transcription polymerase chain reaction Abstract. T -P - - Keywords. ; ; Content I. Đặt vấn đề Orthomyxoviridae. . A/H5N1 , , . , , vir /H5N1 . 1. a chn p thc hin phn ng multiplex RT- 2. n cu ti n ca phn ng multiplex RT-PCR: nhit i gian gn mi, nng 3. Th nghin ng multiplex RT-t s mu bnh phm thu thm. II. Vật liệu và phương pháp nghiên cứu Mâ ̃ u bệnh phẩm: /H5N1: 8 gi ( ); 6 ( - g); 30 Tách chiết RNA: thu RNA Thiết kế mô ̀ i : 5, N1 , 2.0.11. Sau khi 5.4 /H5N1 , /H5N1 -PCR. Phn ứng m utiplex RT-PCR: RT- 1000 (Biorad). (10 ) 2%, ethidium bromide 0,5 /ml 15 , . 100 bp. Đa ́ nh gia ́ đô ̣ đă ̣ c hiê ̣ u cu ̉ a pha ̉ n ư ́ ng : A/H1N1, /H3, ( ), /H5 ( ) Đa ́ nh gia ́ đô ̣ nha ̣ y cu ̉ a pha ̉ n ư ́ ng : S, /H5N1 1.2/blunt (Fermentas) , Kit (Fermentas). 260 (Eppendorf). . Sau , 10 1 / . III. Kết qu Thiê ́ t kê ́ mô ̀ i: 5, N1 , 3 utiplex RT- /H5N1 : Mô ̀ i Trnh t 5’-3’ V tr Tm Kch thưc DiagMF GTCTTCTAACCGAGGTCGAAAC 5-26 55.1 154 bp DiagMR GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 371 bp DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 292 bp DiagN1R GCATCAGGATAACAGGAGCA 794-775 55.4 Tối ưu phn ứng mutiplex RT-PCR: - ( , nhi, , ) . , mutiplex RT- 3 . utiplex RT- , 0.3 , 0.5 0.4 ; : c 50 o C b 95 o C trong 15 ; 45 (94 o C: 30 ; 57 o C: 30 ; 72 o C: 30 ); 72 o C trong 5 . Đa ́ nh gia ́ đô ̣ đă ̣ c hiê ̣ u cu ̉ a pha ̉ n ư ́ ng m utiplex RT-PCR: (; /H1N1; /H5 A/H3 N1) . m A/H5N1. , (ngươ ̀ i, Escherichia coli, Mycobacteria tuberculosis, Chlamydia trachomatis, Neisseria gorrnorhea, Hepatitis B virus, Hepatitis C virus, Human immunodeficiency virus, Human Papillomavirus), utiplex RT-PCR . Ảnh điện di đa ́ nh gia ́ độ đă ̣ c hiê ̣ u cu ̉ a pha ̉ n ư ́ ng multiplexRT-PCR. M: thang DNA chuâ ̉ n 100 bp; NC: Chư ́ ng âm; 1: cm A/H5; 2: cm A/H3; 3: cm B; 4: cm A/H5N1; 5: cm A/H1N1 Đa ́ nh gia ́ đô ̣ nha ̣ y cu ̉ a pha ̉ n ư ́ ng mutiplex RT-PCR: , 10 1 10 10 / 10 2%. di cho ( bromide) 10 . Thư ̉ nghiê ̣ m đa ́ nh gia ́ đô ̣ nha ̣ y cu ̉ a pha ̉ n ư ́ ng multiplex RT-PCR M: thang DNA 100 bp; NC: Chư ́ ng âm; S lưng bản sao RNA trong mu th đưc ghi ch pha trên. ng dng k thuật mutiplex RT-PCR pha ́ t hiê ̣ n cu ́ m A /H5N1 trên mâ ̃ u bê ̣ nh phâ ̉ m: Kmutiplex RT-PCR 14 A/H5N1 (2 , 3 , 3 , 6 ). utiplex RT- 14 . Kết qua ̉ thư ̉ nghiê ̣ m pha ̉ n ư ́ ng multiplex RT-PCR trên mâ ̃ u bê ̣ nh phâ ̉ m dương tnh. M: thang DNA chuẩn 100 bp; NC: Chư ́ ng âm; md: muscovy duck; ck: chicken; d: duck 1, 2, 3; h: human 1, 2, 3, 4, 5, 6 K thut mutiplex RT-u bnh phm (thu thp t gia cm b b dt qu t hic 9 m H5N1 (31 m70%). Kết qua ̉ thư ̉ nghiê ̣ m pha ̉ n ư ́ ng multiplex RT-PCR phát hiện virus cm gia cầm A/H5N1 trên một s mu bê ̣ nh phâ ̉ m M: Thang DNA chuẩn 100 bp; NC: Chứng âm; PC: Chứng dương; 1-10: Mu bệnh phẩm. Kết luận - mutiplex RT-PCR. - - nhanh /H5N1 /H5N1 . - ex RT-PCR References : Tiếng Việt Báo cáo tình hình cm gia cầm tại Việt Nam, Tạp ch Công nghệ Sinh học 2(1): 1-18. Tạp ch Khoa học Kỹ thuật Th y, 11(1): 81-86. Tạp ch Khoa học Kỹ thuật Th y, 11(2): 53-58. Tiếng Anh 5. Abdel-Ghafar AN, Chotpitayasunondh T, Gao Z, Hayden FG, Nguyen DH, et al, N. Engl. J. Med, 358, pp. 261-73. 6. Apisarnthanarak A, Kitphati R, Thongphubeth K, Patoomanunt P, et al, 2004, Emerg Infect Dis, 10, pp. 1321- 4. -length of neuraminidase combine to regulate the growth of avian influenza viruses in Virus Res, 79(1-2): 177-185. Arch. Virol., 119, pp. 37-42. 9. Beigel JH, Farrar J, Han AM, Hayden FG, Hyer R, de Jong MD, Lochindarat S, N Engl J Med, 353, pp. 1374- 85. 10. Bloomberg News articles (2006), Two Bird Flu Gene Mutations Might Lead to Faster Human Spread, Published. Nature, 439, pp. 248-9 12. CDC (2009), Interim guidance on the planning for the use of surgical masks and respirators in health care settings during an influenza pandemic. fection in Hong Clin Infect Dis, 34(suppl 2):S58- S64. Proc Natl Acad Sci USA, 103, pp. 2845- 50. The evolution of , Proc Natl Acad Sci USA, 101: p. 10452-10457. 16. Chotpitayasunondh T, Ungchusak K, Hanshaoworaku Emerg Infect Dis, 11, pp. 201- 9. 17. Conenello G, Zamarin D, Perrone L, Tumpey T and Palese P (2007), A Single Mutation in the PB1-F2 of H5N1 (HK/97) and 1918 Influenza A Viruses Contributes to I, PLoS Pathog, 3(10), pp. 1414-21 18. De Jong MD, Bach VC, Phan TQ, Vo MH, Tran TT, Nguyen BH, Beld M, Le TP, influenza A (H5N1) in a child presenting with diarrhea foll N Engl J Med, 352, pp. 686-91. 19. De Jong MD, Simmons CP, Thanh TT, Hien VM, Smith GJ, Chau TN, Hoang DM, Chau NV, Khanh TH, Dong VC, Qui PT, Cam BV, Ha DQ, Guan Y, Peiris JS, uenza A Nat Med, 12, pp. 1203- 07. 20. De Jong MD, Tran TT, Truong HK, Vo MH, Smith GJ, Nguyen VC, Bach VC, Phan e N Engl J Med, 353, pp. 2667- 72 Proc Natl Acad Sci U S A, 90(9): 4171-4175. 22. Duan L, Bahl J, Smith G, et al. (2008), The development and genetic diversity of H5N1 influenza virus in China, 1996-Virology, 380, pp. 243-54. Evolution of the receptor Virology; 344:432-438. 24. Greninger A (2004), The Definition and Measurement of Dangerous Research. 25. Guan Y, et al (2004), H5N1 influenza: A protean pandemic threat, PNAS, 101(21), pp. 8156-61 Proc. Natl Acad. Sci. USA, 99, pp. 89505. 27. Hamada S., Suzuki Y., Suzuki T., et al (2006), Haemagglutinin mutations responsible for the binding of H5N1 influenza A virus to human- Nature, 444(7117), pp.378-82. Influenza, Report 2006. 29. Hatta M., et al (2007), Growth of H5N1 Influenza A Viruses in the Upper Respiratory Tracts of Mice, PLoS. Pathog. 30. Hoa, L.T., D.D. Khang, P.V. Chi, N.V. Hai, T.N. Hai, N.T.B. Nga, and L.T. Binh Molecular characterization of the H5 gene for the highly pathogenic A/H5N1 strains isolated in Vietnam during 2004 Proceedings of International Workshop on Biotechnology in Agriculture, p. 68-71. 31. Hui DS (2 Respirology, 13(suppl 1):S10-S13. 32. International Committee on Taxonomy of Viruses Index of Viruses (2009), Orthomyxoviridae, In: ICTVdB - The Universal Virus Database, version 7. B#chen-Osmond, C (Ed), Columbia University, New York, USA. 33. Julkunen I, Pyhala R, Hovi T, 1985, Enzyme immunoassay, complement fixation and hemagglutination inhibition tests in the diagnosis of influenza A and B virus Purified hemagglutinin in subtype-specific diagnosis, J. Vir.Methods. 10, 75-84. 34. Kandun IN, Wibisono H, Sedyaningsih ER, Yusharmen, Hadisoedarsuno W, et al. (N. Engl. J. Med, 355, pp. 2186-94. 35. Katz JM, Lim W, et al. avian influenza A (H5N1) viruses and detection of anti-H5 antibody among J Infect Dis, 180, pp. 1763-70. 36. Lamb RA and Krug RM (2001), Fields Virology, 4th Edition, (D.M. Knipe and P.M. Howley, eds), pp 1487-1531. 37. Lamb RA (1989), Genes and proteins of the influenza viruses. In: Krug R M, editor. The influenza viruses. 1st ed. New York, N.Y: Plenum Press. 38. Le, Q., M. Kiso, K. Someya, Y. Sakai, T. Nguyen, K. Nguyen, N. Pham, H. Nguyen, S. Yamada, Y. Muramoto, T. Horimoto, A. Takada, H. Goto, T. Avian flu: isolation of drug- resistant H5N. Nature, 437(7062): p. 1108. 39. Lee C. W., Suarez D., Tumpey T., et al (2005), Characterization of Highly Pathogenic H5N1 Avian Influenza A Viruses Isolated from South Korea, Journal of Virology, 79(6), pp. 3692-3702. 40. Luong, G. and P. Pales , Curr Opinion Gen Develop, 2: p. 77-81. Emerg. Infect. Dis., 11, pp. 1303-5 42. Rowe T, Abernathy RA, Hu-Primmer J, et al (1999), Detection of Antibody to Avian Influenza A (H5N1) Virus in Human Serum by Using a Combination of Serologic Assays, J Clin Microbiol, 37(4), pp. 937- 43. 43. Sastre A (2006), Antiviral Response in Pandemic Influenza Viruse, CDC, vol 12 number 1 44. Senne, DA, Panigrahy, B, Kawaoka, Y, Pearson, JE, Suss, J, Lipkind, M, Kida, H and Webster, RG (1996) Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker oAvian Diseases, 40: 425- 437. 45. Swayne DE and Halverson DA (2007), Diseases of Poultry: Influenza, 12th edn. Ames, IA: Blackwell Publishing Professional. 46. Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken viruses isolated in Indonesia from 2003-Virology, 390, pp. 13-21. influenza A (H5N1) in 10 patN Engl J Med, 350, pp. 1179-88. 48. Uiprasertkul, M., R. Kitphati, P. Puthavathana, R. Kriwong, A. Kongchanagul, K. Ungchusak, S. Angkasekwinai, K. Chokephaibulkit, K. Srisook, N. Vanprapar, Apoptosis and pathogenesis of avian influenza A Emerg Infect Dis, 13(5): p. 708-712. 49. WHO inter-country-consultation, influenza A/H5N1 in humans in Asia: Manila, Philippines, 6-7 May 2005. 50. World Health Organization (2009), Continuing progress towards a unified nomenclature system for the highly pathogenic H5N1 avian influenza viruses. Science, 52, pp. 40711. 52. Yamada S, Suzuki Y, Suzuki T, Le MQ, Nidom CA, Sakai-Tagawa Y, Muramoto Y, Ito M, Kiso M, Horimoto T, Shinya K, Sawada T, Kiso M, Usui T, Murata T, Lin Y, Hay A, Haire LF, Stevens DJ, Russell RJ, Gamblin SJ, Skehel JJ, Kawaoka Y nsible for the binding of H5N1 influenza A viruses human-Nature, 444(7117): 378-382. . 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 371 bp DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524. sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker oAvian Diseases, 40: 425- 437.