ngoài các phương pháp nhuộm nói trên người ta còn nhuộm gram phát hiện các vi khuẩn gram dương và gram âm
slide các nhóm máu ngoài hệ ABO
... Lịch sử phát Năm 1939, Levine Stetson phát kháng thể (KT) huyết người phụ nữ sinh bị bệnh vàng da tan máu KT làm ngưng kết 85 % hồng cầu người da trắng Kháng nguyên D: Rh(D) dương, Rh(D) âm Năm ... Tây Ban Nha Rh (D) âm (%) Rh (D) dương( %) 35 65 Da trắng 16 84 Người Mỹ da đen 93 Người gốc Mỹ 99 Người gốc Châu phi Châu 99 99 Vi t Nam, tỷ lệ người có nhóm máu Rh (D) dương chiếm đa số, ... cho người có KT miễn dịch (do truyền máu chửa đẻ), nguy tai biến xảy Hệ nhóm máu MNSs Lịch sử phát 1927, Landsteiner Levine phát KN M N 1947, Walsh Montgomery phát KN S 1951, Levine phát...
- 88
- 912
- 0
slide Các nhóm máu ngoài hệ ABO
... (do truyền máu chửa đẻ), nguy tai biến xảy Hệ nhóm máu MNSs Lịch sử phát 1927, Landsteiner Levine phát KN M N 1947, Walsh Montgomery phát KN S 1951, Levine phát KT chống KN s Sự liên hệ ... (theo Wikipedia ) Nước Rhư(D) âm (%) Rhư(D) dương( %) Tây Ban Nha 35 65 Daưtrắng 16 84 Người Mỹưdaưđen 93 Người gốcưMỹ 99 Người gốcưChâuư phi 99 Châuưá 99 Vi t Nam, tỷ lệ ngời có nhóm ... nhi Gây phản ứng tan máu muộn lâm sàng gây truyền máu không hiệu lực Hệ nhóm máu Kell Lịch sử phát Năm 1946, KN K (Kell)đợc phát Coombs, Mourant Race Năm 1949, Levine CS phát KN k (Cellano)...
- 88
- 709
- 0
Bài giảng Các nhóm máu ngoài hệ ABO
... (do truyền máu chửa đẻ), nguy tai biến xảy Hệ nhóm máu MNSs Lịch sử phát 1927, Landsteiner Levine phát KN M N 1947, Walsh Montgomery phát KN S 1951, Levine phát KT chống KN s Sự liên hệ ... (theo Wikipedia ) Nước Rhư(D) âm (%) Rhư(D) dương( %) Tây Ban Nha 35 65 Daưtrắng 16 84 Người Mỹưdaưđen 93 Người gốcưMỹ 99 Người gốcưChâuư phi 99 Châuưá 99 Vi t Nam, tỷ lệ ngời có nhóm ... nhi Gây phản ứng tan máu muộn lâm sàng gây truyền máu không hiệu lực Hệ nhóm máu Kell Lịch sử phát Năm 1946, KN K (Kell)đợc phát Coombs, Mourant Race Năm 1949, Levine CS phát KN k (Cellano)...
- 88
- 746
- 2
Báo cáo y học: " A suboptimal 5'''' splice site downstream of HIV-1 splice site A1 is required for unspliced viral mRNA accumulation and efficient virus replication" pptx
... responsive to Tat, is not dependent on Tat expression [17], therefore inferences about Tat expression from the 3'ss A1 and A2 oversplicing mutants cannot be made from these assays Viral mRNA stability ... the individual stabilities of the env, tat, rev, and nef spliced viral mRNA species upon inclusion of non-coding exon and (data not shown) Furthermore, the relative level of spliced viral mRNA ... which contains both the NEVM mutation and a previously described mutation within HIV-1 5'ss D3 that increases the affinity of 5'ss D3 with the metazoan 5'ss signal [12] The double mutation further...
- 10
- 283
- 0
Tài liệu Báo cáo khoa học: Enzymatic properties of wild-type and active site mutants of chitinase A from Vibrio carchariae, as revealed by HPLC-MS pptx
... chitinase activity only for the wild-type and for the D392N mutant, with the mutant having much less activity The E315Q and E315M mutants, by contrast, completely lacked hydrolytic activity (Fig ... take part in the catalytic process by stabilizing the transition states flanking the oxazolinium intermediate and subsequently assisting the correct orientation of the 2-acetamido group in catalysis ... sequences were 5¢-CAGCCGCCGTAGAAGTT GTAAGTCATCGCAAAG-3¢, 5¢-CGCCGCCACCAGGG AACATCCAGTCAATATCTAC-3, and 5¢-GCCGCCAC CAGGGAATTGCCAGTCAATATCTAC-3¢, respectively Confirmation of the mutated nucleotides by...
- 11
- 592
- 0
Tài liệu Báo cáo khoa học: Medium-chain dehydrogenases/reductases (MDR) Family characterizations including genome comparisons and active site modelling pdf
... eukaryotic species (Table 3), forming a family, distinguishable from the other non-zinc-containing oxidoreductases (Table 2) The human orthologue (HS ENSP 234985) may be similarly important for mitochondrial ... 237 (Mycocerosic acid synthase) Quinone oxidoreductase Quinone oxidoreductase Quinone oxidoreductase Quinone oxidoreductase (Quinone oxidoreductase) (Alcohol dehydrogenase class III) Synaptic ... [GAS]-x-N-x(2)-[DEN]-x(5)-G-x(6,19)-[PS]-x(3)-[GA]-x-[ED]-x(2)-G-x-[VIL]-x(3)-G L-x(6)-[VL]-T-Y-G-G-M-[SA]-[KR] [GA]-[VIL]-[CS]-[GN]-[STA]-D-[VILMS]-[HKP]-x(14,27)-G-H-[ED]-x(2)-G-x- [VI] -x(10,12)-G-[DEQ]-x-[IV] C-G-x-C-x(2)-D-x(17)-G-H-E...
- 10
- 316
- 0
Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf
... Waals contacts, the calculation method in [21] was used R E S U LT S The enzymatic activity and molecular stability of the mutants The catalytic activity and the molecular stability of the mutants ... kinetic constants in Table show that the Phe114 !Ile, the Tyr146 !His and the Tyr146 !His/Asn147 !Ser substitutions did not change the catalytic activity of D-chymotrypsin Molecular stability was ... inactivation rate constants were obtained from the equations found by curve fitting with the ORIGIN 5.0 software to the time dependence curves of the residual activities that were previously linearized...
- 9
- 613
- 0
Báo cáo khoa học: Low U1 snRNP dependence at the NF1 exon 29 donor splice site doc
... sitedirected mutagenesis using pGEM Hind R (5¢-aagctatttagg tgacactatagaa-3¢) as a reverse primer, and U1+4G_Bgl2F (5¢-ccaagatctcatacctacctggcag-3¢), U1+5A_Bgl2F (5¢-ccaag atctcatatttacctggcag-3¢), ... ESE examers hnRNP motifs Silencer motifs from Sironi et al ESE finder matrices SRp55 TAAGTA CAAGTA TAAGTA CTGTCTAA CTTCAGC CAGCAGA AACTTC ACTTCA CTTCAG ACTTCAGC AGTGAA CGAACA GCGAACAA GGGCAATG TGAGTC ... where, even in vivo, the expression of U1 mutants carrying more extensive U1 snRNA complementarity for the IVS29 donor site mutants than U1–IVS29 donor site wild-type complementarity are very...
- 14
- 206
- 0
Báo cáo khoa học: " Identification and antigenic site analysis of foot-and-mouth disease virus from pigs and cattle in Korea" doc
... tttgagctgcgtctgccacttga gaagggcccagggttggactc gctgcctacctccttcaa agcttgtaccagggtttggc cctggtctttccaggtctag tcaccaagctgtgtgttccat tcaacaattactacatgcagc gtgccactgtactgtgttgtagt Sense Antisense Sense Antisense ... DNASIS (Hitachi software, Japan) and MegAlign program (Dnastar, USA) The nucleotide sequences of VP1 gene for comparative analysis were obtained from the international DNA databank (Table 2) Results ... sequences of the viruses that we obtained were compared with those of viral strains from the NCBI database using the BLAST program, which revealed the identity ranged from 94.6% to 98.1% (Table 4) Analysis...
- 8
- 319
- 0
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
... infectious virus Virology 1990, 179:347-364 Mazarin V, Gourdou I, Querat G, Sauze N, Vigne R: Genetic structure and function of an early transcript of visna virus J Virol 1988, 62:4813-4818 Saltarelli ... achieved with primer 5'-TCTAAAGGATCCCCCAGCAAGCTAAGTATCAACCCCAG-3' (non CAEV sequences are shown in italic) by using the CLONTECH Transformer site-directed mutagenesis kit (mutated nt are underlined ... sitedirected mutagenesis at position 5979, upstream the env initiation codon, using the primer 5'-TGCAAATAAATGGATCCAACAAGTAGCAAAAGT-3' (nt 5968 to 6000) Mutagenic primers 5'-GGGACAGCAAGCTAAGTATCAA3'...
- 17
- 422
- 0
Báo cáo y học: "Cross-kingdom patterns of alternative splicing and splice recognition" docx
... controls (Table S1), intron and exon lengths from annotations (Table S2), and details of our analysis of functional group enrichment of RIs (Table S3) Additional data file is a spreadsheet containing ... RIs and controls Additional data file shows intron and exon length distributions for six example organisms Additional data file contains supplementary tables detailing the differences in information ... initiated and supervised the study, and revised the manuscript Additional data files The following additional data are available with the online version of this paper Additional data file is a figure...
- 19
- 317
- 0
study the substitution of fossil fuels by rdf produced from municipal solid waste of hanoi m.a thesis waste management and contaminated site treatment
... figures/ tables M aster Thesis L i s t OF TABLES Table 1: Waste composition in Hanoi in 1995 and 2003 [20] 15 Table 2: MSW eeneration and collection rate in cities/towns in Vietnam 16 Table ... 30 Table 11: Waste input com position .32 Table 12: Characteristics o f waste fraction (Vietnam based) [9 ] 35 Table 13: GW P according to IPCC [18] 36 Table 14: Stabilization ... study, waste was taken out o f bio-box when water content was stable, around weeks Stabilization time o f this study in comparison with other study is shown in table 14 Table 14: Stabilization time...
- 51
- 469
- 0
Electrical, dielectric and magnetocaloric properties of selected a and b site substituted manganites
... SYMBOLS LIST OF SYMBOLS R Resistance Resistivity ζ Conductivity T Temperature V Voltage e Electronic charge I Current X Reactance L Inductance C Capacitance Z Electrical impedance M Magnetization ... dependence of dielectric loss tangent (tan ) for (a) x = 0.3, (b) 0.5 and (c) at selected frequencies -158 Fig.4.26: Normalized dielectric loss tangent (tan/tanp) vs reduced temperature ... temperature, field-induced metamagnetic transition in the paramagnetic state, field-induced insulator to metal transition at low temperature, cluster glass state below 100 K, CMR state below 100 K, and...
- 242
- 417
- 0
Tài liệu Báo cáo khóa học: The effect of mutations surrounding and within the active site on the catalytic activity of ricin A chain pptx
... percentage Symbols indicate the experimental data, error bars represent the SD and solid lines represent bestfitted curves (A) RTA, d; RTA R213A, j, and RTA R213D, m (B) RTA, d; RTA R258A j, and RTA ... quantitative activity assays of these RTA variants, was not achieved To assess whether substitution at Asn78 with Ser changed the catalytic activity of RTA, the N-glycosidase activity of RTA N78S ... catalytic activity of RTA, the N-glycosidase activity of RTA N122A against yeast ribosomes was determined and compared to that of wild-type RTA (Fig 6A) The reduction in activity of this RTA...
