... GACTCATGACTGTTGTTACAACC-3' and reverse 5'-TCTCAGGACTCTCTTAGGTACTA-3' that amplify a 493 bp fragment, and primers for β-actin are: forward 5'-TGGAGAAGAGCTATGAGCTGCCTG-3' and reverse 5'-GTGCCACCAGACAGCACTGTGTTG-3' ... phospholipase A2 in reactive astrocytes in responseto transient focal cerebral ischemia in the rat brain J Neurochem 2004, 90(3):637-645 Yagami T, Ueda K, Asakura K, Hata S, Kuroda T, Sakaeda T, Takasu ... initiating astrocyte activation and inflammatory cascade [49], its ability to induce sPLA2-IIA mRNA in astrocytes suggests that sPLA2-IIA upregulation could be engaged in early inflammatory events...
... fluorescence and amplification cycle were generated using the amplified PCR product as a template, and were used to calculate mRNA copy number in each sample Data were expressed as relative mRNA expression ... necessity of DNAse pretreatment and hybridisation Anal Cell Pathol 2001, 22:151-158 Teo IA and Shaunak S Polymerase chain reaction in situ: an appraisal of an emerging technique Histochem J 1995, ... [4] was carried out on a series of total RNA preparations from normal human tissue and paired normal/cancer samples Selection of sequences for oligonucleotide primers was carried out with the aim...
... NA7R ORF7-F ORF7-R PCV2 -A2 PCV2 -A3 CSFV-F CSFV-R Trình tự mồi [5’ – 3’] CAG CCA GTC AAT CAG CTG TG GAA CGT TCG GTC TGG GTG AG ATC CTC CCT GAA TCT GAC AGG TGG GTG GCA GAA AAG CTG TT GTG TCA ATC ... GCA GAA AAG CTG TT GTG TCA ATC AGT GCC ATT GAC C TCC CGT ATT TTC TTG CGC TC GAT GCC ATT TTT CCT TCT CC AAC ATG GAT GGT GTA ACT GG TCT CTA TAG TGT TGG TCA TTC C Ta [oC] 55 55 53 54 Kích thƣớc sản ... HCl; mM EDTA; pH = 8,0 Dung dịch Cân 0,5 g agarose h a tan vào 100 ml dung dịch agarose 0.5% đệm TBE Dung dịch Cân g agarose h a tan vào 100 ml dung dịch đệm agarose % TBE Ethidium Hoà tan g Ethidium...
... 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA 794-775 55.4 Kích thước 154 bp 371 bp 292 bp Tối ưu phản ứng mutiplex ... Swayne DE and Halverson DA (2007), Diseases of Poultry: Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken ... K Someya, Y Sakai, T Nguyen, K Nguyen, N Pham, H Nguyen, S Yamada, Y Muramoto, T Horimoto, A Takada, H Goto, T Suzuki, Y Suzuki, and Y Kawaoka (2005), “Avian flu: isolation of drugresistant H5N1...
... order to determine numerical values Intact mRNA was successfully extracted from as little as 400 µl of whole blood, comparable amounts to that obtained from infants via heelstick This mRNA was used ... different reactions for each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across at least three reactions in which approximately equal amounts ... quantification of GAPDH mRNA by QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according to the amount of GAPDH mRNA in the sample Authors' contributions Heather Jaspan...
... (5'-ACGTCCTGGACCCTAAGTTTTG-3') was used as a shared reverse primer P5(5'-GGTTTTATAAAAGATT), p6(5'-ATCTAGAGGTAA-3') were used as the primer specific for different CDV vaccine strains Primer pairs ... P1 (5'-AAATCCTGTGTTACCCGCTC-3'), P2 (5'-TGGTGGCTCTGCAATATGAA3'), and P3 (5'-AATGAATGGATGCCTGGGGTTT-3') were used as the primer specific for CDV species, wildtype strains, and vaccine strain Onderstepoort, ... (5'-CCAATTCATCCAAGCTGTCC-3') and P6 (5'-GGGATTTGAACGGTTACATGAG-3') The amplified products were cloned and sequenced, and the sequences were aligned with the H genes of a number of CDV strains available...
... Fluorescent and LC-Red probe sequences used for CEA identification were: 5’-CCTGAAATGAAGAAACTACACCAGGGC-fluorescein and 5’-LC-Red 640-GCTATATCAGAGCAACCCCAACCAGCphosphate Real-time PCR monitoring was achieved ... multivariate analyses were used to evaluate factors relating to diseasefree survival According to univariate analysis, age, tumor depth, nodal metastasis, histological grade, TNM stage, CEA mRNA positivity ... Carcinoembryonic antigen Univariate and multivariate analyses of 3-year disease-free survival The 5-year overall survival was 58.9% and 3-year disease free survival was 63.9% Both univariate and multivariate...
... start EEE-F TGTGCGTACCTCCTCATCGTT 335 EEE-R GACTGGCGTGAATCTCTGCTT 414 EEE-Probe HEX364 AGCAGCCTACCTTTCCGACAATGGTTGTCTAMRA WEE-F AGGGATACCCCCGAAGGTT 8220 WEE-R GTGAATAGCACACGGGTGGTT 8322 CTTTCGAATGTCACGTTCCCATGCG ... Nattanmai S, Kramer LD, Bernard KA, Tavakoli NP: A duplex realtime reverse transcriptase polymerase chain reaction assay for the detection of St Louis encephalitis and eastern equine encephalitis ... Pässler et al developed a detecting assay for alphaviruses based on antibodies [14] Lambert et al developed an RT-PCR assay and Taqman RT-PCR assay for WEEV and EEEV [11] But none of the above methods...
... China), qualitative duplex real-time RTPCR assay, and COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay (Roche Molecular Systems, Pleasanton, CA) A total of 100 HCV-negative serum samples were obtained ... deviation (SD), as appropriate The intra-assay and inter-assay variations are expressed as SD and coefficient of variation (CV), based on the mean Ct values Probit analysis was performed to determine ... screening and laboratory diagnosis of HCV infection Materials and methods Standards A dilution series of the World Health Organization (WHO) Second International Standard for HCV RNA (National Institute...
... in combination with various templates, namely Vacc-P (lane 1), Vacc-Q (lane 2), a local strain (lane 3), Vacc-P and a local strain (lane 4), Vacc-Q and a local strain (lane 5) and a negative control ... strain amplification were F-vacc: 5'CATCAGCCATGATCAGGGTCTTTTC-3' and R-vacc: 5'-GGGCGGTCTTGTTGGGTATGTGTTT-3' The primers used for field strain amplification were F-wt: 5'AATTCCCAAAAAATCCAAACCCTGC-3' ... incubation at 70°C for 10 Following this, the first round amplification was conducted by polymerase chain reaction (PCR) with the outer primers CDF-F: 5'-AGAGTGCAAAATAGTAAGAATCCAAGC-3' and CDF-R:...
... Table 4: List of clinical signs and symptoms in patients tested Clinical/Laboratory feature n = 124 Number of cases Percentage (%) Pyrexia Arthralgia Headache Ocular pain Emesis Lumbar pain Rash ... observation of clinical and laboratory features, at least 4% of patients had suggestive symptoms This figure gives an average of at least 16 cases of DHF/ DSS per year based on the number of patients ... cells, proteases and lymphokines may be released and activate complement coagulation cascades and vascular permeability factors In 20–30% of DHF cases, the patient develops shock, known as the dengue...
... TGGACCGGTG 16 AAGACCGGGA ACCCGGTCAC 17 TCCCGGTGAG AACCCGGGAA 18 GAATCCGGCA ACCCGGAAAC TTCCCGGGTT 19 TTTGCCCGGT 20 TGCCGGTTCA CCCGGCATAA CACCCGGATG 21 22 AGCCGGGTAA CCCGGAAGAG TCAGTCCGGG 23 CTACCGGCAC ... that AMP PCR assay could produce DNA marker patterns from genomic and digested Phutikanit et al Acta Veterinaria Scandinavica 2010, 52:18 http://www.actavetscand.com/content/52/1/18 G-S G-L Page ... recognition locations only These particular locations are abundant in the mammalian genome and many may not closely associate with gene regulatory domains To enhance the ability of the AMP PCR in...
... Diethylpyrocarbonate treated water DNA: Deroxi ribonucleic acid dNTP: Deoxyribonucleotide triphosphate EDTA: Etilendiamin tetraaxetic acid HA (H): Haemagglutinin LB: Luria-Bertani media M: Matrix protein NA (N): ... Indonesia, Thái Lan, Việt Nam ph a nam Trung Quốc từ năm 2003 đến [14] Các clade virus cúm A/ H5N1 Các tổ chức WHO (World Health Organization), OIE (Organisation for Animal Health) FAO (Food and Agriculture ... dàng lan truyền quần thể - Hiện tƣợng glycosyl h a: Glycosyl h a (glycosylation) gắn kết chuỗi oligosaccharide với amino acid asparagine số vị trí định 11 chuỗi polypeptide HA hay NA, hay số...
... CTTAA G Mix and ligate G AATTC CTTAA G Recombinant molecules G AATTC CTTAA G GAATTC CTTAAG GAATTC CTTAAG Parental molecules DNA ligase covalently joins two DNA molecules • Uses ATP or NADH to provide ... from different sources together with DNA ligase Restriction endonucleases generate ends that facilitate mixing and matching GAATTC CTTAAG GAATTC CTTAAG EcoRI cut G AATTC CTTAA G G AATTC CTTAA ... have a natural system to take up DNA • Treat with inorganic salts to destabilize cell wall and cell membrane • During a brief heat shock, some of the bacteria takes up a plasmid molecule • Can...