Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACG...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx
... 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTT GG TGAATCTT-3¢. Protein expression and purification The TIM gene carrying the mutation was expressed in E. coli AA200 ... a network of interactions involving His95, Glu97, and Arg98, which form direct contacts across the dimer interface. Database Structural data are available in the Pro...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx
... gagt … tcac ag GGATAT 1.8 3 105 CAACAG gt aata … ttcc ag ACGTAT 7.7 4 262 a TACTTG gt atgt … aatc ag GATATG 1.3 5 120 a ACAGAG gt aaaa … tctc ag AAAATT 9.9 6 138 GCATTG gt aagg … attt ag GGCAGT ... 1024 AAGGAC gt aagt … ttca ag GATTGC 0.57 11 176 AGAAGA gt aagt … ttgc ag CAATTT 4.5 12 130 ATGTTG gt gagt … tttt ag GGCATA 3.9 13 85 ACTCAA gt aagg … taat ag GATTTC 1.1 14 51 ATGTAG gt aagt …...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Mechanistic studies on bovine cytosolic 5¢-nucleotidase II, an enzyme belonging to the HAD superfamily doc
... CCAAAAATGTGCTCTCCAATA-3¢ (from b ase 1065 to base 1044); D 351N_R) 5¢-CCC AAAAA TGTGCTCTCCAATA-3¢ (from base 1065 to base 1044); D356E_R) 5¢ -A ATCTCCCCAAAAATGTGA TCT-3¢ (from base 1071 to base ... D’Ambrosio 2 , Rossana Pesi 3, *, Marcella Camici 3 , Lino Ferrara 2 and Maria Grazia Tozzi 3 1 Dipartimento di Scienze del Farmaco, Universita ` di Sassari, Italy; 2 Proteomics and Mass...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "Text Summarization Model based on Maximum Coverage Problem and its Variant" pot
... Model based on Maximum Coverage Problem and its Variant Hiroya Takamura and Manabu Okumura Precision and Intelligence Laboratory, Tokyo Institute of Technology 4259 Nagatsuta Midori-ku Yokohama, ... operation in stack de- coding pops the candidate summary with the least priority in the queue. By restricting the size of each queue to a certain constant stacksize, we...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: "Verb Classification using Distributional Similarity in Syntactic and Semantic Structures" pdf
... Sarkar, and Aravind k. Joshi. 2003. Using LTAG Based Features in Parse Reranking. In Empirical Methods for Natural Language Processing (EMNLP), pages 89–96, Sapporo, Japan. Ivan Titov and James ... Machine Learning Journal. Ryan Rifkin and Aldebaro Klautau. 2004. In defense of one-vs-all classification. Journal of Machine Learning Research, 5:101–141. Magnus Sahlgren. 2006. Th...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo khoa học: Specific TSC22 domain transcripts are hypertonically induced and alternatively spliced to protect mouse kidney cells during osmotic stress pptx
... concentra- ting mechanism and maintenance of systemic salt and water balance. Thus, renal papillary (and outer medullary) cells have special mechanisms to adapt to variable and severe hyperosmolality. ... USA) replaced the 10% fetal bovine serum. Animals and RNA isolation C57 ⁄ BL6 mice were obtained from the Jackson Laboratory (Bar Harbor, ME) and a stock maintained at...
Ngày tải lên: 30/03/2014, 10:20
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... does to cathepsin H. To illustrate this, we calculated the aver- age distances between CA atoms of the active site cys- teine and histidine residues in cathepsins B and H and the center of CA atoms ... the procathepsin structures and increases in the series of complexes with stefin A and chagasin, although it has no impact on the binding constant. Hence,...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc
... Characterization of the interaction between the plasma membrane H + -ATPase of Arabidopsis thaliana and a novel interactor (PPI1) Corrado Viotti, Laura Luoni, Piero Morandini and Maria Ida ... C-terminus of isoform 1 of the PM H + -ATPase of A. thaliana (AHA1) interacts with the first 88 amino acids of PPI1 [22], indicating that the PM H + -ATPase binding site o...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream primer (NP7: 5¢-CAATCTCCATGGCTAG TAGCTTGCACTCAG-3¢) containing a NcoI restriction site and 1 U of Pfu-polymerase. PCR amplification was carried out ... standard. Standard enzyme assay SPRK activity was routinely measured using Suc-Ala-Ala- Pro-Phe-pNA (Sigma Aldrich) as substrate. The peptidase assay was carried out in a to...
Ngày tải lên: 19/02/2014, 07:20