Báo cáo Y học: Conformational analysis by CD and NMR spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia potx

... spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia Tobias Tengel 1 , Ingmar Sethson 1 and Matthew S. Francis 2 1 Departments of Organic Chemistry and 2 Molecular Biology, ... study, we designed synthetic peptides encompassing theC-terminal amphipathicdomain of YopD. A solution structure of YopD 278)300 , a peptide t...

Ngày tải lên: 31/03/2014, 21:21

... CEACAM1 were amplified from CEACAM cDNA (gift from M. Kuroki, Fukuoka University, Fukuoka, Japan) with primer pair 5¢-ATCATA TGCAGCTCACTACTGAATCCATGCC-3¢ and 5¢-AT CGGGATCCCTAACTCACTGGGT TCTGTATTTC-3¢ and ... Microbiology, University of Amsterdam/AMC, Amsterdam, the Netherlands; 3 Department of Molecular Microbiology and 4 Department of Pharmaceutics, Utrecht University, Utre...

Ngày tải lên: 17/03/2014, 10:20

... expression in branchial epithelial cells of Japanese eel, Anguilla japonica Kentaro Miyamoto 1 , Nobuhiro Nakamura 1 , Masahide Kashiwagi 1 , Shinji Honda 1 , Akira Kato 1 , Sanae Hasegawa 2 , Yoshio Takei 2 and ... of euryhaline fishes. The proteins may contribute to remode- ling of the gill architecture and its maintenance by targeting, for degradation via the proteasomal p...

Ngày tải lên: 17/03/2014, 10:20

... concentrated to 10% of the original volume of the nuclear extract by trichloroacetic acid precipitation. The concentrated sample was analysed by SDS/PAGE (10% polyacrylamide). Amino acid sequencing of ... Hepatic cirrhosis and neuronal degeneration are the most debilita- ting symptoms of WD and are caused by the impairment of biliary copper excretion and the...

Ngày tải lên: 17/03/2014, 23:20

... analysis of hydroxylation of saturated fatty acids by recombinant P450foxy produced by an Escherichia coli expression system 7 Tatsuya 7 Kitazume 1 , Akinori Tanaka 1 , Naoki Takaya 1 , Akira ... 140 P450foxy (Fusarium) b 1200 900 2,000 a Kitazume et al. [14]. b Nakayama et al. [13]. Fig. 2. Apparent substrate specificity of rP450foxy for saturated fatty acids. Enzymatic activity...

Ngày tải lên: 08/03/2014, 22:20

... nucleotide sequence, as well as a systematic structural and functional analysis of the 5¢ flanking region of the Bsep gene. The 5¢ deletional analysis of the Bsep promoter revealed a region from nucleotide ... bases in bold) and sense (5¢-GCTAGAGCTGGACTTTATTCCATT GAAATA-TAAGCAAACAGTG-3¢) oligonucleotide of the IR-1 element was used in a temperature cycling rea...

Ngày tải lên: 17/03/2014, 23:20

... events that involves ac- tivation of many genes and synthesis of various pro- teins. The importance of several apoptotic pathways such as mitochondrial pathways and death receptor pathways has been ... There are two major intracellular apoptosis-signaling cascades; mitochondrial pathways and death receptor pathways [4]. Mitochondrial pathways are regulated by various proa...

Ngày tải lên: 31/10/2012, 15:12

... agarose gels. 3. Results Mutational analysis of hCDC4 in AML In this study the common exons 2 to 11 and the three known transcript variants of exon 1 of hCDC4 (Figure 1A) were analyzed by ... cellular pathways leading to chromosomal instability [12]. As the disruption of the above described cellular oncogenic pathways also plays an important role in hematologica...

Ngày tải lên: 31/10/2012, 16:49

... real-time RT-PCR as described above. RNA extraction and array analysis. For each array sample, the RNA was prepared from the purified thymocytes. The thymocytes were processed by using the ... genes which changed the most with age, we uploaded all of our array data into the array analysis program of the NHGRI (http://arrayanalysis.nih.gov). Table 3 lists th...

Ngày tải lên: 03/11/2012, 11:35

... plasmid specific primers (M13F-cccagtcacgacgttg taaaacg- and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc. All other chemicals were of analy- tical grade or higher quality. Animals, ... through a myotoxic/ cytolytic site distinct from the catalytic site, as already described for the inhibition of myotoxicity by heparin [44]. At least in the case of B. as...

Ngày tải lên: 21/02/2014, 01:21