0

gt nhiệm vụ 3 dạy kỹ thuật chạy trên đường vòng thông qua các biện pháp sau

giao an Anh 9- PPCT 2012

giao an Anh 9- PPCT 2012

Tiếng anh

... did GV: Nguyn Vn Thng 23 Giáo án Tiếng Anh Trờng THCS Ngha bỡnh Năm học 2010 2011 3) He left London and returned to his native town in 16 13 4) He died on April 23, 16 13 IV/ I wish I had a new ... How are you today? 33 Giáo án Tiếng Anh Trờng THCS Ngha bỡnh Năm học 2010 2011 2) Checking up and warm up (05'): Questions - write down new words Answers 3) New lesson (33 '): Teachers activities ... have seen her recently 3) Peter was seen by Mai last 3) Mai saw Peter last week week 4) We didnt meet them two days ago 4) They werent met two days ago 3) New lesson (32 ): Teachers activities...
  • 113
  • 225
  • 0
22. There is only a chair ............... leg was broken. a. whose b. which c. when d. that a 23. potx

22. There is only a chair ............... leg was broken. a. whose b. which c. when d. that a 23. potx

Kỹ năng nói tiếng Anh

... a 33 Hundreds of boys have dream of evading school a escaping b avoiding c preventing d running away b 34 He was the third man was killed in this way a that b whom c whose d which a 35 You ... to open c 33 she came into home last night is still a mystery to us a How b Although c While d Since a 34 The woman was accused stealing the bag a with b to c about d of d 35 John will ... epidemic b 30 The man lives in this house works in the city a who b whom c whose d which a 31 I have no reservation in you this company a recommending b recruiting c saying d asking a 32 David,...
  • 43
  • 575
  • 0
Phonetics Choose one word whose underlined part is pronounced differently from the others. Identify your answer by circling the corresponding letter A, B, C, or D:

Phonetics Choose one word whose underlined part is pronounced differently from the others. Identify your answer by circling the corresponding letter A, B, C, or D:

Tiếng anh

... 1 23 A hour 124 A church 125 A lady 126 A fit 127 A fond 128 A some 129 A hour 130 A practice 131 A river 132 A sun 133 A paper 134 A got 135 A enjoy 136 A forests 137 A give 138 A aviation 139 ... thank 233 A smallest B best C longest D biggest 234 A coffee B spot C second D stock 235 A mountain B ground C blouse D soup 236 A bridge B white C size D nine 237 A department 238 A busy 239 A ... anh đất gầm lên khúc độc hành 35 36 37 38 39 40 A dictation A dew A asked A smells A chooses A decided B repetition B knew B helped B cuts B pauses B hatred 41 42 43 44 45 A head A blood A height...
  • 9
  • 7,727
  • 23
114_Friends- D$C6$AF$E1$BB$9AI B$C3$93NG C$C3$82Y $C3$94 M$C3$94I-NTKim Thu-3-9-11

114_Friends- D$C6$AF$E1$BB$9AI B$C3$93NG C$C3$82Y $C3$94 M$C3$94I-NTKim Thu-3-9-11

... báo tin nhà cha mẹ Cần Thơ Sau thời gian, gia đình biết anh chị di tãn định cư Florida Tôi Tố-Uyên cho biết Cho đến hôm gặp London, sau 36 năm, Thu-Thủy kễ cho biết thêm sau đến định cư Hoa Kỳ Thu-Thủy, ... yêu Thu-Thủy lên đệ nhị, sau chục năm quen thân tình bạn sinh hoạt bên gốc ô môi Sau đỗ tú tài năm 1967, anh Việt vào học Trường Võ Bị Quốc Gia Đà Lạt Còn Thu-Thủy Tố Uyên sau đỗ Tú Tài lên Sài ... đùi Mặc dầu bị thương, anh huy chiến đấu sau tạm băng vết thương, dựa lưng vào thành giao thông hào để huy Chính đêm hôm bị thương đó, anh đồng đội giao thông hào anh sống sót, hay thương tích...
  • 6
  • 429
  • 0
Tài liệu Tài liệu đào tạo môi trường (Các khoá A, B, C và D) doc

Tài liệu Tài liệu đào tạo môi trường (Các khoá A, B, C và D) doc

Điện - Điện tử

... lu vực sông Mê Công Bài - Cơ sở quan trắc môi trờng Khoá học C: Quản lý tổng hợp Tài nguyên nớc Môi trờng Bài - Sử dụng tài nguyên lu vực sông Mê Công Bài - Tổng quan nội dung quản lý tài nguyên ... đánh giá tác động môi trờng Lu vực sông Mê Công Bài - Tổng quan quy trình đánh giá tác động môi trờng Bài - Kinh tế môi trờng quy trình EIA thuật ngữ ... Danh mục tài liệu Khoá học A: Phát triển bền vững Nhận thức Môi trờng Bài - Các đặc điểm địa lý, dân c sinh thái lu vực sông Mê Công Bài - Những hoạt động thực tiễn không bền...
  • 3
  • 715
  • 0
Tài liệu B GIÁO D C & ÀO T O I H C HU KHOA Y T CÔNG C NG B môn: S c kh e môi trư ng -----&*&----- BÀI docx

Tài liệu B GIÁO D C & ÀO T O I H C HU KHOA Y T CÔNG C NG B môn: S c kh e môi trư ng -----&*&----- BÀI docx

Sức khỏe giới tính

... Ch t h u c: mg O2/L Nitrat: mg/L Cl-: mg/L N c mỏy 0, 93 v t 24,50 N c gi ng thnh ph 3, 11 0 ,30 232 .80 N c gi ng nụng thụn 1 ,37 0,20 40,00 2 .3 Mu i Natriclorua (NaCl) ... xng s ng M i quan h n i b loi M i quan h gi a cỏc cỏ th qu n th hay cỏc qu n th c a m t loi thu c v m i quan h n i b loi M i quan h ny bao g m nh ng tng tỏc dng v õm, bi u hi n quan h c nh tranh, ... cỏch m ng cụng nghi p hm l ng CO2 l 290 ppm; 1958 l 31 5 ppm; 1970 l 32 1 ppm; 1980 l 33 5 ppm 1.1.2 Chu trỡnh n c: N c ch a khớ quy n khụng l n, t c quay vũng nhanh, th i gian lu l i ng n hn so v i...
  • 194
  • 413
  • 0
Tài liệu Công Nghệ Thi Công Dầm Hộp Liên Tục B.T.C.T.D.Ư.L. Bằng Phương Pháp Đúc Hẫng ppt

Tài liệu Công Nghệ Thi Công Dầm Hộp Liên Tục B.T.C.T.D.Ư.L. Bằng Phương Pháp Đúc Hẫng ppt

Kiến trúc - Xây dựng

... long 137 0 33 5 45 45 170 270 610 170 45 33 5 45 700 30 công nghệ thi công dầm hộp btct d.-.l Hình 15 Thanh ứng suất ổn định dầm theo ph-ơng nằm ngang C L 137 0 45 33 5 108.2 27 170 27 135 34 37 Tim ... 242.5 1/2 HìNH CHIếU NGANG CầU 700/2 =35 0 29.1 30 0/2 660/2 30 0x100 450x200 125x125 30 205.9 450x200 34 5 30 0x100 31 5 187.2 30 87.5 450x200 450x200 Thanh CĐC D38 125x125 450x200 500/2 công nghệ thi ... Chân sau tỳ vào mặt dầm ray thông qua đệm gỗ cho chân chạy phía sau trạng thái tự (không tỳ vào cánh dầm ray) Sau điều chỉnh, Chân tr-ớc xe đúc phải đ-ợc gông chặt xuống mặt bê tông thông qua...
  • 44
  • 1,113
  • 15
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học

... B-cerulean-citrine-elongin C 37 .9 36 .2 52.4 44.1 38 .0 37 .5 1 .32 1 .38 0. 93 1.17 1.20 1.26 ± ± ± ± ± ± L- 62.1 63. 8 47.6 55.9 62.0 62.5 3. 54 3. 41 3. 05 3. 30 3. 23 3 .30 ± ± ± ± ± ± 0.08 0.04 0. 23 0.28 0.07 0.11 ... 34 .7 36 .5 44.8 43. 1 1 .32 1 .31 0.94 0. 93 5572 C-citrine(Y66A) C-citrine(Y66A)-elongin B C-citrine C-citrine elongin B ± ± ± ± a2 (%) 0.08 0.11 0.07 0.08 65 .3 63. 5 55.2 56.9 3. 47 3. 44 2.98 2. 83 ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT -3 and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT -3 , into the XbaI site of pBOS Vector pBOS-Myc...
  • 9
  • 420
  • 0
the genesis of east asia 221 b c - a d 907 aug 2001

the genesis of east asia 221 b c - a d 907 aug 2001

Cao đẳng - Đại học

... E PLURIBUS SERICUM T H R E E civilizing mission: conceiving east asia 30 Mission Civilisatrice 38 The Diplomatic Order 53 Back from Babel: The Kanji Sphere 60 F O U R beyond east asia: global ... korea 165 Chinese Colonies 165 Native Diversity 168 Singular Korea 1 73 E I G H T japan: insular east asia 1 83 Immigration 1 83 Becoming Japanese 194 A Separate Sun—Japan’s All-under-Heaven 201 ... Chu ci belong to “one main stream of Chinese literary evolution.” 18 The philosopher Xun Zi (31 3– 238 b.c.) famously distinguished the Chu people from those of both Yue and Xia, the latter of...
  • 345
  • 263
  • 0
b. much twice c. twice as much d. times two c 35. I’ll always remember that journey - it was an pot

b. much twice c. twice as much d. times two c 35. I’ll always remember that journey - it was an pot

Kỹ năng nói tiếng Anh

... and b are correct > a 32 Jack confessed to …………… the jewels a stealing b steal c stole d stolen a 33 My brother and I are not at all a as b like c alike d unlike >c 34 You should it right ... and saucer a wash b repair c decorate d mold > b 32 "Why have you decided to apply for another job?" "I'm tired as an accountant." a for work b to work c of working d about working c 33 That ... tailor and this skirt is too short If I were you, I should a lengthen it b have it lengthened c have lengthened it d have it lengthen b TEST 25 I Pronunciation: a mice > b a mile > c a police...
  • 43
  • 545
  • 0
b. Was c. Had d. Have b 22.

b. Was c. Had d. Have b 22. "Did Susan use to be your next-door neighbor?" "Yes, but I potx

Kỹ năng nói tiếng Anh

... is too b 32 If you burn the garbage, it will give off odor a poisonous b dirty c pleasant d awful a 33 He telephoned while I dinner a am having b had c have had d was having d 34 My parents ... be c to being d or be c 32 We don't know the ……… of the game a facts b customs c rules d laws c 33 Yoko borrowed 20,000 dollars the bank a of b by c at d from d 34 We had to use our neighbour's ... he read d 36 I a great fortune from my grandparents a offered b had c inherited d got up c 37 Last night, five thousand pounds stolen in the robbery a is b are c was d were c 38 I know...
  • 43
  • 734
  • 1
30. This .................. for his behavior. a. amounts b. accounts c. arrives d. approaches b pot

30. This .................. for his behavior. a. amounts b. accounts c. arrives d. approaches b pot

Kỹ năng nói tiếng Anh

... stare d peer c 30 I wish to buy of the same a qualities b sums c packages d quantities d 31 This sight me of my childhood a excuses b reminds c forgets d remembers b 32 The price of foodstuff ... 30 I think John and Henry should an argument a settle b sort c arrange d choose a 31 I ordered him it again a don’t b not c didn’t d not to d 32 There's a flight to the island at 7 .30 ... be living d being living c 32 "Is this her hometown?" "No She’s only lived here " a a few years ago b for a few years c since a few years d by a few years b 33 She would be happy if we ...
  • 43
  • 378
  • 0
a. annoying b. arguing c. discussing d. shouting b 22. A good clock always keeps ...………. ppt

a. annoying b. arguing c. discussing d. shouting b 22. A good clock always keeps ...………. ppt

Kỹ năng nói tiếng Anh

... be c to being d or be c 32 We don't know the ……… of the game a facts b customs c rules d laws c 33 Yoko borrowed 20,000 dollars the bank a of b by c at d from d 34 We had to use our neighbour's ... d reception d 32 is your dress, the red one or the green one? a Which b What c How d Who a 33 I have to leave before seven and so a leave you b you have c you d you d 34 He has the ... d too a 37 I’ve got a very interesting as a journalist a occupation b occupy c occupant d occupied a 38 The man to the woman is talking is funny a who b whom c whose d which b 39 Some medicine...
  • 43
  • 716
  • 0

Xem thêm