Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

GROUP ALLERGENS FROM DUST MITE: EPITOPE MAPPING AND FUNCTIONAL CHARACTERIZATION OF DER P 2, AND IDENTIFICATION OF A PARALOGUE OF DER F KAVITA REGINALD (B.Sc (Hons.), UPM) A THESIS SUMBITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCE NATIONAL UNIVERSITY OF SINGAPORE 2006 Acknowledgements It is close to impossible to good scientific research in graduate school without help As most other students who have taken the same path will agree, it is a long and arduous journey, with short bursts of satisfactions when discoveries are made There have been many people who have helped me in my journey as a young scientist in graduate school, and I wish to extend my thanks to them in this section My supervisor, Dr Chew for the research opportunity and guidance in the last years My lab mates, for assistance in laboratory techniques and continually giving me constructive suggestions A big thanks goes out to Tan Ching for the immunological experiment techniques, and Siew Leong for advice and assistance in the protein studies The allergic patient volunteers, for your time and cooperation throughout this study My friends in university Special thanks goes out to Sai Mun and Souvik for always giving me timely assistance and advice in so many areas of research Also to Shruthi, who has been of great assistance for databasing, and analysis of some sections To Vaane, Grace, and Dr Tan for patiently reading and editing the thesis To Siva, for lending technical help My collaborator, Dr Markus, for being an inspirational scientist, and giving me the opportunity to venture into the study of lipids Also to members of his research lab, especially Guanghou and Gek Huey whom I have worked closely with My friends outside university I thank all of them for making my stay in Singapore a fulfilling one To Radhi, Shion, Ken, Shih Lene and Wan Yee, needless to say, I have thoroughly enjoyed all our house parties, cook outs and chill out sessions To Shashi, Harveen, Jam and Punam, you have evolved from friends to my family I have no words to express my gratitude The Sahaja Yogis How would you thank those who have helped you to connect to your spirit? There are no words, just bliss You have helped me discover the true meaning of life, and made it possible for me to go through the difficult moments A huge hug for the ‘world collective’ especially to Geethanjali and Michalis for your assistance My family Without their blessing and continual support, none of this would be possible The Divine i Disclaimer Some parts of the experiments were done together with other lab members, and are listed here In chapter 3, IgE inhibitions were done together with Aaron Chen In chapters 3-8, screening of IgE reactions was done together with Yap Kwong Hsia In chapter 4, cloning of Blo t was done together with Kway Kwee Theng Quantification of allergen concentration in dust samples was done with Kelly Goh Extraction of native Blo t was done with Alvin Histamine release assay was done with Gavin Study of isoforms was done with Jia Yi In chapter 5, immmunostaining and southern blot analysis was done together with Dr Tan Chye Ling Quantification of allergen concentration in dust samples was done with Chen Simin Phylogenetic analysis was done with Shruthi and Dr Yap Von Bing In chapter 6, mass spectrometry was done together with Shui Guanghou Docking analysis was done with Chua Gek Huey In chapter 8, the cytokine assay was done together with Dr Ong Tan Ching ii List of conference abstracts and book chapters International Conference Abstracts Reginald K, L Haroon-Rashid, YS Sew, SH Tan, FT Chew (2002) Identification of putative Tyrophagus putrescentiae allergens with sequence homology to other known allergens by expressed sequence tagging In: XXIth European Academy of Allergology and Clinical Immunology Annual Meeting (EAACI), June 2002, Naples, Italy Allergy 57 (Suppl 73): 286-7 Loo AHB, SPL Tan, AC Angus, KT Kuay, K Reginald, YF Gao, FT Chew (2003) Genetic Relationship Between Allergy-Causing Dust Mites: Phylogenetic Inference From Random Amplified Polymorphic DNA (RAPD) Markers, Housekeeping Gene (18S rDNA) And Group Allergens In: The 60th American Academy of Allergy and Immunology Annual Meeting, - 12 March 2003, Denver, USA J Allergy Clin Immunol 111 (2): S162 K Reginald, XZ Bi, ST Ong, FT Chew (2003) Profiling of Crude Allergen Extracts Using SELDI Mass Spectrometry for Rapid Standardization In: The 60th American Academy of Allergy and Immunology Annual Meeting, - 12 March 2003, Denver, USA J Allergy Clin Immunol 111 (2): S242 AHB Loo, SY Goh, K Reginald, YF Gao, H Jethanand, HS Shang, FT Chew (2004) Validation of the Purity of Acarid Mite Cultures Used for Allergen Extract Preparation and Identification of Contaminants by Ribosomal DNA Sequencing via a PCR-Cloning- and Sequence Homology-Based Approach In: The 61th American Academy of Allergy and Immunology Annual Meeting, 19 - 24 March 2004, San Francisco, USA J Allergy Clin Immunol 113 (2): S140 K Reginald, YF Gao, YS Siew, HS Shang, FT Chew (2004) Cross Comparison of the IgE Binding Profiles to Recombinant Allergens from Suidasia medanensis, Blomia tropicalis and Dermatophagoides farinae using Sera from Blomia- and Dermatophagoides-Predominant Environments In: The 61th American Academy of Allergy and Immunology Annual Meeting, 19 - 24 March 2004, San Francisco, USA J Allergy Clin Immunol 113 (2): S228-9 Reginald K, Gao YF, Lim YP, Chew FT (2004) The expressed sequence tag catalogue and allergens of dust mite, Suidasia medanensis In: XXIIIth European Academy of Allergology and Clinical Immunology Annual Meeting (EAACI), June 2004, Amsterdam, The Netherlands Tay ASL, Shang HS, Bi XZ, Reginald K, Gao YF, Angus AC, Ong ST, Wang WL, Kuay KT, Wang DY, Mari A, Chew FT (2005) Component-Resolved Diagnosis Of House Dust Mite Allergy With A Large Repertoire Of Purified Natural And Recombinant Allergens From The Major Species Of Mites Worldwide In: The 62th American Academy of Allergy and Immunology Annual Meeting, March 2005, San Antonio, USA J Allergy Clin Immunology, 115 (2): S164 iii Reginald K, Wenk MR, Chew FT (2005) The major mite allergen from Dermatophagoides pteronyssinus, Der p 2, is a sterol binding protein In: The 62th American Academy of Allergy and Immunology Annual Meeting, March 2005, San Antonio, USA J Allergy Clin Immunology, 115 (2): S88 Tan CL, Reginald K, Chew FT (2006) Genomic organization and characterization of group allergen paralogs from Dermatophagoides farinae In: The 63th American Academy of Allergy and Immunology Annual Meeting, March 2006, Miami, Florida, USA J Allergy Clin Immunology, 117 (2): S120 Reginald K, Chew FT (2006) Epitope mapping of Der p by site directed mutagenesis: Differential IgE binding epitope profile among individuals sensitized to only Dermatophagoides spp and those with non-pyroglyphid mite responses In: The 63th American Academy of Allergy and Immunology Annual Meeting, March 2006, Miami, Florida, USA J Allergy Clin Immunology, 117 (2): S118 Book Chapter Reginald K, Sew YS, Haroon-Rashid L, Kulaveerasingam H, Tan SH, Chew FT Chapter 49 Identification of putative Tyrophagus putrescentiae allergens with sequence homology to other known allergens by Expressed Sequence Tagging Progress in Clinical Immunology and Allergy in Medicine Edited by Gianni Marone (invited Book Chapter) iv Table of contents Page Acknowledgements i Disclaimer ii List of conference abstracts and book chapters iii Table of contents v List of figures xi List of tables xv List of abbreviations xvi Summary xx Chapter 1: Introduction 1.1 Literature Review 1.1.1 Allergy 1.1.2 Dust mites 1.1.3 Dust mite allergens 1.1.4 Immunotherapy as a treatment for allergic diseases 12 1.2 Aims 14 Chapter 2: Materials and methods 16 2.1 Cloning, mutagenesis, DNA sequencing and gene characterization 16 2.1.1 Sub-cloning and site-directed mutagenesis 16 2.1.2 RT-PCR of putative Blo t using degenerate primers 16 2.1.3 DNA sequencing 17 v 2.1.4 Isolation of Blo t isoforms 18 2.1.5 Isolation of the genomic DNA encoding for Der f and Der f 22 18 2.1.6 Genomic DNA extraction, Southern Blot analysis and hybridization 19 2.2 Protein expression, purification, CD analysis and antibody generation 20 2.2.1 Expression and purification of wild type and mutant allergens 20 2.2.2 Isolation of native Blo t 21 2.2.3 Circular dichroism (CD) spectropolarimetry 21 2.2.4 Gel Filtration 21 2.2.5 Generation of rabbit polyclonal antibodies 22 2.3 Serum samples 22 2.4 Immunological assays 22 2.4.1 Immuno dot blot 22 2.4.2 Specific IgE binding ELISA 23 2.4.3 Inhibition ELISA 24 2.4.4 Histamine release assay 25 2.4.5 Dust sample collection, processing and quantification 25 2.4.6 Staining and immunoprobing 26 2.4.7 Skin prick test 26 2.4.8 Isolation of PBMC and measurement of proliferation upon stimulation with wild type or mutant allergen 27 2.4.9 Measurement of excreted cytokines 28 2.4.10 Mouse immunization 28 2.4.11 Inhibition of human IgE binding to Der p by specific mouse IgG antibodies 2.5 Computer based characterization and analysis 28 29 vi 2.5.1 Analysis of DNA and protein sequences 29 2.5.2 Three dimensional protein structure predictions 29 2.5.3 Phylogenetic sequence analysis 30 2.5.4 Docking of cholesterol to Der p 31 2.6 Lipid assays 2.6.1 Liposome preparation 33 33 2.6.2 Detection of liposome binding to Der p by liposome sedimentation and SDS-PAGE 33 2.6.3 Lipid ELISA 34 2.6.4 Extraction of lipid fraction from Der p 34 2.6.5 HPLC/APCI/MS/MS analysis of cholesterol 35 2.7 Statistical analyses 36 2.8 Approval 36 Chapter 3: IgE reactivity and cross reactivity profiles of group allergens 37 3.1 Introduction 37 3.2 Cloning and sequence analysis of Ale o 2, Sui m and Blo t 39 3.3 IgE reactivity to group allergens 50 3.3.1 IgE reactivity to group allergens in the Singaporean population 50 3.3.2 IgE reactivity to group allergens in the Italian population 56 3.4 Further characterization of Blo t 61 3.4.1 Isolation of native Blo t 61 3.4.2 Histamine release of Blo t 61 3.4.3 Blo t is present in the environmental dust samples 64 3.4.4 Isoforms of Blo t 66 vii 3.5 Discussion 69 Chapter 4: Identification and characterization of Der f 22, a novel allergen from Dermatophagoides farinae: a paralogue of Der f 2? 75 4.1 Introduction 75 4.2 Identification, isolation and characterization of Der f 22 76 4.3 Genomic organization of Der f 22 and Der f 83 4.4 Southern blot analysis 86 4.5 IgE binding capacities of Der f 22 and Der f 88 4.6 Localization of Der f 22 and Der f on sectioned D farinae 92 4.7 Concentration of Der f 22 and Der f in the indoor environment 94 4.8 Der f and Der f 22 binds to cholesterol 96 4.9 Presence of paralogues of group allergens 98 4.10 Discussion 101 Chapter 5: Der p is a cholesterol binding protein 105 5.1 Introduction 105 5.2 Der p binding to liposomes 107 5.3 Binding of Der p to purified lipids 109 5.4 Analysis of lipid extracts from nDer p and rDer p 112 5.5 Characterization of potential cholesterol binding sites in Der p via site directed mutagenesis 114 5.6 Native Der p and two other allergens of the ML domain family bind to cholesterol 117 5.7 Docking of cholesterol on Der p 119 viii 5.8 Discussion 121 Chapter 6: IgE epitope mapping of Der p 125 6.1 Introduction 125 6.2 Design and production of Der p alanine mutants with single amino acid substitution 127 6.3 Reaction profile of dust mite allergic patients from Singapore and Italy 133 6.4 IgE epitope mapping of Der p in the Singaporean and Italian populations based on sensitization profiles 139 6.5 Evaluation of the changes in secondary structures of mutant E102A and unfolded Der p 151 6.6 Discussion 155 Chapter 7: Evaluation of hypoallergen vaccine candidates for Der p 158 7.1 Introduction 158 7.2 Specific IgE binding to site directed mutants of Der p in five allergic individuals 159 7.3 Skin Prick Test 167 7.4 Mouse IgG antibodies raised against mutant E102A and unfolded Der p are able to block allergic individuals’ IgE binding to WT Der p 169 7.5 T cell reactivity and cytokine profile 172 7.6 Discussion 175 ix Ko DC, Binkley J, Sidow A and Scott MP (2003) The integrity of a cholesterolbinding pocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterol levels Proc Natl Acad Sci U S A 100(5): 2518-2525 Kobayashi K, Matsuura E, Liu Q, Furukawa J, Kaihara K, Inagaki J, Atsumi T, Sakairi N, Yasuda T, Voelker DR and Koike T (2001) A specific ligand for beta(2)-glycoprotein I mediates autoantibody-dependent uptake of oxidized low density lipoprotein by macrophages J Lipid Res 42(5): 697-709 Kronqvist M, Johansson E, Magnusson CG, Olsson S, Eriksson TL, Gafvelin G and van Hage-Hamsten M (2000) Skin prick test and serological analysis with recombinant group allergens of the dust mites L destructor and T putrescentiae Clin Exp Allergy 30(5): 670-676 Kuo IC, Yi FC, Cheong N, Shek LP, Chew FT, Lee BW and Chua KY (1999) Sensitization to Blomia tropicalis and dermatophagoides pteronyssinus-a comparative study between Singapore and Taiwan Asian Pac J Allergy Immunol 17(3): 179-188 Lake FR, Ward LD, Simpson RJ, Thompson PJ and Stewart GA (1991) House dust mite-derived amylase: allergenicity and physicochemical characterization J Allergy Clin Immunol 87(6): 1035-1042 Lau S, Falkenhorst G, Weber A, Werthmann I, Lind P, Buettner-Goetz P and Wahn U (1989) High mite-allergen exposure increases the risk of sensitization in atopic children and young adults J Allergy Clin Immunol 84(5 Pt 1): 718-725 Lemmon MA (2004) Pleckstrin homology domains: not just for phosphoinositides Biochem Soc Trans 32(Pt 5): 707-711 Lewis DB (2002) Allergy immunotherapy and inhibition of Th2 immune responses: a sufficient strategy? Curr Opin Immunol 14(5): 644-651 Lin KL, Hsieh KH, Thomas WR, Chiang BL and Chua KY (1994) Characterization of Der p V allergen, cDNA analysis, and IgE-mediated reactivity to the recombinant protein J Allergy Clin Immunol 94(6 Pt 1): 989-996 Lind P, Hansen OC and Horn N (1988) The binding of mouse hybridoma and human IgE antibodies to the major fecal allergen, Der p I, of Dermatophagoides pteronyssinus Relative binding site location and species specificity studied by solid-phase inhibition assays with radiolabeled antigen J Immunol 140(12): 4256-4262 Linhart B and Valenta R (2005) Molecular design of allergy vaccines Curr Opin Immunol 17(6): 646-655 Lombardero M, Heymann PW, Platts-Mills TA, Fox JW and Chapman MD (1990) Conformational stability of B cell epitopes on group I and group II Dermatophagoides spp allergens Effect of thermal and chemical denaturation 199 on the binding of murine IgG and human IgE antibodies J Immunol 144(4): 1353-1360 Lomize MA, Lomize AL, Pogozheva ID and Mosberg HI (2006) OPM: orientations of proteins in membranes database Bioinformatics 22(5): 623-625 Mantyjarvi R, Rautiainen J and Virtanen T (2000) Lipocalins as allergens Biochim Biophys Acta 1482(1-2): 308-317 Marks GB (1998) House dust mite exposure as a risk factor for asthma: benefits of avoidance Allergy 53(48 Suppl): 108-114 McCall C, Hunter S, Stedman K, Weber E, Hillier A, Bozic C, Rivoire B and Olivry T (2001) Characterization and cloning of a major high molecular weight house dust mite allergen (Der f 15) for dogs Vet Immunol Immunopathol 78(3-4): 231-247 McKay A, Leung BP, McInnes IB, Thomson NC and Liew FY (2004) A novel antiinflammatory role of simvastatin in a murine model of allergic asthma J Immunol 172(5): 2903-2908 Mills KL, Hart BJ, Lynch NR, Thomas WR and Smith W (1999) Molecular characterization of the group house dust mite allergen from Dermatophagoides pteronyssinus and its amylase homologue from Euroglyphus maynei Int Arch Allergy Immunol 120(2): 100-107 Miyake K (2004) Innate recognition of lipopolysaccharide by Toll-like receptor 4MD-2 Trends Microbiol 12(4): 186-192 Montealegre F, Sepulveda A, Bayona M, Quinones C and Fernandez-Caldas E (1997) Identification of the domestic mite fauna of Puerto Rico P R Health Sci J 16(2): 109-116 Mora C, Flores I, Montealegre F and Diaz A (2003) Cloning and expression of Blo t 1, a novel allergen from the dust mite Blomia tropicalis, homologous to cysteine proteases Clin Exp Allergy 33(1): 28-34 Morris GM, Goodsell, D.S., Halliday,R.S., Huey, R., Hart, W.E., Belew, R.K., Olson A.J (1998) Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function Journal of Computational Chemistry 19(14): 1639-1662 Mosbech H and Osterballe O (1988) Does the effect of immunotherapy last after termination of treatment? Follow-up study in patients with grass pollen rhinitis Allergy 43(7): 523-529 Mount SM (1982) A catalogue of splice junction sequences Nucleic Acids Res 10(2): 459-472 200 Moverare R, Elfman L, Vesterinen E, Metso T and Haahtela T (2002) Development of new IgE specificities to allergenic components in birch pollen extract during specific immunotherapy studied with immunoblotting and Pharmacia CAP System Allergy 57(5): 423-430 Mueller GA, Smith AM, Chapman MD, Rule GS and Benjamin DC (2001) Hydrogen exchange nuclear magnetic resonance spectroscopy mapping of antibody epitopes on the house dust mite allergen Der p J Biol Chem 276(12): 93599365 Muller U, Akdis CA, Fricker M, Akdis M, Blesken T, Bettens F and Blaser K (1998) Successful immunotherapy with T-cell epitope peptides of bee venom phospholipase A2 induces specific T-cell anergy in patients allergic to bee venom J Allergy Clin Immunol 101(6 Pt 1): 747-754 Munir AK (1998) Mite sensitization in the Scandinavian countries and factors influencing exposure levels Allergy 53(48 Suppl): 64-70 Nathanson ME (1969) Arthropods and allergy J Asthma Res 7(2): 55-63 Nelson RP, Jr., DiNicolo R, Fernandez-Caldas E, Seleznick MJ, Lockey RF and Good RA (1996) Allergen-specific IgE levels and mite allergen exposure in children with acute asthma first seen in an emergency department and in nonasthmatic control subjects J Allergy Clin Immunol 98(2): 258-263 Neudecker P, Lehmann K, Nerkamp J, Haase T, Wangorsch A, Fotisch K, Hoffmann S, Rosch P, Vieths S and Scheurer S (2003) Mutational epitope analysis of Pru av and Api g 1, the major allergens of cherry (Prunus avium) and celery (Apium graveolens): correlating IgE reactivity with three-dimensional structure Biochem J 376(Pt 1): 97-107 Nielsen H, Engelbrecht J, Brunak S and von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites Protein Eng 10(1): 1-6 Nishiyama C, Fukada M, Usui Y, Iwamoto N, Yuuki T, Okumura Y and Okudaira H (1995) Analysis of the IgE-epitope of Der f 2, a major mite allergen, by in vitro mutagenesis Mol Immunol 32(14-15): 1021-1029 Nishiyama C, Yuuki T, Takai T, Okumura Y and Okudaira H (1993) Determination of three disulfide bonds in a major house dust mite allergen, Der f II Int Arch Allergy Immunol 101(2): 159-166 Noon L (1911) Prophylactic inoculation for hay fever Lancet I: 572 O'Connor BD and Yeates TO (2004) GDAP: a web tool for genome-wide protein disulfide bond prediction Nucleic Acids Res 32(Web Server issue): W360-364 201 Olsen AR (1998) Regulatory action criteria for filth and other extraneous materials II Allergenic mites: an emerging food safety issue Regul Toxicol Pharmacol 28(3): 190-198 Olsson S, van Hage-Hamsten M, Whitley P, Johansson E, Hoffman DR, Gafvelin G and Schmidt M (1998) Expression of two isoforms of Lep d 2, the major allergen of Lepidoglyphus destructor, in both prokaryotic and eukaryotic systems Clin Exp Allergy 28(8): 984-991 O'Neill GM, Donovan GR and Baldo BA (1994) Cloning and characterization of a major allergen of the house dust mite, Dermatophagoides pteronyssinus, homologous with glutathione S-transferase Biochim Biophys Acta 1219(2): 521-528 Park GM, Lee SM, Lee IY, Ree HI, Kim KS, Hong CS and Yong TS (2000) Localization of a major allergen, Der p 2, in the gut and faecal pellets of Dermatophagoides pteronyssinus Clin Exp Allergy 30(9): 1293-1297 Park JW, Kim KS, Jin HS, Kim CW, Kang DB, Choi SY, Yong TS, Oh SH and Hong CS (2002) Der p isoallergens have different allergenicity, and quantification with 2-site ELISA using monoclonal antibodies is influenced by the isoallergens Clin Exp Allergy 32(7): 1042-1047 Peitsch MC (1996) ProMod and Swiss-Model: Internet-based tools for automated comparative protein modelling Biochem Soc Trans 24(1): 274-279 Peitsch MC, Wells TN, Stampf DR and Sussman JL (1995) The Swiss-3DImage collection and PDB-Browser on the World-Wide Web Trends Biochem Sci 20(2): 82-84 Pene J, Rousset F, Briere F, Chretien I, Bonnefoy JY, Spits H, Yokota T, Arai N, Arai K, Banchereau J and et al (1988) IgE production by normal human lymphocytes is induced by interleukin and suppressed by interferons gamma and alpha and prostaglandin E2 Proc Natl Acad Sci U S A 85(18): 6880-6884 Piboonpocanun S, Malainual N, Jirapongsananuruk O, Vichyanond P and Thomas WR (2006) Genetic polymorphisms of major house dust mite allergens Clin Exp Allergy 36(4): 510-516 Platts-Mills TA and Chapman MD (1987) Dust mites: immunology, allergic disease, and environmental control J Allergy Clin Immunol 80(6): 755-775 Platts-Mills TA, Vervloet D, Thomas WR, Aalberse RC and Chapman MD (1997) Indoor allergens and asthma: report of the Third International Workshop J Allergy Clin Immunol 100(6 Pt 1): S2-24 Platts-Mills TAE, De Weck, A (1989) Dust mite allergens and asthma-A world wide problem Bulletin of the World Health Organization 66: 769-780 202 Puerta L, Caraballo L, Fernandez-Caldas E, Avjioglu A, Marsh DG, Lockey RF and Dao ML (1996) Nucleotide sequence analysis of a complementary DNA coding for a Blomia tropicalis allergen J Allergy Clin Immunol 98(5 Pt 1): 932-937 Puerta L, Fernandez-Caldas E, Lockey RF and Caraballo LR (1993a) Mite allergy in the tropics: sensitization to six domestic mite species in Cartagena, Colombia J Investig Allergol Clin Immunol 3(4): 198-204 Puerta L, Fernandez-Caldas E, Lockey RF and Caraballo LR (1993b) Sensitization to Chortoglyphus arcuatus and Aleuroglyphus ovatus in Dermatophagoides spp allergic individuals Clin Exp Allergy 23(2): 117-123 Puerta L, Lagares A, Mercado D, Fernandez-Caldas E and Caraballo L (2005) Allergenic composition of the mite Suidasia medanensis and cross-reactivity with Blomia tropicalis Allergy 60(1): 41-47 Punnonen J, Aversa G, Cocks BG, McKenzie AN, Menon S, Zurawski G, de Waal Malefyt R and de Vries JE (1993) Interleukin 13 induces interleukin 4independent IgG4 and IgE synthesis and CD23 expression by human B cells Proc Natl Acad Sci U S A 90(8): 3730-3734 Rajan TV (2003) The Gell-Coombs classification of hypersensitivity reactions: a reinterpretation Trends Immunol 24(7): 376-379 Ramos JD, Cheong N, Lee BW and Chua KY (2001) cDNA cloning and expression of Blo t 11, the Blomia tropicalis allergen homologous to paramyosin Int Arch Allergy Immunol 126(4): 286-293 Reese G, Ayuso R and Lehrer SB (1999) Tropomyosin: an invertebrate pan-allergen Int Arch Allergy Immunol 119(4): 247-258 Rizzo MC, Fernandez-Caldas E, Sole D and Naspitz CK (1997) IgE antibodies to aeroallergens in allergic children in Sao Paulo, Brazil J Investig Allergol Clin Immunol 7(4): 242-248 Rodriguez R, Villalba M, Monsalve RI and Batanero E (2001) The spectrum of olive pollen allergens Int Arch Allergy Immunol 125(3): 185-195 Romagnani S (1991) Human TH1 and TH2 subsets: doubt no more Immunol Today 12(8): 256-257 Saarne T, Kaiser L, Rasool O, Huecas S, van Hage-Hamsten M and Gafvelin G (2003) Cloning and characterisation of two IgE-binding proteins, homologous to tropomyosin and alpha-tubulin, from the mite Lepidoglyphus destructor Int Arch Allergy Immunol 130(4): 258-265 Sanchez-Borges M, Capriles-Hulett A, Fernandez-Caldas E, Suarez-Chacon R, Caballero F, Castillo S and Sotillo E (1997) Mite-contaminated foods as a cause of anaphylaxis J Allergy Clin Immunol 99(6 Pt 1): 738-743 203 Sanner MF (1999) Phyton: A programming language for software integration and development J Mol Graphics Mod 17: 57-61 Schmidt M, Olsson S, van der Ploeg I and van Hage-Hamsten M (1995) cDNA analysis of the mite allergen Lep d identifies two different isoallergens and variants FEBS Lett 370(1-2): 11-14 Sehon AH (1991) Carl Prausnitz Memorial Lecture Suppression of antibody responses by chemically modified antigens Int Arch Allergy Appl Immunol 94(1-4): 11-20 Shen HD, Chua KY, Lin KL, Hsieh KH and Thomas WR (1993) Molecular cloning of a house dust mite allergen with common antibody binding specificities with multiple components in mite extracts Clin Exp Allergy 23(11): 934-940 Shen HD, Chua KY, Lin WL, Hsieh KH and Thomas WR (1995) Characterization of the house dust mite allergen Der p by monoclonal antibodies Clin Exp Allergy 25(5): 416-422 Sly RM (1999) Changing prevalence of allergic rhinitis and asthma Ann Allergy Asthma Immunol 82(3): 233-248; quiz 248-252 Smith AM, Benjamin DC, Derewenda U, Smith WA, Thomas WR and Chapman MD (2001a) Sequence polymorphisms and antibody binding to the group dust mite allergens Int Arch Allergy Immunol 124(1-3): 61-63 Smith AM, Benjamin DC, Hozic N, Derewenda U, Smith WA, Thomas WR, Gafvelin G, van Hage-Hamsten M and Chapman MD (2001b) The molecular basis of antigenic cross-reactivity between the group mite allergens J Allergy Clin Immunol 107(6): 977-984 Smith AM and Chapman MD (1996) Reduction in IgE binding to allergen variants generated by site-directed mutagenesis: contribution of disulfide bonds to the antigenic structure of the major house dust mite allergen Der p Mol Immunol 33(4-5): 399-405 Smith AM and Chapman MD (1997) Localization of antigenic sites on Der p using oligonucleotide-directed mutagenesis targeted to predicted surface residues Clin Exp Allergy 27(5): 593-599 Smith AM, Chapman MD, Taketomi EA, Platts-Mills TA and Sung SS (1998) Recombinant allergens for immunotherapy: a Der p variant with reduced IgE reactivity retains T-cell epitopes J Allergy Clin Immunol 101(3): 423-425 Smith W, Mills K, Hazell L, Hart B and Thomas W (1999a) Molecular analysis of the group and allergens from the house dust mite, Euroglyphus maynei Int Arch Allergy Immunol 118(1): 15-22 204 Smith WA, Chua KY, Kuo MC, Rogers BL and Thomas WR (1994) Cloning and sequencing of the Dermatophagoides pteronyssinus group III allergen, Der p III Clin Exp Allergy 24(3): 220-228 Smith WA, Hart BJ and Thomas WR (1999b) Group allergen Eur m 0101 precursor [Euroglyphus maynei],Direct Submission, Accession number:AAD10712 Smith WA and Thomas WR (1996a) Comparative analysis of the genes encoding group allergens from Dermatophagoides pteronyssinus and Dermatophagoides farinae Int Arch Allergy Immunol 109(2): 133-140 Smith WA and Thomas WR (1996b) Sequence polymorphisms of the Der p house dust mite allergen Clin Exp Allergy 26(5): 571-579 Soderlund A, Gabrielsson S, Paulie S, Hammarstrom ML, Rak S and Troye-Blomberg M (1997) Allergen induced cytokine profiles in type I allergic individuals before and after immunotherapy Immunol Lett 57(1-3): 177-181 Spangfort MD, Mirza O, Ipsen H, Van Neerven RJ, Gajhede M and Larsen JN (2003) Dominating IgE-binding epitope of Bet v 1, the major allergen of birch pollen, characterized by X-ray crystallography and site-directed mutagenesis J Immunol 171(6): 3084-3090 Sporik R, Holgate ST, Platts-Mills TA and Cogswell JJ (1990) Exposure to housedust mite allergen (Der p I) and the development of asthma in childhood A prospective study N Engl J Med 323(8): 502-507 Stanaland BE, Fernandez-Caldas E, Jacinto CM, Trudeau WL and Lockey RF (1994) Sensitization to Blomia tropicalis: skin test and cross-reactivity studies J Allergy Clin Immunol 94(3 Pt 1): 452-457 Stewart GA, Bird CH and Thompson PJ (1992) Do the group II dust mite allergens correspond to lysozyme? J Allergy Clin Immunol 90(1): 141-142 Suzuki M, Tanaka Y, Korematsu S, Mikami B and Minato N (2006) Crystal structure and some properties of a major house dust mite allergen, Derf Biochem Biophys Res Commun 339(2): 679-686 Swoboda I, De Weerd N, Bhalla PL, Niederberger V, Sperr WR, Valent P, Kahlert H, Fiebig H, Verdino P, Keller W, Ebner C, Spitzauer S, Valenta R and Singh MB (2002) Mutants of the major ryegrass pollen allergen, Lol p 5, with reduced IgE-binding capacity: candidates for grass pollen-specific immunotherapy Eur J Immunol 32(1): 270-280 Takai T, Ichikawa S, Yokota T, Hatanaka H, Inagaki F and Okumura Y (2000) Unlocking the allergenic structure of the major house dust mite allergen der f by elimination of key intramolecular interactions FEBS Lett 484(2): 102107 205 Takai T, Yokota T, Yasue M, Nishiyama C, Yuuki T, Mori A, Okudaira H and Okumura Y (1997) Engineering of the major house dust mite allergen Der f for allergen-specific immunotherapy Nat Biotechnol 15(8): 754-758 Tategaki A, Kawamoto S, Aki T, Jyo T, Suzuki O, Shigeta S and Ono K (2000) Newly described house dust mite allergens ACI International 1(74): 76 Thomas WR and Chua KY (1995) The major mite allergen Der p a secretion of the male mite reproductive tract? Clin Exp Allergy 25(7): 667-669 Thomas WR, Hales BJ and Smith WA (2005) Structural biology of allergens Curr Allergy Asthma Rep 5(5): 388-393 Thomas WR and Smith W (1998) House-dust-mite allergens Allergy 53(9): 821-832 Thomas WR and Smith W (1999) Towards defining the full spectrum of important house dust mite allergens Clin Exp Allergy 29(12): 1583-1587 Thomas WR, Smith WA and Hales BJ (2004) The allergenic specificities of the house dust mite Chang Gung Med J 27(8): 563-569 Thomas WR, Smith WA, Hales BJ, Mills KL and O'Brien RM (2002) Characterization and immunobiology of house dust mite allergens Int Arch Allergy Immunol 129(1): 1-18 Till S, Durham S, Dickason R, Huston D, Bungre J, Walker S, Robinson D, Kay AB and Corrigan C (1997) IL-13 production by allergen-stimulated T cells is increased in allergic disease and associated with IL-5 but not IFN-gamma expression Immunology 91(1): 53-57 Tovey ER, Chapman MD and Platts-Mills TA (1981) Mite faeces are a major source of house dust allergens Nature 289(5798): 592-593 Tovey ER, Johnson MC, Roche AL, Cobon GS and Baldo BA (1989) Cloning and sequencing of a cDNA expressing a recombinant house dust mite protein that binds human IgE and corresponds to an important low molecular weight allergen J Exp Med 170(4): 1457-1462 Trudinger M, Chua KY and Thomas WR (1991) cDNA encoding the major mite allergen Der f II Clin Exp Allergy 21(1): 33-37 Tsai LC, Chao PL, Shen HD, Tang RB, Chang TC, Chang ZN, Hung MW, Lee BL and Chua KY (1998) Isolation and characterization of a novel 98-kd Dermatophagoides farinae mite allergen J Allergy Clin Immunol 102(2): 295303 Turner H and Kinet JP (1999) Signalling through the high-affinity IgE receptor Fc epsilonRI Nature 402(6760 Suppl): B24-30 206 Valenta R (2002) The future of antigen-specific immunotherapy of allergy Nat Rev Immunol 2(6): 446-453 Valenta R and Kraft D (1995) Recombinant allergens for diagnosis and therapy of allergic diseases Curr Opin Immunol 7(6): 751-756 Valenta R and Kraft D (2001) Recombinant allergen molecules: tools to study effector cell activation Immunol Rev 179: 119-127 Valenta R, Lidholm J, Niederberger V, Hayek B, Kraft D and Gronlund H (1999) The recombinant allergen-based concept of component-resolved diagnostics and immunotherapy (CRD and CRIT) Clin Exp Allergy 29(7): 896-904 Valenta R, Vrtala S, Laffer S, Spitzauer S and Kraft D (1998) Recombinant allergens Allergy 53(6): 552-561 Valerio CR, Murray P, Arlian LG and Slater JE (2005) Bacterial 16S ribosomal DNA in house dust mite cultures J Allergy Clin Immunol 116(6): 1296-1300 van Hage-Hamsten M and Johansson SG (1992) Storage mites Exp Appl Acarol 16(1-2): 117-128 van Hage-Hamsten M and Valenta R (2002) Specific immunotherapy the induction of new IgE-specificities? Allergy 57(5): 375-378 van Neerven RJ, Wikborg T, Lund G, Jacobsen B, Brinch-Nielsen A, Arnved J and Ipsen H (1999) Blocking antibodies induced by specific allergy vaccination prevent the activation of CD4+ T cells by inhibiting serum-IgE-facilitated allergen presentation J Immunol 163(5): 2944-2952 Van Regenmortel MHV (1996) Mapping Epitope Structure and Activity: From OneDimensional Prediction to Four-Dimensional Description of Antigenic Specificity Methods 9(3): 465-472 van 't Hof W, Driedijk PC, van den Berg M, Beck-Sickinger AG, Jung G and Aalberse RC (1991) Epitope mapping of the Dermatophagoides pteronyssinus house dust mite major allergen Der p II using overlapping synthetic peptides Mol Immunol 28(11): 1225-1232 Varela J, Ventas P, Carreira J, Barbas JA, Gimenez-Gallego G and Polo F (1994) Primary structure of Lep d I, the main Lepidoglyphus destructor allergen Eur J Biochem 225(1): 93-98 Verini M, Rossi N, Verrotti A, Pelaccia G, Nicodemo A and Chiarelli F (2001) Sensitization to environmental antigens in asthmatic children from a central Italian area Sci Total Environ 270(1-3): 63-69 207 Voorhorst R, Spieksma-Boezeman MI and Spieksma FT (1964) Is a Mite (Dermatophagoides Sp.) the Producer of the House-Dust Allergen? Allerg Asthma (Leipz) 10: 329-334 Vriend G (1990) WHAT IF: A molecular modeling and drug design program J Mol Graph 8: 52-66 Vrtala S, Akdis CA, Budak F, Akdis M, Blaser K, Kraft D and Valenta R (2000) T cell epitope-containing hypoallergenic recombinant fragments of the major birch pollen allergen, Bet v 1, induce blocking antibodies J Immunol 165(11): 6653-6659 Vrtala S, Focke-Tejkl M, Swoboda I, Kraft D and Valenta R (2004) Strategies for converting allergens into hypoallergenic vaccine candidates Methods 32(3): 313-320 Vrtala S, Hirtenlehner K, Vangelista L, Pastore A, Eichler HG, Sperr WR, Valent P, Ebner C, Kraft D and Valenta R (1997) Conversion of the major birch pollen allergen, Bet v 1, into two nonanaphylactic T cell epitope-containing fragments: candidates for a novel form of specific immunotherapy J Clin Invest 99(7): 1673-1681 Wachholz PA, Nouri-Aria KT, Wilson DR, Walker SM, Verhoef A, Till SJ and Durham SR (2002) Grass pollen immunotherapy for hayfever is associated with increases in local nasal but not peripheral Th1:Th2 cytokine ratios Immunology 105(1): 56-62 Walker C and Zuany-Amorim C (2001) New trends in immunotherapy to prevent atopic diseases Trends Pharmacol Sci 22(2): 84-90 Wan H, Winton HL, Soeller C, Tovey ER, Gruenert DC, Thompson PJ, Stewart GA, Taylor GW, Garrod DR, Cannell MB and Robinson C (1999) Der p facilitates transepithelial allergen delivery by disruption of tight junctions J Clin Invest 104(1): 123-133 Weber E, Hunter S, Stedman K, Dreitz S, Olivry T, Hillier A and McCall C (2003) Identification, characterization, and cloning of a complementary DNA encoding a 60-kd house dust mite allergen (Der f 18) for human beings and dogs J Allergy Clin Immunol 112(1): 79-86 Weiss KB and Sullivan SD (2001) The health economics of asthma and rhinitis I Assessing the economic impact J Allergy Clin Immunol 107(1): 3-8 WHO/IUIS (1994) Allergen Nomenclature Allergen Nomenclature Subcommittee World Health Organization Geneva, Switzerland, Bulletin of the World Health Organization 72: 797-806 Wiedermann U, Herz U, Baier K, Vrtala S, Neuhaus-Steinmetz U, Bohle B, Dekan G, Renz H, Ebner C, Valenta R and Kraft D (2001) Intranasal treatment with a recombinant hypoallergenic derivative of the major birch pollen allergen Bet v 208 prevents allergic sensitization and airway inflammation in mice Int Arch Allergy Immunol 126(1): 68-77 Wiedermann U, Jahn-Schmid B, Bohle B, Repa A, Renz H, Kraft D and Ebner C (1999) Suppression of antigen-specific T- and B-cell responses by intranasal or oral administration of recombinant bet v 1, the major birch pollen allergen, in a murine model of type I allergy J Allergy Clin Immunol 103(6): 12021210 Wright CS, Li SC and Rastinejad F (2000) Crystal structure of human GM2-activator protein with a novel beta-cup topology J Mol Biol 304(3): 411-422 Yasueda H, Mita H, Akiyama K, Shida T, Ando T, Sugiyama S and Yamakawa H (1993) Allergens from Dermatophagoides mites with chymotryptic activity Clin Exp Allergy 23(5): 384-390 Yi FC, Cheong N, Shek PC, Wang DY, Chua KY and Lee BW (2002) Identification of shared and unique immunoglobulin E epitopes of the highly conserved tropomyosins in Blomia tropicalis and Dermatophagoides pteronyssinus Clin Exp Allergy 32(8): 1203-1210 Yuuki T, Okumura Y, Ando T, Yamakawa H, Suko M, Haida M and Okudaira H (1991) Cloning and expression of cDNA coding for the major house dust mite allergen Der f II in Escherichia coli Agric Biol Chem 55(5): 1233-1238 Yuuki T, Okumura Y and Okudaira H (1997) Genomic organization and polymorphisms of the major house dust mite allergen Der f2 Int Arch Allergy Immunol 112(1): 44-48 Zeiler T, Taivainen A, Rytkonen M, Rautiainen J, Karjalainen H, Mantyjarvi R, Tuomisto L and Virtanen T (1997) Recombinant allergen fragments as candidate preparations for allergen immunotherapy J Allergy Clin Immunol 100(6 Pt 1): 721-727 Zhang L, Chew FT, Soh SY, Yi FC, Law SY, Goh DY and Lee BW (1997) Prevalence and distribution of indoor allergens in Singapore Clin Exp Allergy 27(8): 876-885 209 Appendix I List of primers A Primers for the amplification of group allergens Lepd2_BamH1(f) : 5’-CGGGATCCGGCAAGATGACCTTCAAG-3’ Lepd2_EcoR1(r): 5’-CGGAATTCTTATTCGACTTGTCCGTG-3’ Glyd2_BamH1(f): 5’-CGGGATCCGGCAAGATGAAGTTTAAG-3’ Glyd2_EcoR1(r): 5’-CGGAATTCTTATTCGACTTGCCGGCC-3’ Derf2_BamH1(f): 5’-CGGGATCCGATCAAGTCGATGTTAAAG-3’ Derf2_EcoR1(r): 5’-CGGAATTCTTAATCACGGATTTACC-3’ Derp2_BamH1(f): 5’-CGGGATCCCGTGATCAAGTCGATGTC-3’ Derp2_EcoR1(r): 5’-CGGAATTCTTAATCGCGGATTTCGC-3’ Tyrp2_BamH1(f): 5’-CGGGATCCGGCAAGGTCAAGTTCACC-3’ Tyrp2_EcoR1(r): 5’-CGGAATTCTTAGGGCTTGACGTCGGT-3’ Aleo2_BamH1(f): 5’-CGGGATCCGGTCAAGTTCGGTTCGAG-3’ Aleo2_EcoR1(r): 5’-CGGAATTCTTAGTTGGCAATGTCGCC-3’ B Primers for alanine mutants of Der p R128A_F: 5'-TGCTACTCATGCTAAAATCGCCGATTAAGAATTCGAGCTCC-3' 78.2°C R128A_R: 5'-GGAGCTCGAATTCTTAATCGGCGATTTTAGCATGAGTAGCA-3' 78.2°C H11A_F: 5'-TCGATGTCAAAGATTGTGCCAATGCCGAAATCAAAAAAGTTTTGGTACCAG-3' 78.5°C H11A_R: 5'-CTGGTACCAAAACTTTTTTGATTTCGGCATTGGCACAATCTTTGACATCGA-3' 78.5°C W92A_F: 5'-AGGACAACAATATGATATTAAATATACAGCGAATGTTCCAAAAATTGCACCAAAATC3' 78.4°C W92A_R: 5'-GATTTTGGTGCAATTTTTGGAACATTCGCTGTATATTTAATATCATATTGTTGTCCT3' 78.4°C H22A_F: 5'-AAAGTTTTGGTACCAGGATGCGCCGGTTCAGAACCATGTATCATT-3' 78.1°C H22A_R: 5'-AATGATACATGGTTCTGAACCGGCGCATCCTGGTACCAAAACTTT-3' 78.1°C K55A_F: 5'-CTCAAAAACAGCTAAAATTGAAATCGCAGCTTCAATCGATGGTTTAGAAGT3'78.8°C 210 K55A_R: 5'-ACTTCTAAACCATCGATTGAAGCTGCGATTTCAATTTTAGCTGTTTTTGAG3'78.8°C K89A_F: 5'-TGGTTAAAGGACAACAATATGATATTGCATATACATGGAATGTTCCAAAAATTGC-3' 78.3°C K89A_R: 5'-GCAATTTTTGGAACATTCCATGTATATGCAATATCATATTGTTGTCCTTTAACCA-3' 78.3°C K77A_F: 5'-TCCAAATGCATGCCATTATATGGCCTGTCCATTGGTTAAAGGACAAC-3' 78.2°C K77A_R: 5'-GTTGTCCTTTAACCAATGGACAGGCCATATAATGGCATGCATTTGGA-3' 78.2°C L61A_F: 5'-AATCAAAGCTTCAATCGATGGTGCCGAAGTTGATGTTCCCGGTAT-3' 78.1°C L61A_R: 5'-ATACCGGGAACATCAACTTCGGCACCATCGATTGAAGCTTTGATT-3' 78.1°C E25A_F: 5'-CAGGATGCCATGGTTCAGCCCCATGTATCATTCATCGTG-3' 80.1°C E25A_R: 5'-CACGATGAATGATACATGGGGCTGAACCATGGCATCCTG-3' 80.1°C Q85A_F: 5'ATGAAATGTCCATTGGTTAAAGGACAAGCCTATGATATTAAATATACATGGAATGTTCC-3' 78.2°C Q85A_R: 5'GGAACATTCCATGTATATTTAATATCATAGGCTTGTCCTTTAACCAATGGACATTTCAT-3' 78.2°C N10A_F: 5'-GTCGATGTCAAAGATTGTGCCGCCCATGAAATCAAAAAAGTTTTGGTAC-3' 78.3°C N10A_R: 5'-GTACCAAAACTTTTTTGATTTCATGGGCGGCACAATCTTTGACATCGAC-3' 78.3°C K6A_F: 5'-CGCCACCACCACTGAGAGCCGATTGTGCCAATCATGAAATC-3' 79.7°C K6A_R: 5'-GATTTCATGATTGGCACAATCGGCTCTCAGTGGTGGTGGCG-3' 79.7°C H30A_F: 5'-GGTTCAGAACCATGTATCATTGCCCGTGGTAAACCATTCCAATTG-3' 78.1°C H30A_R: 5'-CAATTGGAATGGTTTACCACGGGCAATGATACATGGTTCTGAACC-3' 78.1°C K96A_F: 5'-GATATTAAATATACATGGAATGTTCCAGCAATTGCACCAAAATCTGAAAATGTTG-3' 78.3°C K96A_R: 5'-CAACATTTTCAGATTTTGGTGCAATTGCTGGAACATTCCATGTATATTTAATATC-3' 78.3°C I97A_F: 5'-ATATTAAATATACATGGAATGTTCCAAAAGCCGCACCAAAATCTGAAAATGTTGTCG3' 78.1°C I97A_R: 5'-CGACAACATTTTCAGATTTTGGTGCGGCTTTTGGAACATTCCATGTATATTTAATAT3' 78.1°C K100A_F: 5'-GAATGTTCCAAAAATTGCACCAGCCTCTGAAAATGTTGTCGTCACTG-3' 78.2°C K100A_R: 5'-CAGTGACGACAACATTTTCAGAGGCTGGTGCAATTTTTGGAACATTC-3' 78.2°C H74A_F: 5'-GGTATCGATCCAAATGCATGCGCCTATATGAAATGTCCATTGGTTAAAG-3'78.3°C H74A_R: 5'-CTTTAACCAATGGACATTTCATATAGGCGCATGCATTTGGATCGATACC-3'78.3°C K15A_F: 5'-GTGCCAATCATGAAATCAAAGCAGTTTTGGTACCAGGATGC-3' 78.2°C K15A_R: 5'-GCATCCTGGTACCAAAACTGCTTTGATTTCATGATTGGCAC-3' 78.2°C N114A_F: 5'-GTCACTGTTAAAGTTATGGGTGATGCAGGTGTTTTGGCTTGTGCTATTG-3' 79.2°C N114A_R: 5'-CAATAGCACAAGCCAAAACACCTGCATCACCCATAACTTTAACAGTGAC-3' 79.2°C N93A_F: 5'GACAACAATATGATATTAAATATACATGGGCCGTTCCAAAAATTGCACCAAAATCTGAA-3' 78.2°C N93A_R: 5'TTCAGATTTTGGTGCAATTTTTGGAACGGCCCATGTATATTTAATATCATATTGTTGTC-3' 78.2°C 211 E102A_F: 5'-TCCAAAAATTGCACCAAAATCTGCCAATGTTGTCGTCACTGTTAAAG-3' 78.6°C E102A_R: 5'-CTTTAACAGTGACGACAACATTGGCAGATTTTGGTGCAATTTTTGGA-3' 78.6°C E62A_F: 5'-AAGCTTCAATCGATGGTTTAGCCGTTGATGTTCCCGGTATC-3' 79.2°C E62A_R: 5'-GATACCGGGAACATCAACGGCTAAACCATCGATTGAAGCTT-3' 79.2°C V110A_F: 5'-AAATGTTGTCGTCACTGTTAAAGCAATGGGTGATAATGGTGTTTTGG-3' 78.6°C V110A_R: 5'-CCAAAACACCATTATCACCCATTGCTTTAACAGTGACGACAACATTT-3' 78.6°C V108A_F: 5'-ATCTGAAAATGTTGTCGTCACTGCAAAAGTTATGGGTGATAATGGTG-3' 78.6°C V108A_R: 5'-CACCATTATCACCCATAACTTTTGCAGTGACGACAACATTTTCAGAT-3' 78.6°C V106A_F: 5'-GCACCAAAATCTGAAAATGTTGTCGCAACTGTTAAAGTTATGGGTGATAAT-3' 78.8°C V106A_R: 5'-ATTATCACCCATAACTTTAACAGTTGCGACAACATTTTCAGATTTTGGTGC-3' 78.8°C V104A_F: 5'-AAAAATTGCACCAAAATCTGAAAATGCAGTCGTCACTGTTAAAGTTATGGG-3' 78.8°C V104A_R: 5'-CCCATAACTTTAACAGTGACGACTGCATTTTCAGATTTTGGTGCAATTTTT-3' 78.8°C F41A_F: 5'-GTAAACCATTCCAATTGGAAGCTTTAGCAGAAGCCAATCAAAACTCAAAAACAGC-3' 79.4°C F41A_R: 5'-GCTGTTTTTGAGTTTTGATTGGCTTCTGCTAAAGCTTCCAATTGGAATGGTTTAC-3' 79.4°C V16A_F: 5'-GTGCCAATCATGAAATCAAAAAAGCATTGGTACCAGGATGCCATG-3' 79.4°C V16A_R: 5'-CATGGCATCCTGGTACCAATGCTTTTTTGATTTCATGATTGGCAC-3' 79.4°C Y90A_F: 5'-GGTTAAAGGACAACAATATGATATTAAAGCAACATGGAATGTTCCAAAAATTGCACC3' 78.1°C Y90A_R: 5'-GGTGCAATTTTTGGAACATTCCATGTTGCTTTAATATCATATTGTTGTCCTTTAACC3' 78.1°C L37A_F: 5'-TCATCGTGGTAAACCATTCCAAGCAGAAGCTTTATTCGAAGCCAATC-3' 78.2°C L37A_R: 5'-GATTGGCTTCGAATAAAGCTTCTGCTTGGAATGGTTTACCACGATGA-3' 78.2°C V18A_F: 5'-CATGAAATCAAAAAAGTTTTGGCACCAGGATGCCATGGTTC-3' 79.6°C V18A_R: 5'-GAACCATGGCATCCTGGTGCCAAAACTTTTTTGATTTCATG-3' 79.6°C W92A_F: 5'-AGGACAACAATATGATATTAAATATACAGCGAATGTTCCAAAAATTGCACCAAAATC3' 78.4°C W92A_R: 5'-GATTTTGGTGCAATTTTTGGAACATTCGCTGTATATTTAATATCATATTGTTGTCCT3' 78.4°C F35A_F: 5'-GTATCATTCATCGTGGTAAACCAGCACAATTGGAAGCTTTATTCGAAGC-3' 78.3°C F35A_R: 5'-GCTTCGAATAAAGCTTCCAATTGTGCTGGTTTACCACGATGAATGATAC-3' 78.3°C 212 Appendix II A B Supplementary Figure Microtome-cut D farinae sections probed with preimmune sera of rabbits which were later immunized with (A) Der f and (B) Der f 22 Sections were viewed using light microscope with 200X magnification 213 ... allergen from Dermatophagoides farinae: a paralogue of Der f 2? 75 4.1 Introduction 75 4 .2 Identification, isolation and characterization of Der f 22 76 4.3 Genomic organization of Der f 22 and Der f. .. antibodies raised against Der f 22 and Der f 2, and immunolocalization on D farinae sections 93 Figure 4. 12 Concentration of Der f 22 and Der f in dust samples 95 Figure 4.13 Binding of Der f 22 and Der. .. Cystein pairing of Der f 22 and Der f 80 Figure 4.4 Ribbon structures of Der f 22 and Der f 80 Figure 4.5 CD spectra of Der f 22 (solid line) and Der f (dashed line) 82 Figure 4.6 Location of intron