Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACCCGG GATATCTTTATCGTC ATCGTCTTT GTAGTCC ATGG TGGT-3¢, respectively. ... oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ and 5¢-CTAGAGTTAACC CGGGATATCGGCGTAGTCGGGCACGTCGTAGGGG TACATGGTGGT-3¢, into...

Ngày tải lên: 16/03/2014, 05:20

9 421 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

... absorbance band centered at 528 nm and by a blue-shift of < /b> the CT band from 618 to 616 nm (spectrum b of < /b> Fig. 8A) . The slow phase is instead characterized by a marked enhancement of < /b> the absorbance ... important for a deeper understanding of < /b> the folding mechanism(s) and the factors affecting protein stabilization. The non-native compact state of < /...

Ngày tải lên: 19/02/2014, 05:20

11 487 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... of < /b> Biochemistry, Niigata University Graduate School of < /b> Medical and Dental Sciences, Gakkocho-dori, Niigata, Japan 2 Kitasato Junior College of < /b> Health and Hygienic Sciences, Yamatomachi, Minami-Uonuma-shi, ... from Nacalai Tesque, Inc. (Kyoto, Japan). Anti- serum against recombinant human TNSALP was raised in rabbits as described previously [21]. COS-1 cells were c...

Ngày tải lên: 19/02/2014, 17:20

14 445 0
Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

... M.(2002)Structural plasticity in the eight-helix fold of < /b> a trematode haemoglobin. Acta Crystallogr. D-Biol Cryst. D58,1–4. 18. Cutruzzola, F., Allocatelli, C. T., Brancaccio, A. & Brunori, M. (1996) Aplysia ... (1988) 1 HNMR resonance assignment and dynamic analysis of < /b> phenylalanine cd1 in a low-spin ferric complex < /b> of < /b> sperm whale myoglobin. J. Am....

Ngày tải lên: 23/03/2014, 17:22

14 505 0
Tài liệu Báo cáo khoa học: NMR structural characterization of HIV-1 virus protein U cytoplasmic domain in the presence of dodecylphosphatidylcholine micelles doc

Tài liệu Báo cáo khoa học: NMR structural characterization of HIV-1 virus protein U cytoplasmic domain in the presence of dodecylphosphatidylcholine micelles doc

... chain amide correlations of < /b> glutamine and aspara- gine residues are connected by a continuous line. Chemical shift changes of < /b> backbone amide H N (B) and 15 N (C) resonances upon the addition of < /b> ... heteronuclear NOEs and structural insight from homonuclear NOE-based distance constraints indicated that micelle-associ- ated VpUcyt retains a substantial degree...

Ngày tải lên: 18/02/2014, 06:20

16 633 0
Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc

Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc

... SUR 2B are encoded by splice variants of < /b> a single gene, ABCC9, and differ only in their C- terminal 42 amino acids. ATP blocks K ATP channel activity by binding to Kir6.2, whereas the SUR subunit ... a truncated NBD2 construct, NBD2-DC, which lacked the last 42 amino acids. Figure 2A and Table 1 show that the ATPase activity of < /b> NBD2-DC was greater than that of...

Ngày tải lên: 06/03/2014, 11:20

9 620 0
Báo cáo khoa học: "Weakly-Supervised Acquisition of Open-Domain Classes and Class Attributes from Web Documents and Query Logs" pot

Báo cáo khoa học: "Weakly-Supervised Acquisition of Open-Domain Classes and Class Attributes from Web Documents and Query Logs" pot

... 50 Precision Rank Class: Average-Class manually assembled instances automatically extracted instances Figure 3: Accuracy of < /b> attributes extracted based on man- ually assembled, gold standard (M ... remainders of < /b> queries that also contain one of < /b> the class instances. In the case of < /b> the class movies, whose instances include jay and silent bob strike back and kill...

Ngày tải lên: 08/03/2014, 01:20

9 447 0
Báo cáo khoa học: "Determining the Specificity of Terms using Compositional and Contextual Information" pptx

Báo cáo khoa học: "Determining the Specificity of Terms using Compositional and Contextual Information" pptx

... disease names. The system was evaluated by two criteria, coverage and precision. Coverage is the fraction 2 MEDLINE is a database of < /b> biomedical articles serviced by National Library of < /b> ... root of < /b> the subtree, and the subtree consists of < /b> 436 disease names which are target terms of < /b> specificity measuring. A set of < /b> journal abstract...

Ngày tải lên: 08/03/2014, 04:22

6 385 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... Greenspan MD, Yudkovitz JB, Chen JS, Hanf DP, Chang MN, Chiang PY, Chabala JC & Alberts AW (1989) The inhibition of < /b> cytoplasmic acetoacetyl-CoA thiolase by a triyne carbonate (L-660, 631). Biochem Biophys ... have a reactive cysteine in the active site, playing a key role in the reaction cycle by accepting the fatty-acyl moiety from either acyl-CoA (thiolases) or from...

Ngày tải lên: 16/03/2014, 04:20

13 473 0
Báo cáo khoa học: The structural comparison of the bacterial PepX and human DPP-IV reveals sites for the design of inhibitors of PepX activity pot

Báo cáo khoa học: The structural comparison of the bacterial PepX and human DPP-IV reveals sites for the design of inhibitors of PepX activity pot

... While PepX from beneficial bacteria are probably involved in the degradation of < /b> milk caseins, proline-rich pro- teins, the in vivo function of < /b> this enzyme in Lactococci and Lactobacilli is not fully ... domains flanking the catalytic domain, different dimer organization and sub- strate selectivity processes. These resemblances are characteristic of < /b> X-PDAP activity...

Ngày tải lên: 23/03/2014, 13:20

10 561 0
w