Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique Koshi Kinoshita 1, *, Kenji Goryo 1, *, Mamiko Takada 2 , Yosuke Tomokuni 1 , Teijiro Aso 3 , Heiwa Okuda 4 , Taro Shuin 4 , Hiroshi Fukumura 2 and Kazuhiro Sogawa 1 1 Department of Biomolecular Sciences, Graduate School of Life Sciences, Tohoku University, Aoba-ku Sendai, Japan 2 Department of Chemistry, Graduate School of Science, Tohoku University, Aoba-ku Sendai, Japan 3 Department of Functional Genomics, Kochi Medical School, Kohasu, Okoh-cho, Nankoku Kochi, Japan 4 Department of Urology, Kochi Medical School, Kohasu, Okoh-cho, Nankoku Kochi, Japan The von Hippel–Lindau (VHL) gene is located on the short arm of chromosome 3 and its deletions or muta- tions are associated with VHL disease [1,2]. Affected individuals develop a variety of tumors, including retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas and pheochromocytomas. Biallelic VHL gene defects are also found in sporadic malignancies, such as renal cell carcinomas and hemangioblastomas [3,4]. The VHL gene product exists in two forms, a larger p30 protein (pVHL30) and a smaller p19 protein (pVHL19), the latter generated by internal translation initiation at the Keywords conformation change; FRET–FLIM; live cell imaging; protein complex; ubiquitin ligase Correspondence K. Sogawa, Department of Biomolecular Science, Graduate School of Life Sciences, Tohoku University, Aoba-ku Sendai 980-8578 Japan Fax: +81 22 795 6594 Tel: +81 22 795 6590 E-mail: sogawa@mail.tains.tohoku.ac.jp *These authors contributed equally to this work (Received 26 June 2007, revised 21 August 2007, accepted 29 August 2007) doi:10.1111/j.1742-4658.2007.06075.x The tumor suppressor von Hippel–Lindau (VHL) gene product forms a com- plex with elongin B and elongin C, and acts as a recognition subunit of a ubiquitin E3 ligase. Interactions between components in the complex were investigated in living cells by fluorescence resonance energy transfer (FRET)–fluorescence lifetime imaging microscopy (FLIM). Elongin B–ceru- lean or cerulean–elongin B was coexpressed with elongin C-citrine or citrine- elongin C in CHO-K1 cells. FRET signals were examined by measuring a change in the fluorescence lifetime of donors and by monitoring a corre- sponding fluorescence rise of acceptors. Clear FRET signals between elon- gin B and elongin C were observed in all combinations, except for the combination of elongin B-cerulean and citrine-elongin C. Although similar experiments to examine interaction between pVHL30 and elongin C linked to cerulean or citrine were performed, FRET signals were rarely observed among all the combinations. However, the signal was greatly increased by coexpression of elongin B. These results, together with results of coimmuno- precipitation experiment using pVHL, elongin C and elongin B, suggest that a conformational change of elongin C and ⁄ or pVHL was induced by binding of elongin B. The conformational change of elongin C was investigated by measuring changes in the intramolecular FRET signal of elongin C linked to cerulean and citrine at its N- and C-terminus, respectively. A strong FRET signal was observed in the absence of elongin B, and this signal was modestly increased by coexpression of elongin B, demonstrating that a conformation change of elongin C was induced by the binding of elongin B. Abbreviations FLIM, fluorescence lifetime imaging microscopy; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; VHL, von Hippel–Lindau. FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS 5567 second methionine [5,6]. Both pVHL proteins are asso- ciated with two ubiquitous proteins, elongin B and elongin C, to form a ternary complex (hereafter referred to as the VBC complex), and its formation is required for tumor suppressor functions. Elongin B and elongin C were initially found together with elongin A in the elongin (SIII) complex that increases the efficiency of elongation by RNA polymerase II [7,8]. Biochemical analysis of the com- plex revealed that elongin A functions as a trans- criptionally active subunit whereas elongin B and elongin C act as regulatory subunits. Elongin B and elongin C bind stably to each other (elongin BC com- plex), and elongin A has the ability to bind to elon- gin C but cannot bind directly to elongin B. Elongin B has a ubiquitin homology domain, whereas elongin C contains homology to Skp1, a subunit of Skp1-Cul1-F box ubiquitin ligases. The ubiquitin-like domain of elongin B was found to be necessary for binding to elongin C [9]. pVHL shares a common binding site with elongin A on elongin C, and no direct interaction occurs between pVHL and elongin B. Thus, interaction of elongin BC with elongin A and pVHL is mutually exclusive. The elongin BC complex interacts not only with elongin A and pVHL, but also with SOCS-box proteins with a conserved BC-box motif located in the SOCS-box [10]. Mutations of pVHL that inactivate binding to elongin C result in the development of malignant tumors. For formation of the VBC complex, it has been elucidated that cooperation of the HSP70 and TRiC ⁄ CCT chaperone systems is required [11,12]. The VBC complex further associates with cullin-2 and a ring-finger protein, Rbx1, to form a larger ubiquitin- ligase complex, and pVHL acts as the substrate- binding subunit in the E3 ubiquitin ligase. Hypoxia activated transcription factors, HIF-1a, HLF (HIF-2a, EPAS-1) and HIF-3a, are known substrates for ubiqu- itin ligase [13–16]. Oxygen-dependent hydroxylation of specific proline residues in the oxygen-dependent deg- radation domain of the factors are recognized by the pVHL in the E3 ligase and subsequent ubiquitination of the factors results in degradation by proteasomes. Lowered oxygen levels in hypoxia down-regulate prolyl hydroxylation and increase stabilization of the factors. Degradation of the factors in normoxia and their sta- bilization in hypoxia comprise the pivotal mechanism for cellular hypoxic responses such as the promotion of glycolysis and vascularization [17,18]. Fluorescence lifetime imaging microscopy (FLIM) is a recently developed technique that can be applied to measure fluorescence lifetimes of fluorescent proteins such as green fluorescent protein (GFP) in living cells. When combined with fluorescence resonance energy transfer (FRET), this measurement presents unambigu- ous evidence for spatial and temporal interactions between proteins and conformational changes of pro- teins occurring in living cells. The occurrence of FRET can be accurately and finely determined by measuring the reduced fluorescence lifetime of donor proteins in the presence of acceptors. Because fluorescence lifetime is, in principle, unaffected by changes in probe concen- tration or excitation intensity, FRET–FLIM has advantages over intensity-based FRET techniques. In particular, FRET–FLIM has advantages in intermole- cular FRET measurement in which expression levels of the two fluorescent proteins cannot be easily controlled in individual cells [19–21]. In the present study, we monitored the fluorescence rise of acceptor fluorescent proteins as distinctive evi- dence for the occurrence of FRET in addition to the decreased fluorescence lifetimes of donor proteins using time-domain FLIM. Using the FRET–FLIM technique, we observed strong intermolecular FRET signals between elongin B and elongin C. For stable binding of pVHL30 to elongin C, we found that the coexistence of elongin B is necessary to induce a con- formational change of elongin C. Results Imaging of interaction between elongin B and elongin C As shown in Fig. 1A, cerulean-elongin B and elon- gin B-cerulean were expressed throughout cells, and citrine-elongin C and elongin C-citrine were similarly expressed in the cells. As a first step to examine interac- tion between elongin B and elongin C by FRET–FLIM, the fluorescence lifetime of cerulean-elongin B and elongin B-cerulean, which were separately expressed in CHO-K1 cells, was determined, using a subnanosecond 410 nm light-emitting diode and a time- and space- correlated single photon counting detector on a FLIM microscope. A representative FLIM image of cells expressing cerulean-elongin B is shown in Fig. 1B. Its lifetime was fairly constant throughout the cells, and similar lifetimes were observed in different cells expressing the fluorescent protein (Fig. 1B). Fig- ure 1C,D shows a fluorescence decay curve of ceru- lean-elongin B, which was further analyzed by following a two-component model. Two lifetimes, 1.32 ns and 3.54 ns, were calculated from the curve with ratio coefficients of 37.9% and 62.1%, respec- tively (Table 1). The decay curve of elongin B-cerulean was similarly analyzed as shown in Fig. 1E,F, and the lifetimes, 1.38 ns and 3.41 ns, were almost identical to FRET imaging of the VBC complex K. Kinoshita et al. 5568 FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS those of cerulean-elongin B (Table 1). The v 2 values of the fit were between 1.0 and 1.3 and between 1.0 and 1.2, respectively, indicating that the overall model fit- ting was statistically significant. The decays were also analyzed according to a three-exponential model as reported by Millington et al. [22], resulting in only a modest improvement of fit as judged from v 2 values; the values were reduced by approximately 4% or less by the three-exponential fitting. Next, we coexpressed acceptor fluorescent proteins together with donor fluorescent proteins in the follow- ing four combinations: cerulean-elongin B and citrine- elongin C; cerulean-elongin B and elongin C-citrine; elongin B-cerulean and elongin C-citrine; and elon- gin B-cerulean and citrine-elongin C. Transfected cells with coexpression of moderate amounts of two fluo- rescent proteins, cerulean-elongin B and citrine- elongin C, were randomly chosen for measuring fluorescence decay of the two proteins. As shown in Fig. 1C, decay of fluorescence of cerulean-elongin B in the presence of coexpressed citrine-elongin C was sig- nificantly faster than that of separately expressed ceru- lean-elongin B. The two lifetimes of donor, s 1 and s 2 , were decreased to 0.93 ns and 3.05 ns, respectively, in the presence of the acceptor (Table 1), indicating trans- fer of energy between the two fluorescent proteins. This decrease in the fluorescence lifetime of donors was clearly observed when their FLIM images were compared (Fig. 1B). The FLIM image of cerulean- elongin B in the presence of citrine-elongin C suggests that the interaction between the two fluorescent pro- teins homogeneously occurred in the cells. The 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns Cit Cit 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns Cit 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns 550-600nm 450-500nm 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns Ceru 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns 0.01 0 1 0.1 Intensity/a.u. 2 4 6 810 12 14 Time/ns Ceru-EloB Ceru-EloB + Cit-EloC Ceru-EloB + Cit-EloC Cit-EloC Ceru-EloB Ceru-EloB + EloC-Cit EloC-Cit Ceru-EloB + EloC-Cit EloB-Ceru EloC-Cit EloB-Ceru + EloC-Cit EloB-Ceru + EloC-Cit EloB-Ceru Cit-EloC + Cit-EloC EloB-Ceru + Cit-EloC EloB-Ceru 2.0 2.5 3.0 3.5 4.0 ns)( 2.0 2.5 3.0 3.5 4.0 (ns) Ceru-EloB Ceru-EloB + Cit-EloC Ceru-EloB Cit-EloCEloB-Ceru EloC-Cit mock Ceru-EloB EloB-Ceru Cit-EloC EloC-Cit A C D E F B Fig. 1. FLIM analysis of interaction between elongin B and elon- gin C in CHO-K1 cells. (A) Cellular localization of elongin B linked to cerulean and elongin C linked to citrine. Chimeric proteins, ceru- lean-elongin B (Ceru-EloB), elongin B-cerulean (EloB-Ceru), citrine- elongin C (Cit-EloC) and elongin C-citrine (EloC-Cit) were transiently expressed in CHO-K1 cells by DNA transfection using the lipofec- tion method. Forty hours after transfection, fluorescence of ceru- lean and citrine moieties of the chimeric proteins was observed with an Olympus BX50 fluorescent microscope with a filter set (Olympus U-MCFPHQ and U-MYFPHQ). Scale bar ¼ 20 lm. A typi- cal result of immunoblot analysis of whole cell extracts of cells expressing cerulean-linked elongin B or citrine-linked elongin C was shown using anti-GFP serum, as shown below. Lane 1, mock; lane 2, cerulean-elongin B; lane 3, elongin B-cerulean; lane 4, citrine-elongin C; lane 5, elongin C-citrine. (B) FLIM image of ceru- lean-elongin B in the presence or absence of citrine-elongin C. A lifetime map was made from time- and space-correlated single pho- ton counting data by fitting data to a single exponential decay. In the FLIM map, color corresponds to the fluorescence lifetime indi- cated by a false color scale. (C–F) CHO-K1 cells were transfected with plasmids encoding: (C) cerulean-elongin B and elongin C- citrine; (D) elongin B-cerulean and elongin C-citrine; (E) cerulean- elongin B and citrine-elongin C; and (F) elongin B-cerulean and citrine-elongin C. The fluorescence decay curve of cerulean (shown in blue) and citrine (shown in green) represents an average of fluo- rescence decay data obtained from cells observed. For comparison, the decay curve of cerulean-linked elongin B without acceptor (shown in black) or the decay curve of citrine-linked elongin C with- out donor (shown in black) are also shown. K. Kinoshita et al. FRET imaging of the VBC complex FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS 5569 fluorescence decay curve of citrine-elongin C coex- pressed with cerulean-elongin B was also obtained as shown in Fig. 1C. When its decay curve was compared with that of citrine-elongin C, a clear fluorescence rise in the curve was observed. A similar level of FRET sig- nals could be detected in the combination of cerulean- elongin B and elongin C-citrine, as shown in Fig. 1D and Table 1. FRET between elongin B-cerulean and elongin C-citrine was weak (Fig. 1E), and FRET sig- nals were very weak for the combination of elongin B- cerulean and citrine-elongin C (Fig. 1F and Table 1). Interaction between elongin C and pVHL30 A chimeric fluorescent protein, pVHL30-cerulean, was expressed in CHO-K1 cells by DNA transfection. As shown in Fig. 2A, it was distributed throughout the cells with stronger expression in the cytoplasm. By western blotting analysis, it was found that a small amount of pVHL19-cerulean was also expressed. Life- times were determined on the FLIM microscope as shown in Table 2. We constructed a plasmid only for expression of pVHL19-cerulean, introduced it into the Table 1. Fluorescence decay data for cerulean-linked elongin B and citrine-linked elongin C expressed in living CHO-K1 cells. Data are derived from whole cell regions of interest and are expressed as mean ± SD. a 1 and a 2 are the exponential coefficients (%) for the s 1 and s 2 decay times, respectively. n, number of cells examined. Combination of protein a 1 (%) s 1 (ns) a 2 (%) s 2 (ns) n v 2 Cerulean-elongin B 37.9 1.32 ± 0.06 62.1 3.54 ± 0.08 10 1.0–1.3 Elongin B-cerulean 36.2 1.38 ± 0.05 63.8 3.41 ± 0.04 8 1.0–1.2 Cerulean-elongin B-citrine-elongin C 52.4 0.93 ± 0.20 47.6 3.05 ± 0.23 8 1.0–1.3 Cerulean-elongin B-elongin C-citrine 44.1 1.17 ± 0.06 55.9 3.30 ± 0.28 12 1.0–1.8 Elongin B-cerulean-elongin C-citrine 38.0 1.20 ± 0.07 62.0 3.23 ± 0.07 10 1.0–1.4 Elongin B-cerulean-citrine-elongin C 37.5 1.26 ± 0.10 62.5 3.30 ± 0.11 10 1.0–1.3 pVHL-Ceru mock pVHL-Ceru 0.01 1 0.1 Intensity/a.u. 024 68101214 Time/ns ` Ceru Cit 450-500nm 550-600nm 0.01 1 0.1 Intensity/a.u. 02468101214 Time/ns 0.01 1 0.1 Intensity/a.u. 02468101214 Time/ns 0.01 1 0.1 Intensity/a.u. 02468101214 Time/ns HA-pVHL FLAG-EloC Myc-EloB - - - - + - + + - - + + + + + WB : anti-FLAG WB : anti-Myc WB : anti-FLAG WB : anti-HA pVHL Elongin C Elongin B Elongin C pVHL Elongin B WB : anti-HA WB : anti-Myc IP : anti-FLAG Input pVHL-Ceru pVHL-Ceru + Cit-EloC Cit-EloC pVHL-Ceru + Cit-EloC Cit-EloC pVHL-Ceru + Cit-EloC + EloB pVHL-Ceru + Cit-EloC + EloB pVHL-Ceru A B C D Fig. 2. Interaction between pVHL and elongin C induced by elon- gin B. (A) Cellular localization of pVHL linked to cerulean. A chime- ric protein, pVHL-cerulean (pVHL-Ceru), was transiently expressed in CHO-K1 cells by DNA transfection using the lipofection method. Forty hours after transfection, fluorescence of cerulean moiety of the chimeric proteins was observed with an Olympus BX50 fluores- cent microscope with a filter set (Olympus U-MCFPHQ). Scale bar ¼ 20 lm. A typical result of western blotting for expressed pro- teins of pVHL-cerulean is shown on the right. CHO-K1 cells were transfected with plasmids encoding (B) pVHL-cerulean and citrine- elongin C and (C) pVHL-cerulean and citrine-elongin C coexpressed with elongin B. The fluorescence decay curve of cerulean (shown in blue) and citrine (shown in green) represents an average of fluo- rescence decay data obtained from cells observed. For comparison, the decay curve of pVHL-cerulean without acceptor protein (shown in black) or the decay curve of citrine-linked elongin C without donor protein (shown in black) are also shown. (D) Coimmunopre- cipitation analysis of pVHL, elongin B and elongin C. HA-pVHL, myc-elongin B and Flag-elongin C were expressed in CHO-K1 cells. Whole cell extracts were treated with anti-Flag serum. Co-precipi- tated proteins were visualized with anti-HA, anti-Flag or anti-myc sera after electrophoresis and subsequent electroblotting to a nitro- cellulose membrane; 5% input is shown. FRET imaging of the VBC complex K. Kinoshita et al. 5570 FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS cells and measured lifetimes of expressed pVHL19- cerulean. Almost identical lifetimes to those of pVHL30-cerulean were obtained (data not shown). When an acceptor chimeric protein, citrine-elongin C was coexpressed with pVHL30-cerulean, the lifetimes of cerulean moiety showed only a minimal decrease (Fig. 2B and Table 2). We expressed donor and accep- tor proteins in the pairs pVHL30-cerulean and elon- gin C-citrine, cerulean-pVHL30 and citrine-elongin C, and cerulean-pVHL30 and elongin C-citrine, and determined lifetimes of donors. Non-existent or negli- gible FRET signals were observed similar to the pair of pVHL30-cerulean and citrine-elongin C (data not shown). These results suggest two possibilities; one is that interaction between pVHL30 and elongin C rarely occurs in the cells, and the other is that interaction occurs when the fluorophores are separated by more than 10 nm. We expressed elongin B together with pVHL30-cerulean and citrine-elongin C, and the inter- action between pVHL30 and elongin C was investi- gated by FRET–FLIM. As shown in Fig. 2C and Table 2, clear FRET signals, decrease in lifetimes of pVHL30-cerulean and fluorescence rise in the decay curve of acceptors, could be detected, only when elon- gin B was coexpressed. To examine the interaction between pVHL and elongin C, a coimmunoprecipita- tion experiment was performed. As shown in Fig. 2D, an interaction between elongin C and VHL30 existed in the absence of elongin B, and considerable stabiliza- tion of pVHL and elongin C was observed with the coexistence of elongin B. Taken together, these results indicate that distance between donor and acceptor in the pair of pVHL30- cerulean and citrine-elongin C is so separated that energy transfer was below the detection level. Conformational change of elongin C induced by binding of elongin B Increased FRET signals between pVHL-cerulean and citrine-elongin C by coexpression of elongin B suggest that a conformation change of elongin C induced by binding of elongin B may occur and that this confor- mational change of elongin C leads to stabilization of elongin C and pVHL. To visualize the conformational change in living cells, intramolecular FRET measure- ment using a chimeric protein of cerulean-elongin C- citrine was carried out in the presence or absence of elongin B. Without the coexistence of elongin B, a con- siderable decrease in donor fluorescence lifetime was observed (Fig. 3B and Table 3) compared to that of cerulean-elongin C-citrine(Y66A) in that fluorophore formation in the citrine moiety was abolished by the mutation of Tyr66 to Ala (Fig. 3A). A decrease in the lifetimes was further augmented by the coexpression of elongin B as shown in Fig. 3D and Table 3. This decrease was modest but reproducible in three indepen- dent experiments. Coimmunoprecipitation experiments indicated that the presence of fluorescent proteins at N- and C-terminal ends of elongin C did not affect the binding of elongin B to elongin C moiety (Fig. 3C). Discussion We used cerulean as the FRET donor because the flu- orescence lifetime of this protein is reported to be the best fit by a single exponential [23], which greatly sim- plifies quantitative analysis of FRET data compared to donors with a double exponential decay. However, our results clearly demonstrated that the decay curve of cerulean is the best fit by a double exponential such as CFP. This finding agrees with the results of Millington et al. [22]. Two fluorescent lifetimes of cerulean and their fraction ratios displayed in the literature are simi- lar to those obtained in the present study. Despite the complex decay profiles, cerulean was useful as a FRET donor because it shows a higher quantum yield and extinction coefficient than other donors like CFP. In addition to analysis of the decay curve of donors, we examined the decay of acceptors, and found a fluores- cence rise in the curve that inevitably results from energy transfer as shown in Figs 1–3. Simultaneous determinations of the two FRET indicators clearly demonstrate the occurrence of FRET and minimize risk due to interference from sample autofluorescence. It is also reported that reduced lifetimes of donors can occur by the strong illumination from a mercury lamp [24,25]. Excitation levels at the sample surface under Table 2. Fluorescence decay data for cerulean-linked pVHL30 and citrine-linked elongin C. Data are derived from whole cell regions of inter- est and are expressed as mean ± SD. a 1 and a 2 are the exponential coefficients (%) for the s 1 and s 2 decay times, respectively. n, number of cells examined. Combination of protein a 1 (%) s 1 (ns) a 2 (%) s 2 (ns) n v 2 VHL-cerulean 39.0 1.26 ± 0.06 61.0 3.40 ± 0.07 8 1.0–1.2 VHL-cerulean-citrine-elongin C 43.5 1.23 ± 0.13 56.5 3.38 ± 0.18 10 1.0–1.2 VHL-cerulean-citrine-elongin C-elongin B 51.4 1.05 ± 0.05 48.6 3.18 ± 0.20 10 1.0–1.2 K. Kinoshita et al. FRET imaging of the VBC complex FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS 5571 the FLIM microscope used in the present study were very low (approximately 15 mWÆcm )2 ) so that no pho- todynamic reactions took place. FRET signals between cerulean-linked elongin B and citrine-linked elongin C can be detected in the fol- lowing donor-acceptor combinations in decreasing order: cerulean-elongin B and citrine-elongin C > cerulean-elongin B and elongin C-citrine  elongin B- cerulean and elongin C-citrine. FRET signals from the pair of elongin B-cerulean and citrine-elongin C were modest (Table 1). Since the rate of energy transfer depends on the inverse sixth power of the distance between donor and acceptor, this result matches with the results from the X-ray crystallography of the VBC complex [26]; the distance between the C-terminal end of elongin B and the N-terminal end of elongin C used for the FRET pair of elongin B-cerulean and citrine- 450-500nm 0.01 1 0.1 Intensity/a.u. 0 2 4 6 810 12 14 Time/ns 550-600nm Cerulean Cit Ceru Cit Cerulean Cerulean Cerulean Cerulean Cit Cerulean Cit Cit 0.01 1 0.1 Intensity/a.u. 0 2 4 6 810 12 14 Time/ns 0.01 1 0.1 Intensity/a.u. 0 2 4 6 810 12 14 Time/ns 0.01 1 0.1 Intensity/a.u. 0 2 4 6 810 12 14 Time/ns 0.01 1 0.1 Intensity/a.u. 0 2 4 6 810 12 14 Time/ns 0.01 1 0.1 Intensity/a.u. 0 2 4 6 810 12 14 Time/ns Myc-EloB Ceru-EloC-Cit Ceru(W66A)-EloC-Cit Ceru-EloC-Cit(Y66A) - - - - + - - - + + - - + - + - + - - + WB : anti-Myc WB : anti-GFP WB : anti-Myc WB : anti-GFP Elongin C Elongin C Elongin B Elongin B IP : anti-Myc Input Ceru(W66A)-EloC-Cit + EloB Ceru-EloC-Cit + EloB Cerulean Ceru-EloC-Cit + EloB Cerulean Ceru-EloC-Cit Ceru(W66A)-EloC-Cit Ceru-EloC-Cit Ceru-EloC-Cit(Y66A) Ceru-EloC-Cit Ceru-EloC-Cit(Y66A) + EloB Ceru-EloC-Cit + EloB Ceru-EloC-Cit Ceru-EloC-Cit + EloB mock Ceru-EloC-Cit Ceru(W66A)-EloC-Cit Ceru-EloC-Cit(Y66A) Cerulean Citrine Ceru-EloC-Cit Ceru-EloC-Cit(Y66A) Ceru(W66A)-EloC-Cit A B C D E Fig. 3. Intramolecular FRET of elongin C conjugated with cerulean and citrine at its N- and C-termini, respectively. (A) Cellular images expressing cerulean-elongin C-citrine or its mutant pro- teins. Chimeric proteins, cerulean-elongin C-citrine and its mutant proteins, cerulean(W66A)-elongin C-citrine and cerulean-elongin C- citrine(Y66A), were transiently expressed in CHO-K1 cells by DNA transfection using the lipofection method. Forty hours after trans- fection, fluorescence of cerulean and citrine moieties of the chime- ric proteins was observed with an Olympus BX50 fluorescent microscope with a filter set (Olympus U-MCFPHQ and U-MY- FPHQ). Scale bars ¼ 20 lm. A typical result of western blotting for expressed proteins is shown on the right. (B) FLIM analysis of cerulean-elongin C-citrine in living CHO-K1 cells. CHO-K1 cells were transfected with a plasmid encoding cerulean-elongin C- citrine for FLIM analysis. For comparison, the decay curve of ceru- lean-elongin C-citrine(Y66A) or cerulean(W66A)-elongin C-citrine is shown. (C) FLIM analysis of cerulean-elongin C-citrine expressed with elongin B. For comparison, the decay curve of cerulean- elongin C-citrine(Y66A) or cerulean(W66A)-elongin C-citrine coex- pressed with elongin B is shown. (D) Comparison of the decay curves of cerulean-elongin C-citrine expressed with or without elongin B. Two decay curves of cerulean-elongin C-citrine obtained in the absence or presence of elongin B are shown in blue and red, respectively. (E) Coimmunoprecipitation analysis of cerulean-elon- gin C-citrine with elongin B. A plasmid for cerulean-elongin C-citrine or its mutants was introduced into CHO-K1 cells with a plasmid for myc-elongin B. Whole cell extracts were treated with anti-myc serum and coprecipitated cerulean-elongin C-citrine protein or its mutants was visualized by anti-GFP serum after electrophoresis and subsequent electroblotting to a nitrocellulose membrane; 5% input is shown. Table 3. Fluorescence decay data for elongin C-linked to cerulean and citrine. Citrine(Y66A) indicates a mutated citrine with mutation of Tyr66 to Ala. Data are derived from whole cell regions of interest and are expressed as mean ± SD. a 1 and a 2 are the exponential coeffi- cients (%) for the s 1 and s 2 decay times, respectively. n, number of cells examined. Combination of protein a 1 (%) s 1 (ns) a 2 (%) s 2 (ns) n v 2 Cerulean-elongin C-citrine(Y66A) 34.7 1.32 ± 0.08 65.3 3.47 ± 0.02 6 1.0–1.3 Cerulean-elongin C-citrine(Y66A)-elongin B 36.5 1.31 ± 0.11 63.5 3.44 ± 0.08 6 1.0–1.2 Cerulean-elongin C-citrine 44.8 0.94 ± 0.07 55.2 2.98 ± 0.08 8 1.0–1.3 Cerulean-elongin C-citrine elongin B 43.1 0.93 ± 0.08 56.9 2.83 ± 0.09 10 1.0–1.2 FRET imaging of the VBC complex K. Kinoshita et al. 5572 FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS elongin C is relatively long (4.7 nm) compared to dis- tances (2–3 nm) between other combinations of termi- nal ends of elongin B and elongin C, although the effects caused by the binding of pVHL on the 3D struc- ture of the elongin BC complex are not exactly known. The present study has clarified that conformation of pVHL and ⁄ or elongin C in the absence of elongin B was different from that in the VBC complex and that conformation of elongin C was changed upon binding of elongin B. The coimmunoprecipitation experiment (Fig. 2D) demonstrated that a remarkable stabilization of elongin C was caused by the binding of elongin B and, to a lesser extent, stabilization of pVHL was also found as previously reported [27,28]. The conforma- tional change of elongin C may be associated with the stabilization of the proteins. To date, the role of elon- gin B in the large E3 ubiquitin-ligase complex includ- ing the VBC-Cul2-Rbx1 is not understood because no direct interaction is present between elongin B and other components except for elongin C, and the fact that there is no obvious elongin B homologue in yeast obscured its physiological function [29]. The present study strongly suggests that elongin B is required to alter the conformation of elongin C that leads to sta- bilization of elongin C and pVHL. In summary, we have shown that interactions between components of the VBC complex can be visu- alized in living cells by a FRET–FLIM technique. Strong FRET signals were observed between elongin B and elongin C. Conformational changes of elongin C were caused by the binding of elongin B. In the pres- ent study, we demonstrated that the fluorescence rise in the decay curves of acceptors can be used as a sensi- tive indicator for the occurrence of FRET as well as donor lifetime-based measurements. Experimental procedures Plasmid construction pCerulean-elongin B was constructed by inserting the blunt-ended XspI-SmaI fragment of pCI neo-elongin B into the blunt-ended BspEI site of pCerulean-C1. pCerulean- elongin C and pcitrine-elongin C were similarly constructed by inserting the blunt-ended BstBI-SmaI fragment of pCI neo-elongin C into the blunt-ended BspEI site of pcerulean- C1 and pcitrine-C1, respectively. For the plasmid construc- tion for elongin C-citrine, the stop codon of elongin C was changed to GGA by using primers 5¢-CCCAAGC TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢. After digestion of the PCR fragment by EcoRI and AgeI, the fragment was inserted into the EcoRI and AgeI sites of pcitrine-N1. pVHL-cerulean was similarly constructed by PCR using primers 5¢-CGGAATTCCGATGCCCCGGA GGGCGGAGAACTG-3¢ and 5¢-ACGTACCGGTCCG CAATCTCCCATCCGTTGATGTG-3¢, and pcerulean-N1. pBOS-HA was constructed by insertion of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into the XbaI site of pBOS Vector. pBOS-Myc and pBOSFlag were constructed similarly by using the synthesized oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTC ATCGTCTTT GTAGTCC ATGG TGGT-3¢, respectively. pBOS-HA-pVHL was constructed by inserting the blunt-ended XhoI-AgeI fragment of pVHL- cerulean into the HpaI site of pBOS-HA. PBOS-FLAG- elongin C was constructed by inserting the blunt ended BstBI-SmaI fragment of pCIneo-elongin C into the SmaI site of pBOS-FLAG. PBOS-Myc-elongin B was constructed by inserting blunt-ended XhoI-SmaI fragment of pCIneo- elongin B into the HpaI site of pBOS-Myc. pCerulean-elon- gin C-citrine was constructed by inserting the EcoRV-HpaI fragment of the plasmid for elongin C-citrine into the EcoRV-HpaI site of pcerulean-elongin C. pCerulean (W66A)-C1 was constructed by site-directed mutagenesis, using the primers 5¢-CGTGACCACCCTGACCGCGGG CGTGCAGTGCTTC-3¢ and 5¢-GAAGCACTGCACGCC CGCGGTCAGGGTGGTCACG-3¢. pCerulean(W66A)- elongin C-citrine was constructed by inserting the BsrGI-EcoRI fragment of pcerulean-elongin C and the EcoRI-HpaI fragment of elongin C-citrine into the BsrGI- HpaI site of pcerulean(W66A)-C1. pcitrine(Y66A)-N1 was similarly constructed by site-directed mutagenesis, using the primers 5¢-TCGTGACCACCTTCGGCGCCGGCCTGAT GTGCTTCG-3¢ and 5¢-CGAAGCACATCAGGCCGGCG CCGAAGGTGGTCACGA-3¢. pCerulean-elongin C-citrine (Y66A) was constructed by inserting the BsrGI-AgeI frag- ment of pcerulean-elongin C-citrine and the AgeI-HpaI fragment of pcitrine(Y66A)-N1 into the BsrGI-HpaI site of pcerulean-C1. Cell culture and DNA transfection CHO-K1 cells were provided by the Cell Resource Center for Biomedical Research (Institute of Development, Aging and Cancer, Tohoku University, Japan) and grown on poly d-lysine coated glass bottom culture dishes (35 mm, MatTeK Corporation, Ashland, MA, USA) in phenol red-free K. Kinoshita et al. FRET imaging of the VBC complex FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS 5573 Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum, 1% nonessential amino acid solution (Invitrogen), 2 mml-gluta- mine (Sigma, Saint Louis, MO, USA) and 40 lgÆmL )1 kana- mycin. DNA (0.5 lg) consisting of equal amounts of each expression plasmid was introduced into CHO-K1 cells by the lipofection method using FuGene 6 reagent (Roche, Basel, Switzerland). Cells were incubated 40 h after transfection and observed by a FLIM microscope. The transfected cells were fixed with 4% formaldehyde and the cells were observed by fluorescence microscope as described previously [30]. Western blotting and immunoprecipitation Whole cell extracts were prepared from CHO-K1 cells transfected with plasmids encoding chimeric fluorescent proteins by mixing 10 mm Tris ⁄ HCl buffer, pH 7.5, con- taining 1 mm EDTA, 0.15 m NaCl, 1 mm dithiothreitol, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 10 lm MG132 and protease inhibitor cocktail (Roche). Pro- teins were resolved by 12% SDS ⁄ PAGE, and transferred to a nitrocellulose membrane (GE Healthcare, Piscataway, NJ, USA). Polyclonal anti-GFP serum (Clontech, Mountain View, CA, USA) diluted 1 : 1000 and donkey anti-rabbit horseradish peroxidase linked IgG (GE Healthcare) diluted 1 : 10000 were used as the first and second antibodies, respectively. The membrane was developed using the ECL plus detection system (GE Healthcare). CHO-K1 cells were transfected with plasmids for HA-tagged pVHL, Flag- tagged elongin C and myc-tagged elongin B, harvested, lysed and exposed to Flag-affinity agarose beads (Sigma) that had been pretreated with anti-Flag serum. Proteins bound to washed beads were eluted, boiled and separated by 15% SDS ⁄ PAGE. After electrophoresis, the proteins were blotted onto a nitrocellulose membrane and probed with anti-FLAG (Sigma), anti-HA (MBL, Nagoya, Japan) or anti-Myc (MBL) sera. Coimmunoprecipitation of elon- gin B and cerulean-elongin C-citrine was similarly per- formed. Measurement of fluorescence lifetime Techniques to measure FRET include FLIM to detect decreases in the lifetime of donor fluorescence and fluores- cence rise in the acceptor decay curve that are accompanied by FRET. FLIM measurements were conducted on the live cells at 37 °C after the culture medium was replaced with fresh medium. The emission lifetimes of fluorescent cells were measured on an inverted microscope (Axiovert 135, · 100 oil immersion objective with NA ¼ 1.3; Carl Zeiss, Oberkochen, Germany) equipped with a disk-anode microchannel-plate photomultiplier (Europhoton, Berlin, Germany), which can detect photons in a time- and space- resolved fashion by using a time correlated single photon counting technique. Spatial resolution can be obtained with a quadrant-anode, the details of which are provided else- where [31,32]. The excitation source was a 410 nm picosec- ond diode laser (FWHM 78 ps, LDH-P-C-400; PicoQuant, Berlin, Germany), which illuminates a relatively large area of approximately 100 lm in diameter and was operated at a repetition rate of 10 MHz. Average excitation power was estimated to be approximately 15 mWÆcm )2 , which is equiv- alent to the single photon counting level. Fluorescence from live cell samples was sequentially collected within the same cells at 475 ± 25 nm for cerulean and 575 ± 25 nm for citrine by band-pass filters. Fluorescence lifetime data were analyzed using global analysis with multiexponential decays [33]. Peak values of photon counting were approximately 2000 counts. CCD images of cells were obtained with an Olympus DP70 CCD camera (Olympus, Tokyo, Japan). Acknowledgements This work was supported in part by Grant-In-Aid for research from the Ministry of Education, Culture, Sports, Science and Technology of Japan. References 1 Latif F, Tory K, Gnarra J, Yao M, Duh FM, Orcutt ML, Stackhouse T, Kuzmin I, Modi W, Geil L et al. (1993) Identification of the von Hippel–Lindau disease tumor suppressor gene. Science 260, 1317–1320. 2 Chen F, Kishida T, Yao M, Hustad T, Glavac D, Dean M, Gnarra JR, Orcutt ML, Duh FM, Glenn G et al. (1995) Germline mutations in the von Hippel–Lindau disease tumor suppressor gene: correlations with pheno- type. Hum Mutat 5, 66–75. 3 Foster K, Prowse A, van den Berg A, Fleming S, Huls- beek MM, Crossey PA, Richards FM, Cairns P, Affara NA, Ferguson-Smith MA et al. (1994) Somatic muta- tions of the von Hippel–Lindau disease tumour suppres- sor gene in non-familial clear cell renal carcinoma. Hum Mol Genet 3, 2169–2173. 4 Gnarra JR, Tory K, Weng Y, Schmidt L, Wei MH, Li H, Latif F, Liu S, Chen F, Duh FM et al. (1994) Muta- tions of the VHL tumour suppressor gene in renal carci- noma. Nat Genet 7, 85–90. 5 Iliopoulos O, Ohh M & Kaelin WG Jr (1998) pVHL 19 is a biologically active product of the von Hippel–Lin- dau gene arising from internal translation initiation. Proc Natl Acad Sci USA 95, 11661–11666. 6 Schoenfeld A, Davidowitz EJ & Burk RD (1998) A sec- ond major native von Hippel–Lindau gene product, ini- tiated from an internal translation start site, functions as a tumor suppressor. Proc Natl Acad Sci USA 95, 8817–8822. 7 Bradsher JN, Jackson KW, Conaway RC & Conaway JW (1993) RNA polymerase II transcription factor SIII. FRET imaging of the VBC complex K. Kinoshita et al. 5574 FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS I. Identification, purification, and properties. J Biol Chem 268, 25587–25593. 8 Aso T, Lane WS, Conaway JW & Conaway RC (1995) Elongin (SIII): a multisubunit regulator of elongation by RNA polymerase II. Science 269, 1439–1443. 9 Brower CS, Shilatifard A, Mather T, Kamura T, Takagi Y, Haque D, Treharne A, Foundling SI, Conaway JW & Conaway RC (1999) The elongin B ubiquitin homol- ogy domain. Identification of elongin B sequences important for interaction with elongin C. J Biol Chem 274, 13629–13636. 10 Kamura T, Sato S, Haque D, Liu L, Kaelin WG Jr, Conaway RC & Conaway JW (1998) The elongin BC complex interacts with the conserved SOCS-box motif present in members of the SOCS, ras, WD-40 repeat, and ankyrin repeat families. Genes Dev 12, 3872–3881. 11 Feldman DE, Thulasiraman V, Ferreyra RG & Fryd- man J (1999) Formation of the VHL-elongin BC tumor suppressor complex is mediated by the chaperonin TRiC. Mol Cell 4, 1051–1061. 12 Melville MW, McClellan AJ, Meyer AS, Darveau A & Frydman J (2003) The Hsp70 and TRiC ⁄ CCT chaper- one systems cooperate in vivo to assemble the von Hip- pel–Lindau tumor suppressor complex. Mol Cell Biol 23, 3141–3151. 13 Bruick RK & McKnight SL (2001) A conserved family of prolyl-4-hydroxylases that modify HIF. Science 294, 1337–1340. 14 Epstein AC, Gleadle JM, McNeill LA, Hewitson KS, O’Rourke J, Mole DR, Mukherji M, Metzen E, Wilson MI, Dhanda A et al. (2001) C. elegans EGL-9 and mam- malian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 107, 43–54. 15 Ivan M, Kondo K, Yang H, Kim W, Valiando J, Ohh M, Salic A, Asara JM, Lane WS & Kaelin WG Jr (2001) HIFa targeted for VHL-mediated destruction by proline hydroxylation: implications for O 2 sensing. Sci- ence 292, 464–468. 16 Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, Kriegsheim AV, Hebestreit HF, Mukherji M, Schofield CJ et al. (2001) Targeting of HIF-a to the von Hippel–Lindau ubiquitylation complex by O 2 -regu- lated prolyl hydroxylation. Science 292, 468–472. 17 Hirota K & Semenza GL (2005) Regulation of hypoxia- inducible factor 1 by prolyl and asparaginyl hydroxylas- es. Biochem Biophys Res Commun 338, 610–616. 18 Masson N & Ratcliffe PJ (2003) HIF prolyl and aspar- aginyl hydroxylases in the biological response to intra- cellular O(2) levels. J Cell Sci 116, 3041–3049. 19 Suhling K, French PM & Phillips D (2005) Time- resolved fluorescence microscopy. Photochem Photobiol Sci 4, 13–22. 20 Wallrabe H & Periasamy A (2005) Imaging protein mole- cules using FRET and FLIM microscopy. Curr Opin Biotechnol 16, 19–27. 21 Becker W, Bergmann A, Hink MA, Konig K, Benndorf K & Biskup C (2004) Fluorescence lifetime imaging by time-correlated single-photon counting. Microsc Res Tech 63, 58–66. 22 Millington M, Grindlay GJ, Altenbach K, Neely RK, Kolch W, Bencina M, Read ND, Jones AC, Dryden DTF & Magennis SW (2007) High-precision FLIM- FRET in fixed and living cells reveals heterogeneity in a simple CFP-YFP fusion protein. Biophys Chem 127, 155–164. 23 Rizzo MA, Springer GH, Granada B & Piston DW (2004) An improved cyan fluorescent protein variant useful for FRET. Nat Biotechol 22, 445–449. 24 Bae JH, Rubini M, Jung G, Wiegand G, Seifert MH, Azim MK, Kim JS, Zumbusch A, Holak TA, Moroder L et al. (2003) Expansion of the genetic code enables design of a novel ‘gold’ class of green fluorescent pro- teins. J Mol Biol 328, 1071–1081. 25 Tramier M, Zahid M, Mevel JC, Masse MJ & Coppey- Moisan M (2006) Sensitivity of CFP ⁄ YFP and GFP ⁄ mCherry pairs to donor photobleaching on FRET determination by fluorescence lifetime imaging micros- copy in living cells. Microsc Res Tech 69, 933–939. 26 Stebbins CE, Kaelin WG Jr & Pavletich NP (1999) Structure of the VHL-elongin C-elongin B complex: implications for VHL tumor surppressor function. Science 284, 455–461. 27 Schoenfeld AR, Davidowitz EJ & Burk RD (2000) Elongin BC complex prevents degradation of von Hip- pel–Lindau tumor suppressor gene products. Proc Natl Acad Sci USA 97, 8507–8512. 28 Kamura T, Brower CS, Conaway RC & Conaway JW (2002) A molecular basis for stabilization of the von Hippel–Lindau (VHL) tumor suppressor protein by components of the VHL ubiquitin ligase. J Biol Chem 277, 30388–30393. 29 Koth C, Botuyan MV, Moreland RJ, Jansma DB, Conaway JW, Conaway RC, Chazin WJ, Friesen JD, Arrowsmith CH & Edwards AM (2000) Elongin from Saccharomyces cerevisiae. J Biol Chem 275, 11174–11180. 30 Sato F, Yasumoto K, Numayama-Tsuruta K & Sogawa K (2005) Heterodimerization with LBP-1b is necessary for nuclear localization of LBP-1a and LBP-1c. Genes Cells 10, 861–870. 31 Kemnitz K, Pfeifer L, Paul R & Coppey-Moisan M (1997) Novel detectors for fluorescence lifetime imaging on the picoscecond time scale. J Fluoresc 7, 93–98. 32 Kemnitz K, Pfeifer L & Ainbund MR (1997) Detector for multichannel spectroscopy and fluorescence lifetime imaging on the picosecond timescale. Nucl Instr Meth Phys Res A 387, 86–87. 33 Beechem JM (1989) A second generation global analysis program for the recovery of complex inhomogeneous fluorescence decay kinetics. Chem Phys Lipids 50, 237– 251. K. Kinoshita et al. FRET imaging of the VBC complex FEBS Journal 274 (2007) 5567–5575 ª 2007 The Authors Journal compilation ª 2007 FEBS 5575 . oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢,. ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTC ATCGTCTTT GTAGTCC ATGG TGGT-3¢, respectively.