Báo cáo y học: "Filicide in Austria and Finland - A register-based study on all filicide cases in Austria and Finland 1995-2005b" potx
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot
... outstatistical analysis and manuscript preparation. TBG car-ried out patient referral, clinical data analysis and manu-script preparation. MHP carried out patient referral, clinicaldata analysis and ... contributionsJV carried out sample collection, flow cytometry, data anal-ysis and manuscript preparation. SL carried out NK cytotox-icity assays and manuscript preparation. EHG carried outstatistical ... (BDPharmingen, San Diego, CA) and stained with either phy-coerythrin-conjugated mouse IgG2b anti-perforin or phyco-erythrin-conjugated mouse IgG1 anti-granzyme Bantibodies (BD Pharmingen). After...
- 8
- 365
- 0
Báo cáo y học: "Effect of small interference RNA (siRNA) for ADAMTS5 on intervertebral disc degeneration in the rabbit anular needle-puncture model" pptx
... the data. YA and KA performed dataacquisition, statistical analysis, and interpretation of data. KMparticipated in the design of the study and finalized the manu-script. YK and TK participated ... as a baseline measure-ment. Radiographs were digitally scanned and digitally storedby using an image-capture software program.Image analysis All radiographic images were independently analyzed ... JD: Analysis ofADAMTS4 and MT4-MMP indicates that both are involved in aggrecanolysis in interleukin-1-treated bovine cartilage. Oste-oarthritis Cartilage 2005, 13:26 9-2 77.15. Pattoli MA, MacMaster...
- 10
- 548
- 0
Báo cáo y học: "Logistic Organ Dysfunction Score (LODS): A reliable postoperative risk management score also in cardiac surgical patients" pps
... 2.1Combined ascending aorta and valve surgery 116 4.1Combined ascending aorta and coronary surgery 5 0.2Cardiac transplantation 24 0.9Congenital, cardiac tumors, pulmonary embolectomy,assist ... Germany.Authors’ contributionsMH: Conception and design; acquisition, analysis and interpretation of data;drafting the manuscriptAB: substantial contributions to conception and design; revising ... rtality and pro-longed ICU stay [20]. Mortality is strongly related to thenumber and severity, as well as the duration and type oforgan dysfunctions, such that the number of failingorgans and...
- 6
- 315
- 0
Báo cáo y học: "Effect of the dual endothelin receptor antagonist bosentan on untreatable skin ulcers in a patient with diabetes: a case report" ppsx
... multifactorial and includesMacrovasculopathy (arterial insufficiency), microvasculo-pathy ( neuropathy and diabetic skin microangiopathy), and an increased propensity for infection [3]. Endothelinmay ... requiredadjustments of his insulin dose and addition of on- demand fast-acting insulin. He was also receiving bicalu-tamide 50 mg/day, candesartan 16 mg/day, furosemide20 mg/day, triflusal 6 00 ... decu-bital lesions remained at Wagner grade II. In parallel,his general condition deteriorated, and vascular surgerywas contraindicated.InvestigationGiven the lack of response, risk of amputation,...
- 4
- 337
- 0
Báo cáo y học: " Adenovirus serotype 7 associated with a severe lower respiratory tract disease outbreak in infants in Shaanxi Province, China" pps
... unavailable in China. Most of the adenovirusinfections especially severe pneumonia in infants wasdiagnosed clinically with out laboratory confirmation,especially in county hospitals. Additionally, ... GAACCAGGAACCAGTCTT 2058 6-2 06037U GTGGATGGGGAAGGATAC 2054 3-2 0560 5067L TAAAGCAGGGTGGGCTCA 2103 1-2 10488U CATACCGTTCTCCAGCAACT 2091 4-2 0933 5098L ATCAAAAAGGTAGCAGGT 2140 5-2 14229U CGCCATAGTCAACACTGC ... CATTGGCTTCAGGGATAAC 1928 8-1 9306 4784L TGGCGTGTACTTGTAAAC 1974 8-1 97655U GGCAACAATCTGGCTATG 1966 1-1 9678 4935L GAGGTTGATGCTGGTGAA 2013 6-2 01536U TGGAAATGACCTCAGAAC 2008 9-2 0106 5156L GAACCAGGAACCAGTCTT...
- 7
- 271
- 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
... Tsuda, T., K aya, S., Yokoyama, T., Hayashi, Y. & Taniguchi, K.(1998) ATP and acetyl phosphate induces m olecular events nearthe ATP binding site and t he membrane dom ain of N a +,K+-ATPase:Thetetramericnatureoftheenzyme.J. ... thickness of a bilayer whichis composed of 1-palmitoyl-2-oleoyl-sn -glycero-3-phospho-choline increases by 15% from 63.2 to 72.3 A Ê[43] and thecross-sectional area occupied by hydrocarbon chains ... decreasedreaction rate of the Na+/K+-ATPasewithanincreaseinpressure can be rationalized based on a decrease in ¯uidityof the lipid bilayer with a concomitant decrease in proteinconformational...
- 9
- 432
- 0
Báo cáo y học: "Etanercept versus etanercept plus methotrexate: a registrybased study suggesting that the combination is clinically more efficacious" pptx
... present study was performed using only data collected and analysed at the Karolinska and Huddinge Hospitals.The STURE database is maintained in the RAMONA soft-ware package (Carmona, Halmstad, ... was moreefficacious in clinical practice than treatment with etaner-cept alone.Materials and methodsThe STURE database collects efficacy and safety data for all patients starting biological ... patientsreceiving etanercept as monotherapy with only partiallysatisfactory responses, the addition of MTX might giveadditional clinical benefit. While many of these implica-tions can and probably will...
- 5
- 346
- 0
báo cáo khoa học: " The health disparities cancer collaborative: a case study of practice registry measurement in a quality improvement collaborative" pot
... defined largely by age thresholds.Ultimately, a paradigm shift to population-based infor-mation systems and healthcare delivery may be necessaryto track and manage the delivery of clinical ... an adjunct to collab-orative learning sessions, and at the regional and locallevel by the Information System Specialist (ISS). Thetraining typically consisted of four- to eight-hour interac-tive ... of particularly motivated health centerswith special attention from national organizations. A minority of clinical practices has any disease registry toprovide guidance in managing the care...
- 15
- 346
- 0
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"
... product containing bitter orange extract, caffeine and green tea extract does not lead to increased cardiovascular stress and that fat oxidation may increase in certain populations. Key words: ... this study was to determine the effects of the acute ad-ministration of a product containing caffeine from guarana, p-synephrine from C. aurantium and a green tea polyphenolic extract on heart ... Smedema JP, Muller GJ. Coronary spasm and thrombosis in a bodybuilder using a nutritional supplement containing synephrine, octopamine, tyramine and caffeine. So African Med J. 2008; 98: 37 2-3 73....
- 6
- 490
- 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... determined as described [21].Onion arabinogalactan consists of 99%D-galactose and 0.3%L-arabinose and is predominantly linear. Potatoarabinogalactan consists of 86%D-galactose and 6.6%L-arabinose, ... Both types canbe substituted with a) 1-, 3-linkedL-arabinofuranose chains.Type I arabinogalactan is degraded by b-1,4-endogalacta-nase and b-galactosidase. b-1,4-Endogalactanases cleavewithin ... while soy arabinogalactan consists of 57%D-galactose and 38%L-arabinose. Methylation analysisdemonstrated that a substantial amount of theL-arabinoseresidues (14%) in soy arabinogalactan is...
- 9
- 669
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP