0

ads p 2 as a solvable group manifold

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Báo cáo khoa học

... cDNAs derived from human mammary arteries were amplified by RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1 -2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, ... 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCA TTCTTCAGGTCGATATTGTGCAAC-3¢ PCR products were ... Journal compilation ª 20 11 FEBS PDZ3 PDZ-1 -2 PDZ3 PDZ-1mut -2 PDZ-1 -2 kDa 50 Media Ct B PDZ-1-2mut A PDZ-1-2mut hDlg in ERK cascade PDZ-1mut -2 O Maıga et al ¨ WB Myc 37 SD-LT 25 50 AD 50 GAPDH...
  • 11
  • 419
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Hóa học - Dầu khí

... Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin -2 receptor-alpha gene and mode of onset of type diabetes ... in organ-specific autoimmunity: implications in pathophysiology and translation to human disease Eva d’Hennezel1†, Mara Kornete1†, Ciriaco A Piccirillo2* Abstract Peripheral immune tolerance requires ... the age of onset, and so as strongly as the HLA-DQ2/DQ8 predisposing haplotype [35] Furthermore, the predisposing haplotype of CD25 SNPs described by Qu et al [29 ] was found to correlate with acute-onset...
  • 12
  • 573
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc

Báo cáo khoa học

... Including patients with both skeletal and extra-skeletal metastases FA -2 Assays The serum samples were transported at -20 °C to the Williamson Laboratory at St Bartholomew's Hospital FA -2 radioimmunoassays ... daily clinical practice Abbreviations FA -2: Foetal antigen 2; CA15.3: Cancer antigen 15.3; CEA: Carcinoembryonic antigen; PBC: Primary breast cancer; LAPC: Locally advanced primary breast cancer; ... cancer; ABC: Advanced breast cancer; PICP: Carboxyterminal propeptide of type I procollagen; PINP: Aminoterminal propeptide of type I procollagen; ICTP: Type I collagen carboxyterminal telo peptide...
  • 4
  • 286
  • 0
Group 2 allergens from dust mite  epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

Khoa học xã hội

... Scorpione (scorpions) Glycyphagidae Lepidoglyphus Suidasiidae Astigmata Suidasia Echimyopodidae Aranae (spiders) Blomia Chortoglyphidae Chortoglyphus Dermatophagoides Pyroglyphidae Euroglyphus ... type C2 ORF open reading frame PBMC peripheral blood mononuclear cells PBS phosphate buffered saline PBS-T phosphate buffered saline – Tween20 PCR polymerase chain reaction PDB Protein Data Bank ... samples 22 2. 4 Immunological assays 22 2. 4.1 Immuno dot blot 22 2. 4 .2 Specific IgE binding ELISA 23 2. 4.3 Inhibition ELISA 24 2. 4.4 Histamine release assay 25 2. 4.5 Dust sample collection, processing...
  • 235
  • 904
  • 0
giáo án lớp 2 chuẩn kiến thức kỹ năng tuần 4

giáo án lớp 2 chuẩn kiến thức kỹ năng tuần 4

Tiểu học

... Yêu cầu l p tự làm vào - Mời em lên ch a * Giải : Số học sinh hai l p có : 29 + 25 = 54 ( học sinh ) Đ/S: 54 học sinh - Tóm tắt : L p A : 29 học sinh L p 2B : 25 học sinh Cả hai l p : học sinh ... 49 + 25 = 74 - Một em đọc đề - Tự làm vào vở, hai em ngồi cạnh đổi chéo để kiểm tra chéo - Em khác nhận xét bạn - Đọc đề - Số HS l p 2A 29 , B 25 bạn - Tổng số học sinh hai l p - Ta thực ph p cộng ... Biết thực ph p cộng có nhớ phạm vi 100, dạng 29 +5; 49 + 25 - Biết thực ph p cộng cộng với số để so sánh hai số phạm vi 20 - Biết giải toán ph p cộng II Đồ dùng dạy học : - Đồ dùng phục vụ trò...
  • 21
  • 727
  • 1
giáo án lớp 2 tuần 5 chuẩn KTKN

giáo án lớp 2 tuần 5 chuẩn KTKN

Tiểu học

... g p bẻ đuôi máy bay ngang sang hai bên hướng máy bay chếch lên ph a phóng lên không trung - Gọi em lên bảng thao tác bước g p máy bay đuôi rời l p quan sát Sau nhận xét uốn nắn thao tác g p ... máy bay , gạch chéo phần th a C¾t bá phÇn th a Bước :- l p máy bay hoàn chỉnh sử dụng - Mở phần đầu cánh máy bay , cho thân máy bay vào g p trở lại cũ máy bay hoàn chỉnh H10 g p đôi máy bay theo ... -G p đường dấu g p hình 1b Sau mở tờ giấy cắt theo đường n p g p để hình vuông hình chữ nhật H2 a H2b Bước :- G p đầu cánh máy bay -G p đôi tờ giấy hình vuông theo đường chéo hình tam giác H3a...
  • 27
  • 526
  • 0
Giao án lóp ghép 2 trình độ

Giao án lóp ghép 2 trình độ

Tiểu học

... nh¶y c a bµi TDPTC - BiÕt c¸ch ch¬i vµ tham gia ch¬i ®ỵc c¸c trß ch¬i II - chn bÞ dơng cơ: - S©n t p - Cßi III - néi dung vµ ph¬ng ph p: Néi dung Thêi gian Ph¬ng ph p - L p trëng t p h p l p, b¸o ... theo tiêu chí Gv đ a Lắng nghe Thø n¨m ngµy 12 th¸ng 11 n¨m 20 09 L p 2: T p viÕt Bµi 12: ch÷ hoa : K A/ Mơc tiªu: KiÕn thøc: BiÕt viÕt ®óng ® p ch÷ hoa K, viÕt hoa theo hai cì v a vµ nhá BiÕt viÕt ... ®¸nh Ph¬ng ph p - L p trëng t p h p l p, b¸o c¸o - HS chÊn chØnh ®éi ngò trang phơc t p lun - Theo ®éi h×nh hµng ngang - Theo ®éi h×nh vßng trßn - C¸n sù ®iỊu khiĨn l p t p8 ®éng t¸c ( lÇn nh p) ...
  • 350
  • 372
  • 0
Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Hệ điều hành

... Select appropriate strategies to secure a Proxy Server solution Select appropriate strategies to enhance Proxy Server availability Select appropriate strategies to improve Proxy Server performance ... hosts while providing performance within given application response times Support for all mission-critical applications to be available 24 -hours -a- day, 7-days -a- week Connectivity The applications ... in patent and copyright law Read the scenario and answer the questions Be prepared to discuss your answers with the class Scenario A legal firm specializes in patent and copyright law At each...
  • 62
  • 359
  • 0
Giáo án âm nhạc lớp 2 - Tuần 1-35

Giáo án âm nhạc lớp 2 - Tuần 1-35

Tiểu học

... đua biểu diễn trớc l p H 3: Hat kờt hp tro chi: Tro chi 1: - Nghe go tiờt tõu oan cõu hat bai + HS nghe phat hiờn o la tiờt tõu cua cõu hat 2, 3, bai Tro chi 2: - Hat giai iờu cua bai bng cac ... bai bng cac nguyờn õm o, a, u, i + Bung boong binh boong ngõn O o o o o A a a a U u u u nga tiờng cụng vang vang o o o o o - L p thực * Phõn kờt thuc - Ca lp hat lai toan bai lõn - Giáo dục HS giữ ... - GV nhận xét s a sai khích lệ - Tụ chc cho hs chi tro chi - GV go tt cua cõu hat bai cho hs oan la tt cua cõu hat nao? - Hng dõn hs cach hat thay li ca bng cac nguyờn õm o, a, u, i - GV yêu...
  • 37
  • 1,325
  • 24
giaó án lớp 2 tuần 17

giaó án lớp 2 tuần 17

Tiểu học

... L p Chiều thứ hai, ngày 13 tháng 12 năm 20 10 Lý Thi ̣ Bích Hoa ƠN TOAN ́ Ôn phe p cợng và phe p trừ I.Mục tiêu: :- Gi p HS củng cố tính chất giao hốn ph p cộng Quan hệ ph p cộng ph p ... ba ngày 14 tháng 12 năm 20 10 ÔN TOÁN: ÔN LUYỆN I.Mục tiêu: -Ôn t p ph p cộng ph p trừ( Ti p theo) -Gi p HS củng cố tính chất giao hốn ph p cộng Quan hệ ph p cộng ph p trừ Giải tốn nhiều II- ... Tìm thành phần ch a biết ph p cộng , ph p trừ Số ph p cộng ph p trừ II- Các hoạt động dạy học: Hoạt động thầy 1.Hướng dẫn học sinh làm t p t p Toán : Bài 1: Gọi HS nêu yêu cầu bài, l p đọc nhẩm...
  • 18
  • 347
  • 1
giáo án lớp 2 tuần 18  hoàn chỉnh

giáo án lớp 2 tuần 18 hoàn chỉnh

Tiểu học

... L p 2A có 29 học sinh, l p 2B có nhiều l p 2A học sinh Hỏi l p 2B có học sinh? Câu 7: Viết ph p cộng có số hạng tổng Câu 8: Thứ ba tuần ngày 20 tháng 12 Vậy thứ ba tuần sau ngày mấy? a Ngày 26 ... 48+ 12= 12+ 48 To¸n KIỂM TRA THI THỬ I/ Mục tiêu : Kiểm tra t p trung vào nội dung sau: -Cộng, trừ phạm vi 20 -Ph p cộng, ph p trừ có nhớ phạm vi 100 -Giải toán có lời văn ph p tính cộng ph p trừ ... hạng ph p cộng làm phần a HS làm - Làm Sau HS đọc ch a Các HS khác tự kiểm tra bảng l p -Ti p tục cho HS nêu cách tìm số bò trừ, số trừ, -Học sinh thực hiệu ph p tính trừ Sau yêu cầu làm Số 32 12...
  • 20
  • 556
  • 2
Tài liệu Giáo án  lớp 2 tuần 19 hoàn chỉnh

Tài liệu Giáo án lớp 2 tuần 19 hoàn chỉnh

Tiểu học

... em lµm b¶ng l p, 22 + 22 + 22 + 22 ; 35 + 35 + 35 nhËn xÐt, nªu l¹i c¸ch ®Ỉt tÝnh vµ c¸ch 14 +14 + 14 + 14 + 14; 32 + 32 + 32 tÝnh - GV lu ý HS trêng h p cã nhí - Bµi 2: TÝnh 42 28 +24 + 17 - HS ... viÕt 2x5 = 10 nh©n b»ng 10 - GV v a nªu v a g¾n b a lªn b¶ng HS nªu: lµ th a sè - C¸c thµnh phÇn c a ph p nh©n lµ th a sè - Yªu cÇu HS nªu tÝch c a ph p 10 lµ tÝch nh©n 2x5 - 2. 2 Lun t p : Bµi ... häc ¤ n to¸n: ph p nh©n I- Mơc tiªu: - BiÕt chun tỉng c a nhiỊu sè h¹ng b»ng thµnh ph p nh©n - BiÕt ®äc, viÕt kÝ hiƯu c a ph p nh©n - BiÕt c¸ch tÝnh kÕt qu¶ c a ph p nh©n d a vµo ph p céng II- §å...
  • 28
  • 588
  • 1
Tài liệu Các Ứng Dụng Của Windows tập 2 docx

Tài liệu Các Ứng Dụng Của Windows tập 2 docx

Kỹ thuật lập trình

... aDOM.DocumentElement.Attributes.Append(aAttribute); //Add the Last Name attribute to XML aAttribute = aDOM.CreateAttribute("LastName"); aAttribute.Value = txtLName.Text; aDOM.DocumentElement.Attributes.Append(aAttribute); ... h p Dialog gọi sử dụng: PageSetupDialog aPageSetup = new PageSetupDialog(); System.Drawing.Printing.PrintDocument aDoc = new System.Drawing.Printing.PrintDocument(); aPageSetup.Document = aDoc; ... aSaveFileDialog.OverwritePrompt = true; aSaveFileDialog.Title = "Save file for custom application"; if (aSaveFileDialog.ShowDialog() == DialogResult.OK) { //Do something useful with aSaveFileDialog.FileName; } aSaveFileDialog.Dispose();...
  • 33
  • 341
  • 0
Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

Hệ điều hành

... IP performance IP Stack IP Stack Delay and Latency IP MTU Data Data Data Data IP TCP Data Link Link Link IP TCP Data Link Header Trailer Trailer Header MSS To optimize the flow of TCP/IP data ... Points TCP/IP Protocol Suite Data link Data link Data link Data link Physical Physical Physical Physical Telnet Telnet FTP FTP SMTP SMTP DNS DNS TCP TCP SNMP SNMP UDP UDP IGMP ICMP IP IP ARP Ethernet ... Driver IPSec Driver SA SA TCP/UDP TCP/UDP Transport Layer Transport Layer IPSec Driver IPSec Driver Internet Layer Encrypted IP Packets ID 50 Encrypted TCP/UDP ESP IP ESP TCP/UDP ESP IP ESP Data TRL...
  • 58
  • 439
  • 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học

... luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed ... as described [17] Radioactive probes were prepared by PCR using 5¢ [3 2P] -labelled CAT primer, the M13 primer and pCAT-ANT2-()546/ )23 5)wt [14] or pCAT-Go -2- ANT2()546/ )23 5)wt [13] as the template ... polyacrylamide gel The gels were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site -2 wt,...
  • 8
  • 426
  • 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học

... Apparent dissociation constants (K dapp ) of complex M.EcoRIIDNA AdoHcy were calculated as described in Materials and methods Relative K dapp [K dapp (rel.)] were calculated as ratio of K dapp ... M.HhaI by 2P was accompanied by a methyl group transfer to the 2- pyrimidinone base Our study allows us to assume that there are two ways of formation of covalent adducts between C5 MTases and 2P- containing ... 5Â-GCCAA2PCTGGCTCT-3Â/ III 3Â-CGGTT-GGACCGAGA-5Â 5Â-GCCAAC2PTGGCTCT-3Â/ K dapp (rel.) (%) 3Â-CGGTTG-GACCGAGA-5Â IV 5Â-GCCAACC2PGGCTCT-3Â/ 3Â-CGGTTGG-ACCGAGA-5Â binding and methylation of canonical...
  • 9
  • 437
  • 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Báo cáo khoa học

... column (Amersham Pharmacia Biotech, Uppsala, Sweden) and NaCl ⁄ Pi pH 7.4 buffer or an affinity chromatography method developed for Sel-tagged proteins, applying phenyl arsine oxide sepharose, ... IgE against D pteronyssinus as determined with Pharmacia CAP SystemTM, Pharmacia Diagnostics, Uppsala, Sweden) was used for detection as earlier described [ 42] In control experiments with Sel-tagged ... radioactivity was determined using a gamma counter (Cobra II AutoGamma, Packard Instrument Company, Meriden, CT, USA) The labelled allergen ([75Se]Der p 2) was purified from endotoxins and prepared...
  • 12
  • 518
  • 0
Xây dựng thương hiệu với A.S.A.P (P 2) docx

Xây dựng thương hiệu với A.S.A.P (P 2) docx

Tiếp thị - Bán hàng

... với A. S .A .P: A = Advantage (Lợi ch a đựng thông đi p gửi đến khách hàng) S = Style (Phong cách thông đi p) A = Adjective (Thông đi p có đặc trưng gì) P = PMS Color (Màu sắc trực quan thông đi p) ... công bạn Sau cùng, hình ảnh bạn - phản chiếu cách thiết kế phong cách thể danh thi p, kênh website marketing – cách ti p cận tình cờ bạn giới thiệu công ty với khách hàng tiềm Vậy để bạn l a chọn ... luận “lợi thế” (advantage) vào báo lần trước, giải thích “phong cách” (Style) Phong cách bạn gì? Bước cần xác định hình tượng cho công ty bạn Một hình tượng chuyên nghi p nắm vai trò then chốt...
  • 6
  • 463
  • 0
Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

Báo cáo khoa học

... metabolism? Proc Natl Acad Sci USA 93, 15086–15091 Saito, Y., Hayashi, T., Tanaka, A. , Watanabe, Y., Suzuki, M., Saito, E & Takahashi, K (1999) Selenoprotein P in human plasma as an extracellular ... 20 02 Selenoprotein P as a selenium supply protein (Eur J Biochem 26 9) 5747 provided by Ajinomoto, Co Inc., Kawasaki, Japan Human serum albumin and human outdated frozen plasma was kindly donated ... Germain, D.L (1995) Cloning and expression of a cDNA for a mammalian 20 21 22 23 24 25 26 27 28 type III iodothyroninedeiodinase J Biol Chem 27 0, 16569– 1657511 Tamura, T & Stadtman, T.C (1996) A...
  • 6
  • 370
  • 0
moving as a child part 2 conversation

moving as a child part 2 conversation

TOEFL - IELTS - TOEIC

... Moving As A Child Part Conversation knickers: a type of girls pants that not go below the knees back in style: to be fashionable again horrible: very bad playground: a place where children play Kristin: ... can’t imagine It was the worst I, I mean I think for the first two years I lived in Pennsylvania I just wanted to hop on a bus and get back to New York as fast as I could Kristin: Yep, that was me… ... was starting second grade And my younger brother and I had a really rough time www.LearnRealEnglish.com © Copyright 20 08: Learn Real English, LLC Moving As A Child Part Conversation looking back:...
  • 4
  • 416
  • 3

Xem thêm