0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: " Hepatitis C Virus entry: the early steps in the viral replication cycle" pptx

Báo cáo y học:

Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

... Virus (HCV) Infection and Hepatic Steatosis Eugene J. Yoon, and Ke-Qin Hu Division of Gastroenterology and Hepatology, University of California, Irvine Medical Center, CA 92868, USA Corresponding ... directly injure the liver but it rather triggers an HCV-specific lymphoproliferation. Through profuse cytokine production and also a direct cytopathic effect, these T cells result in hepatocyte ... distribution and size of the lipid accumulation within the hepatocytes. Microvesicular steatosis that is seen in Reye’s syndrome and Acute Fatty Liver Disease of Pregnancy occurs due to dysfunctions...
  • 4
  • 438
  • 0
Báo cáo y học:

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

... virological response to antiviral therapy. Virological tools include serological assays for anti-HCV antibody detection and serological determination of the HCV genotype, and molecular assays that ... use of HCV virological tools in the treatment of chronic hepatitis C, according to the HCV genotype: genotype 1 (A), genotypes 2 and 3 (B), and genotypes 4, 5 and 6 (C) . Int. J. Med. Sci. ... detect and quantify HCV RNA and determine the HCV genotype. Anti-HCV antibody testing and HCV RNA testing are used to diagnose acute and chronic hepatitis C. Only patients with detectable HCV...
  • 6
  • 612
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Hepatitis C virus NS5A protein binds the SH3 domain of the Fyn tyrosine kinase with high affinity: mutagenic analysis of residues within the SH3 domain that ?" doc

... affinity to that exhibited by the Nef :SH3 domain interaction. We conclude that NS5A binds to SH3 domains with high affinity, and such interactions couldoccur in the context of an HCV infected cell.Results ... interactions with the SH3 domain of the Src-family tyrosine kinase, Fyn. Surface plasmon resonance analysis revealed that NS5A binds to the Fyn SH3 domain with what can be considered a high affinity ... We conclude that the NS5A: Fyn SH3 domain interaction occurs via a canonical SH3 domain binding site and the high affinity of the interaction suggests that NS5A would be able tocompete with cognate...
  • 9
  • 447
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Hepatitis C virus NS2 and NS3/4A proteins are potent inhibitors of host cell cytokine/chemokine gene expression" potx

... of pcDNA3.1(+)-FLAG-tagged expression vector [43]. Primers for NS3/4A; 5'-AAGGGGGGATCCACCATGGCGCCCATCACGGCG-TACGCCCAGCAG-3', 5'-GTACGGGGATCCTTATCAG-CACTCTTCCATCTCATCGAACTCCTG-3', ... 5'-GTACGGGGATCCTTATCAG-CACTCTTCCATCTCATCGAACTCCTG-3', F gene; 5'-AAAAAAAAGGATCCACCATGGCACGAATCCTAAACCT-CAAAGA-3', 5'-TTTCCCTGGGATCCTTATCACGCCGTCT-TCCAGAACCCG-3' (initiation codon underlined).Preparation of ... 5'-GCAACGCGTCATATTCCTGAGTCCTTCCTTGC-3' and 5'-CCCGGTACCGTCTGTGTCACAGAGAGAAAGGGAG-3'(for IFN-λ3 promoter), 5'-ATGACGCGTGAAATTCAG-GAGTAATCAGATC-3' and 5'-GAGGTACCCGTAGATATT-GCAGATACTTCTG-3'...
  • 13
  • 475
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... is of Mexican origin. The index casewas a 23-year-old female diagnosed with breast carci-noma of the left breast with combined histological fea-tures of lobular carcinoma and infiltrating ... Journal of Surgical OncologyOpen AccessResearchIdentification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndromeLucia Taja-Chayeb*†1, Silvia Vidal-Millán†1, ... ductalcarcinoma. The family history suggested LFS: the patient'sfather was diagnosed with dorsal soft tissue leiomyosar-coma at the age of 67 years, and a half-sister (from the paternal...
  • 7
  • 403
  • 0
Báo cáo y học:

Báo cáo y học: " Hepatitis C virus genotypes circulating in district Swat of Khyber Pakhtoonkhaw, Pakistan" doc

... Epidemiology of HCV Genotypes in the Area of Lecce. J of Prev Med and Hygi 2000,41:46-53.doi:10.1186/1743-422X-8-16Cite this article as: Inamullah et al.: Hepatitis C virus genotypes circulating in district ... Ahmed3Abstract Hepatitis C virus (HCV) is the leading cause of chronic hepatitis worldwide and its subtypes /genotypes are clinicallyimportant for clinical management and vaccine development. ... N: Clinical significance of hepatitis C virus genotypes. Clin MicrobiolRev 2000, 13:223-235.7. Agnello V, Chung RT, Kaplan LM: A role for hepatitis C infection in type IIcryoglobulinaemia....
  • 5
  • 246
  • 0
Báo cáo y học:

Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

... hepatitis B virus infection in truck drivers in Brazil, South America. SexTransm Infect 2008, 84:386-389.14. Ginabreda MGP, Yoshida CFT, Niel C: Genomic characterization of Brazilian hepatitis C virus ... were indepen-dent associated with HCV infection in the study popula-tion. Regarding blood transfusion, HCV infection wasassociated with this procedure before the introductionof screening for ... of HCV infection associated withnon-injecting drugs is probably linked to the usual prac-tice of sharing of non-injecting drug implements, suchas pipes and straws, for smoking and sniffing/snortingdrugs,...
  • 6
  • 381
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis C virus core protein induces apoptosis-like caspase independent cell death" docx

... tetracycline to induce specific protein expressionFigure 3Different features of apoptosis induced by the HCV -core protein in UC cells cultured in the presence or absence of tetracycline to induce ... on caspase activationFigure 5Influence of the HCV -core protein on caspase activation. 1 ì 105 cells/ml of the UC (A, C, E) and UHCV cell lines (B) or 1 × 106 UC cells (D) were cultured for ... the constitutively tetracycline-controlled transacti-Table 1: HCV-proteins expressed in the different cell lines cell lines expressed HCV-proteins clones Ref.UHCV ORF UHCV-32 [30]UC p21 (core- protein) ...
  • 13
  • 284
  • 0
Báo cáo khoa học:

Báo cáo khoa học:" Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" docx

... GTGGGTACCATGTCACACCTCCCTTACATCGAACAGReverse primer, TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC NS4B- CTDForward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGCReverse primer, as NS4B FL NS4B- deltaCTDForward ... primer, as NS4B FLReverse primer, TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC NS4B- CTD sub-CysForward primer, as for NS4B- CTDReverse primer, AGATCTAGAGAGCCGGAGGATGGCGTGGAGGAGTCCTCGTTGATCCACTGd-LDH ... MBDForward primer, GTGGGTACCATGAAATACGGCAAAGACACCTTCCReverse primer, TACTCTAGAGAATGCTCGTATTTATCGC Virology Journal 2009, 6:62 http://www.virologyj.com/content/6/1/62Page 4 of 12(page number...
  • 12
  • 307
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" ppsx

... Schattner A:Increased risk of type 2 diabetes in noncirrhotic patients with chronic hepatitis C virus infection. Mayo Clin Proc 2000,75:355-359.18. Zein CO, Levy C, Basu A, Zein NN: Chronic ... tumornecrosis factor- alpha are increased in acute alcoholic hep-atitis and such cytokines induce insulin resistance andglucose intolerance which could consequently cause typeII Diabetes mellitus ... origin, 12% of Caucasians and 8% of Asians [13].It is unclear as to why some patients with HCV infection develop diabetes because the pathogenic mechanismsleading to DM in patients with HCV infection...
  • 6
  • 291
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis C Virus entry: the early steps in the viral replication cycle" ppt

... possible the study of the HCV replication cycle, in vitro. Studies utilizing the HCVpp andHCVcc systems have increased our insight into the early steps of the viral replication cycle of HCV,such ... the HCV replication cycle was hampered due to difficulties in growing and propagating the virus in an in vitrosetting. The advent of the HCV pseudo particle (HCVpp) and HCV cell culture (HCVcc) ... importance in cholesterol levels to infectivitywhich further highlight the role SRBI plays directly and in- directly in HCV infection. The effective interaction of the HCV glycoproteins, SRBI,and CD81...
  • 11
  • 345
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Hepatitis C virus NS4B carboxy terminal domain is a membrane binding domain" pps

... TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC NS4B- CTD sub-CysForward primer, as for NS4B- CTDReverse primer, AGATCTAGAGAGCCGGAGGATGGCGTGGAGGAGTCCTCGTTGATCCACTGd-LDH MBDForward primer, GTGGGTACCATGAAATACGGCAAAGACACCTTCCReverse ... TAGTCTAGAGAGCCGGAGCATGGCGTGGAGCAGTC NS4B- CTDForward primer, GTGGGTACCATGGCGATACTGCGTCGGCACGTGGGCReverse primer, as NS4B FL NS4B- deltaCTDForward primer, as NS4B FLReverse primer, TAGTCTAGAGACCGACGCAGTATCGCTGCGCACACGAC NS4B- CTD ... between NS4B carboxy terminal domain and the membrane binding domain of D-lactate dehydrogenaseFigure 3Sequence similarity between NS4B carboxy terminal domain and the membrane binding domain of...
  • 12
  • 214
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes in Vom, Plateau State Nigeria" pot

... Schattner A:Increased risk of type 2 diabetes in noncirrhotic patients with chronic hepatitis C virus infection. Mayo Clin Proc 2000,75:355-359.18. Zein CO, Levy C, Basu A, Zein NN: Chronic ... rate of HCV replication.Plasma levels of pro inflammatory cytokines like tumornecrosis factor- alpha are increased in acute alcoholic hep-atitis and such cytokines induce insulin resistance ... BioMed CentralPage 1 of 6(page number not for citation purposes)Virology JournalOpen AccessResearch Hepatitis C Virus infection in apparentenly healthy individuals with family history of diabetes...
  • 6
  • 245
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật