Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... Journal 275 (2008) 5855–5864 ª 2008 The Authors Journal compilation ª 2008 FEBS Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium A. ... 2008)doi:10.1111/j.1742-4658.2008.06715.xSurE, the stationary- phase survival protein of Salmonella typhimurium, forms part of a stress survival operon regulated by the stationary- phase RNA polymerase alternative sigma factor. SurE ... (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC) containing a BamHI site. The genewas cloned at the NheI and BamHI sites...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... exception that sonicationwas used instead of high pressure homogenization, thepuriﬁcation was conducted on an A ¨KTAxpress system(GE Healthcare).Crystallization, data collection and structuredeterminationCrystals ... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... The Authors Journal compilation ª 2010 FEBS Structural and functional studies of the humanphosphoribosyltransferase domain containing protein 1Martin Welin1,*, Louise Egeblad2,*, Andreas...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... kinase,UMPK) from the opportunistic pathogen Ureaplasma parvum was deter-mined and showed similar three-dimensional fold as other bacterial and archaeal UMPKs that all belong to the amino acid ... Ureaplasmaparvum UMP kinase – a potential antibacterial drug targetLouise Egeblad-Welin1, Martin Welin2,*, Liya Wang1 and Staffan Eriksson11 Department of Anatomy, Physiology and Biochemistry, ... determined, as observed by Fassy et al. [14], and avoids the complication of potential UTP formation. Thecoupling enzymes (pyruvate kinase and lactate dehydroge-nase) were tested with ADP and UDP, and...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... chain and hides a large amount of the hydrophobic surface area. Surfacearea calculations for the pentamer give a total surfacearea of  81 000 A ˚2with 30% ( 24 000 A ˚2) as con-tact area. ... genewas removed using the complementary oligomers5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAACCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAATTATCGCCCCTCCCGCC-3¢ (reverse).Virus ampliﬁcation was performed ... ligand (miniﬁber), and [Ligtot] is the total con-centration of the ligand. At any total concentration of lig- and, the anisotropy depends on the total concentration ofC. Zubieta et al. Human...

Tài liệu Báo cáo khoa học: Structural and functional speciﬁcities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... gliomas, malignant astrocy-tomas and medulloblastomas [82,93,94]. The oncogenictransformation mediated by the autocrine PDGF looptakes place through activation of the ras ⁄ MAPK path-way that ... revealing a remarkable increase in contactbetween the prostate carcinoma cells and the stromalcells, which is critical for prostate cancer progression and metastases [66]. As human prostate cancer ... cleavagesites (black arrows) are denoted. Exons and introns are not drawn in scale. The PDGF -A and -B genes cover approximately 20 kb and the PDGF-C and -D cover approximately200 kb. Alternative...

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-speciﬁc polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... 2735residues are a- linked (compare published data for a -and b-rhamnopyranose, a- andb-fucopyranose [26]). This con-clusion was conﬁrmed and the a conﬁguration of ara4dHexestablished using a NOESY ... above for sugar analysis, and thepartially methylated monosaccharides derived were conver-ted into the alditol acetates and analysed by GLC-MS.Smith degradationOPS-I, OPS-II and the O-deacetylated ... immunodiffusion, passive haemaggluti-nation and inhibition of passive haemagglutination, SDS/PAGE and immunoblotting using O-antisera againstC. braakii PCM 1531 and PCM 1487.In double immunodiffusion...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: electron transfer through the nitric oxide synthase ﬂavoprotein domain pdf

... 50 and near 100%) [63,77]. At this point, the data suggestthat Keq A and the associated k on and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity ... ligand [17–19,24]. The attachedﬂavoprotein and heme domains of NOS are also anunusual feature shared by only a handful of prokary-otic CYP proteins [4,8,25].In comparison, the NOS ﬂavoprotein ... ofCaM, the CT and bound NADPH have been studiedin detail. An interesting and possibly novel connectionappears to link regulation of Keq A by the CT and Table 1. Factors that may alter conformational...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: probes of hydrogen tunnelling pptx

... substrate-binding titrations and crystallo-graphic studies when a very large amount of the sub-strate may be required; typical NAD(P)H saturationconstants for OYEs are 0.1-1 mm and as an example, a ... to a single exponential and the N18 9A trace to a 4-exponential function – see the main text for moredetails. (Inset) The same data on a split-axis linear time scale.Adapted from Pudney et al. ... cur-rently available, it appears that it is appropriate todescribe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions may be a large reorganization energy.The...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... required. Mutational and structural studies that characterize such interac-tions are the subject of this minireview. Studies on proteins from the cyanobacterium Anabaena are pref-erentially considered ... redox-based metabolisms in plastids, mitochondria and bacteria.They are also the basic prototypes for a large family of diﬂavin electrontransferases with common functional and structural properties. ... the large PSI subunits,PsaA and PsaB, via a loop that also plays a role in theattachment of PsaC [12]. PsaC, PsaD and PsaE arelocated at the cytosolic site (Fig. 1A) [2,7,13–16]. PsaCcarries...

Tài liệu Báo cáo khoa học: "Structural and Topical Dimensions in Multi-Task Patent Translation" ppt

... Extraction of a parallel patent corpus from comparable dataOur work on patent translation is based on theMAREC3patent data corpus. MAREC con-tains over 19 million patent applications and granted ... pages 818–828,Avignon, France, April 23 - 27 2012.c2012 Association for Computational Linguistics Structural and Topical Dimensions in Multi-Task Patent TranslationKatharina W¨aschle and ... differ-ent patent classes and different patent textsections such as title, abstract, and claims,as separate translation tasks, and investi-gate the inﬂuence of such tasks on machinetranslation performance....

Xem thêm

Từ khóa: tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công báo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bể tai lieu bao cao thuc tap khoa co khi tai lieu bao cao thuc tap tai khoa duoc benh vien Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