- 10
- 616
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... the W121F/Y122F mutant activity may be viewed as a commitment of the tyrosine residue to support the (somewhat higher) residual activity of the W121F single mutant Pre-steady-state kinetics again ... mutants in each of the two positions, or of double mutants, was generated (Table 1) While Km values for all complexes not deviate from that of wild-type by more than a factor of 1.6, the catalytic ... methods for details electron transfer from cytochrome c to any large extent, nor is this position involved in maintaining the low residual activity when the W121 residue is mutated Double mutants in...
- 9
- 457
- 1
Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"
... cementation of the spacer into the femoral canal provides the advantage of rotational and axial stability [3] A normal cementation has the disadvantage in comparison with the partial cementation ... Kummer et al compared in vitro the mechanical properties of commercially available hip spacers containing a substantial stainless steel central core with experimental spacers containing Steinmann pins, ... inserting a metallic endoskeleton (Figure 7) into the spacer; however, literature data are scarce about this topic Schöllner et al investigated in vitro the mechanical properties of gentamicin-loaded...
- 6
- 455
- 0
Báo cáo y học: "Correlations of HBV Genotypes, Mutations Affecting HBeAg Expression and HBeAg/ anti-HBe Status in HBV Carriers"
... samples with positivity for both HBe and anti-HBe Table 5: Distribution of core promoter mutations with HBe/ anti-HBe status Core promoter mutations A1762G1764 wild-type T1762A1764 mutant Co-infections ... mean ± standard deviation HBeAg/ anti-HBe relative titer levels The relative mean titer for HBeAg was 195.9 S/ CO with standard deviation of 123.5 Categorically, for core promoter mutations status, ... codon mutants of hepatitis B virus in Vietnam J Med Virol 2004; 74(2):228-236 Kao JH, Chen PJ, Lai MY, Chen DS Clinical and virological aspects of blood donors infected with hepatitis B virus genotypes...
- 7
- 655
- 1
Tài liệu INTELLECTUAL PROPERTY SITE LICENSE AND SUPPORT AGREEMENT ppt
... indirectly, in violation of applicable laws Miscellaneous The terms Oracle Programs not include the data inputted by Licensee or generated by the Oracle Programs, and Licensee retains all rights ... DEFICIENT ORACLE PROGRAMS OR RELATED SERVICES UNDER THIS ADDENDUM IN NO EVENT SHALL MICROS’S OR ORACLE’S TOTAL LIABILITY ARISING OUT OF OR RELATED TO THIS ADDENDUM EXCEED THE TOTAL FEES PAID BY ... in the applicable program documentation upon delivery Licensee must notify MICROS promptly of any program warranty deficiency MICROS DOES NOT GUARANTEE THAT THE ORACLE PROGRAMS WILL PERFORM ERROR-FREE...
- 2
- 423
- 0
Tài liệu Fat-kids-site-and-labs pptx
... device level you are using Level devices can only talk to other nodes in the same area Level devices are required to permit a device in one area to talk to a device in another DECNET routing tables ... The routers won't know the differance ! start here ******************************** service timestamps debug uptime service timestamps log uptime no service password-encryption ! hostname R1 ! ... administrative distance, the value is Static routes are next with a default administrative distance of Normally EIGRP has an administrative distance of 90, and RIP has an administrative distance of 120...
- 474
- 353
- 0
Tài liệu LoopStar® SONET Access System Cell Site Backhaul Aggregation and Transport pdf
... LoopSta SONET OC-3/12 Radio r 800 Cell Site Tower Cell Site DS1s SONET OC-3/12 LoopSta r 800 Radio Cell Site Tower Analog/Digital Cell Site Service Flexibility The introduction of 3G data services ... LoopStar® SONET Acess System Cell Site Backhaul Aggregation and Transportation Data Network DS1 DS3 TDM Network Ethernet GPS/EDGE SONET OC-3/12 tar LoopS Moble Switching ... services while continuing to serve their existing customers In order to efficiently add transport services, a LoopStar 800 is needed that can aggregate traffic from existing DS0 DACS and provide...
- 4
- 290
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25