection of consensus matches in nucleotide sequence data Nucleic Acids Res 23, 4878–4884  ... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT