quick efficient and consistent method of selecting text any formatting applied to a selected place holder will format all text sitting in the place holder
Báo cáo sinh học: "Mapping of a milk production quantitative trait locus to a 1.056 Mb region on bovine chromosome 5 in the Fleckvieh dual purpose cattle breed" pps
... DD 2A AAGAGGAAAGCCCGGAAGAAGGGAG G A •••••••••••GG•••••AC• G••G•••••••AAAA••AC••AAC• G A ••••••••• A A G••AC• GGA• A G•• A AAG A •••AC• G•• A G•• A •••G A •••AC• G 36 Figure Familial relationships ... accidental marker-phenotype associations when LA and LD are used separately, and also increases the power and resolution of QTL mapping by combining all available information [21] In dairy cattle, ... are paternal and maternal grandsons of A0 , and are very important Fleckvieh bull sires We have collected samples of all the available progeny-tested sons of these two grandsires and all available...
- 11
- 357
- 0
báo cáo khoa học: " A novel method for efficient and abundant production of Phytophthora brassicae zoospores on Brussels sprout leaf discs" pot
... Netherlands The Netherlands The Netherlands The Netherlands Brassica rapa subsp.pekinensis Brassica oleracea var alba Brassica oleracea var.gemmifera Brassica rapa subsp.pekinensis Brassica oleracea ... oleracea var gemmifera) and rutabaga (swedes) (Brassica napus var napobrassica) [6,7] P brassicae is mostly associated with post-harvest damage that limits the marketability of cabbage heads and can ... pathosystem, inoculated a variety of P brassicae isolates on multiple Arabidopsis accessions and defence mutants, and showed that certain combinations result in compatible and others in incompatible interactions...
- 7
- 340
- 0
Báo cáo y học: "IA simple, fast, and accurate method of phylogenomic inference" docx
... obtained from the Sargasso Sea was reanalyzed using AMPHORA and the 31 protein phylogenetic markers The microbial diversity profiles obtained from individual markers are remarkably consistent The ... developed the method, and performed the analyses JAE advised on method design and testing MW and JAE wrote the paper Additional data files Phylotyping simulation study To assess the performance of the ... of informative sites by the program [17] In addition, although many programs are available to automate the creation of multiple sequence alignments, their use for the de novo alignment of a large...
- 11
- 453
- 0
Asymptotically unbiased and consistent estimation of motif counts in biological networks from noisy subnetwork data
... Technology and Research (A* STAR) and the National University of Singapore (NUS) for the Singapore International Graduate Award (SINGA), which has provided me with the chance and financial support to fulfill ... error rates to correct the bias caused by missing and spurious links We show, theoretically and empirically, that such estimators are asymptotically unbiased and consistent, assuming that the subnetwork ... occurrences of any motif can be written in terms of the adjacency matrix A and the Bernoulli random variables Xi , ≤ i ≤ n, in a similar obs way to N1 and N1 in Eqn (2.1) and (2.2) In partitular, the...
- 157
- 343
- 0
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... canonical EF-hand motif and cause conformational changes in this motif The Ca2+ signal change and the accompanying conformational change in the canonical EF-hand are probably relayed to the SAM ... cooperativity of Ca2+ binding to EF-hand protein domains Our laboratory has developed a grafting approach to probe the site-specific Ca2+-binding affinities and metal-binding properties of CaM [14] and ... the single canonical EF-hand, there is a ‘hidden’, atypical, non-Ca2+-binding EF-hand motif that stabilizes the intramolecular inter5594 action between the canonical EF-hand and the SAM domain...
- 9
- 465
- 0
Báo cáo khoa học: "PARSING VS. TEXT PROCESSING IN THE ANALYSIS OF DICTIONARY DEFINITIONS" pot
... grammatical operation: finding the nuclei of noun phrases In conwast, a "real" parser generates a parse tree containing a wealth of structural and relational information that cannot be adequately ... parsing system, in which the tagged vocabulary is the lexicon, the tagging program is the lexical analyzer, and the head finder is a syntax analyzer using a very simple finite state grammar of ... Dictionary And it is much faster This way of looking at our results may make it appear that parsing was a waste of time and effort, of value only as a lesson in how not to go about dictionary analysis...
- 8
- 461
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... organization (rhodamine– phalloidin staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... report a study of the activation of various Hsp90 clients and Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a and...
- 11
- 427
- 0
Báo cáo hóa học: " Boundedness and Lagrange stability of fractional order perturbed system related to unperturbed systems with initial time difference in Caputo’s sense" ppt
... leads to a formulation of certain real-world problems in different areas [1,6] Fractional derivatives and integrals are also useful in pure mathematics and in applications outside mathematics include ... surfaces, quantum mechanical calculations and dissemination of atmospheric pollutants The main advantage of Caputo’ s approach is that the initial conditions for fractional order differential equations ... main advantage of Caputo’ s approach to fractional derivative is that the initial values and the notion of solution parallel the IVP of differential equations, where the derivative is of order...
- 14
- 346
- 0
Báo cáo hóa học: " Research Article Existence and Asymptotic Stability of Solutions for Hyperbolic Differential Inclusions with a Source Term" docx
... Journal of Inequalities and Applications (1.1) with λ = by making use of the Faedo-Galerkin approximation, and then considered asymptotic stability of the solution by using Nakao lemma [8] The background ... differential inclusion (1.1) involving p-Laplacian, a nonlinear, discontinuous, and multivalued damping term and a nonlinear source term The difficulties come from the interaction between the pLaplacian ... potential-well method and the Faedo-Galerkin method In Section 4, the asymptotic stability of the solutions is investigated by using Nakao lemma Statement of main results We first introduce the following abbreviations:...
- 13
- 328
- 0
Báo cáo hóa học: " Research Article Existence and Asymptotic Stability of Solutions for Hyperbolic Differential Inclusions with a Source Term" pptx
... Journal of Inequalities and Applications (1.1) with λ = by making use of the Faedo-Galerkin approximation, and then considered asymptotic stability of the solution by using Nakao lemma [8] The background ... differential inclusion (1.1) involving p-Laplacian, a nonlinear, discontinuous, and multivalued damping term and a nonlinear source term The difficulties come from the interaction between the pLaplacian ... potential-well method and the Faedo-Galerkin method In Section 4, the asymptotic stability of the solutions is investigated by using Nakao lemma Statement of main results We first introduce the following abbreviations:...
- 13
- 256
- 0
Báo cáo lâm nghiệp: "Regeneration and game damage in the Krušné hory Mts. assessed on the basis of National Forest Inventory of the Czech Republic" pps
... 32% of individuals in the investigated area (open space 34% of damaged individuals, below the stand 32% of damaged individuals) whilst average damage in the CR is 21% of damaged individuals Table ... Table Total damage to individuals in regeneration by game Totally Open space Under stand number of individuals/ha number of individuals/ha number of individuals/ha average (%) average (%) average ... separate parts of circular shape with the radius of 12.62 m and their centres 300 m apart from each other According to the type of terrain an inventory plot could be divided into partial areas...
- 14
- 438
- 0
Báo cáo lâm nghiệp: "Analysis of snow accumulation and snow melting in a young mountain spruce and beech stand in the Orlické hory Mts., Czech Republic" pptx
... quite interrupted in the open area In the final stage of melting in the last decade of April, the snow melting rate in spruce reached about 26 mm/day, in beech about 28 mm/day and in the open area ... predominating part of water infiltrates to the underlying rock and then drains away without any damage can be considered to be the most important finding These conclusions agree with findings ... (cm) the situation in the spruce stand has to be taken into account at interpreting and analyzing results of depth/weight measurements of the snowpack For the actual measurement of snow a verified...
- 15
- 348
- 0
Báo cáo y học: "Central fatigue and nycthemeral change of serum tryptophan and serotonin in the athletic horse" potx
... hypothesized that tryptophan infusion may increase fTrp (free-tryptophan) and the fTrp -to- BCAA (branched-chain amino acids) ratio in plasma at the same time as it decreases treadmill endurance in ... tryptophan hydroxylase (TPH) and aromatic L-amino acid decarboxylase [2,11] 5-HT is a metabolic precursor of melatonin in the pineal gland and is believed to be involved in the control of sleep and ... stripes at the bottom of the graphic represent dark and light duration of the natural photoperiod able ad libitum The horses were trained from 15:00 to 16:00 Training included walking, trotting, galloping...
- 4
- 291
- 0
Báo cáo y học: "The accuracy of echocardiography versus surgical and pathological classification of patients with ruptured mitral chordae tendineae: a large study in a Chinese cardiovascular center" ppt
... tests of thoracic echocardiography (TTE) and transesophageal echocardiography (TEE) with the gold standards of surgical findings and pathological examination Materials and methods Patients and clinical ... echocardiogram of the MV and chordae tendineae A: Myxomatous degeneration The structure of the valve is crumbly and the main changes are myxoid degeneration and no inflammation A : Myxomatous ... subvalvular chordae in the myxomatous group was higher than that in the other groups, and the incidence of valvular thickening combined with AV damage in the CRV group was higher than that in the...
- 7
- 279
- 0
Báo cáo khoa hoc:" A study of association between common variation in the growth hormone-chorionic somatomammotropin hormone gene cluster and adult fasting insulin in a UK Caucasian population" doc
... TMF co-ordinated the study and supervised the redrafting of the manuscript All authors read and approved the final manuscript Acknowledgements We thank Ian Day and Tom Gaunt from Southampton University ... study to assess the role of CSH1.01 variation in measures of fetal and postnatal growth and adult insulin resistance, as measured by fasting insulin concentrations and Homeostasis Model Assessment ... Using unlogged fasting insulin data, we obtained a more conservative estimate, but still are able to exclude increases in fasting insulin above 15.4 and 17.8 pmol/l for TT relative to D1D1 and...
- 7
- 353
- 0
Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx
... DR and CC were involved in analysis of data and suggesting experimental design for the study All authors have read and approved the final manuscript Authors’ information PLS is an Assistant Professor ... exposed to autoradiography cDNA fragments of different lengths and intensities are shown here In actual autoradiograph, we were able to observe the largest cDNA bands of 72 nt, 48 nt and 54 nt in ... same rate as DNA band number increases Three to five independent processivity assays were performed for each RT and statistical values that include mean, median, standard deviation and maximum and...
- 12
- 369
- 0
Báo cáo y học: " Correlation between nucleotide composition and folding energy of coding sequences with special attention to wobble bases" docx
... study at hand is a specific case where the folding free energy of an mRNA is used as a measure for adapting structural features and the suggestions that wobble bases are important in carrying parallel ... has a strong positive effect on the accumulated affinity of codons in the nucleic acid (mRNA structure) and the relative frequencies of amino acids in the coded protein generally and co-locating ... redundancy seems to have its own meaning Synonymous codons are interchangeable in regard to amino acid coding, but their effect is individual and additive in respect of their role in determining the...
- 8
- 205
- 0
Nutritional status and effectiveness of interventions to reduce stunting malnutrition among children under 5 years old in the costal plain area, nghe an province
... for analyzing the causes of stunting malnutrition including prenatal and postnatal factors The prenatal factors including internal factors and external factors; a few studies on prenatal stage ... Vitamin A has the effect of promoting the absorption of zinc, whereas vitamin A deficiency also affects the absorption of zinc due to the decrease in zinc transport protein synthesis in intestine ... INDICATORS AND VARIABLES General information group Anthropometric indices Evaluating indicators of worm infection Hb index Indicators of assessing knowledge and practice of mother Intervention...
- 29
- 562
- 0
Electrode formulation of si and lini0 5mn1 5o4 for li ion battery applied to electric traction
... only in ionic form in electrolytes and in atomic scale in oxide cathode materials and when intercalated into carbon anodes [4] The main working principle of LIBs is the reversible electrochemical ... amount of binder Insuring the right quantity of the binder is also very important In addition to the type of binder and non electroactive conducting additive, the ratio of the binder and the conductive ... attributed to the intrinsic structural instability of the material when more than half of the Li ions are extracted On the other hand, the presence of toxic and expensive Co ions in LiCoO2 has...
- 178
- 249
- 0
Application of genetic markers for identification of halophila members and genetic variation of halophila ovalis from western pacific to eastern indian ocean
... Vietnam Florida, USA Malaysia Australia Florida, USA Costa Rica Malaysia Nakagusuku, Japan Nakagusuku, Japan Oaura, Japan Izena Island, Japan Nha Trang, Vietnam Italy Bali, Indonesia Sumbawa, Indonesia ... distance from intramarginal vein to lamina margin, cross-vein angle, and the number of cross veins The ratio between intramarginal veins and the width at the half-length of the lamina was calculated ... Indonesia Kagoshima, Japan Nha Trang, Vietnam Odawa Bay, Japan Mutsu Bay, Japan Suou-Ohshima, Japan Philippines Guam Flores Island, Indonesia Dingo Beach, Australia Trang, Thailand Trang, Thailand Nakagusuku,...
- 170
- 345
- 0
- jeanne marie bouvier de la motte guyon a short and easy method of prayer
- objective and task method of sales budgeting
- qualitative and quantitative method of sales forecasting
- a simple fast and accurate method of phylogenomic inference
- a simple fast and accurate method of phylogenetic inference
- highly efficient and ultraprecision fabrication of structural ceramic parts with the application of electrolytic in process dressing grinding
- 3connotation and research method of digital manufacturing science
- the uniform and consistent interpretation of the modified langmuir equation general considerations
- the uniform and consistent interpretation of the modified fowler guggenheim equation
- the uniform and consistent interpretation of the modified volmer equation
- the uniform and consistent interpretation of the modified de boer hobson equation
- the uniform and thermodynamically consistent interpretation of g s isotherm equations applied for heterogeneous surfaces a the to´th equation
- mechanism and method of single atom pyramidal tip formation from a pd covered w tip
- fluent efficient and automatic repertoires of athletic performance
- isolation and purification method of mouse fetal hepatoblasts
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose