Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

... allergen from Dermatophagoides farinae: a paralogue of Der f 2? 75 4.1 Introduction 75 4 .2 Identification, isolation and characterization of Der f 22 76 4.3 Genomic organization of Der f 22 and Der f ... antibodies raised against Der f 22 and Der f 2, and immunolocalization on D farinae sections 93 Figure 4. 12 Concentration of Der...

Ngày tải lên: 15/09/2015, 17:09

... thermal treatment on IgE- binding activities of Blo t 92 and Blo t 21 4.2.2 Effect of thermal treatment on Blo t and Blo t 21 folding 94 4.2.3 Resistance of IgE- binding of Blo t and Blo t 21 to acid, ... 21 75 and Blo t 3.2.10 Quantitative end point cross-inhibition of Blo t 21 and 77 Blo t 3.2.11 Localization of Blo...

Ngày tải lên: 14/09/2015, 12:44

... Superimposition of the NMR structure of Blo t 21 with Blo t and Der p 58 Figure 3 .7 The allergenicity of Blo t 21, Der f 21, Der p and Blo t 60 Figure 3.8 The CD spectrum of Blo t 21, Der f 21, Blo t and ... cells 25 Blot21_E74A_up Blot21_E74A_down Blot21_K76A_down Blot21_K76A_down Blot21_D79A_up Blot21_D79A_down Blot21_E84A_up Blot21_...

Ngày tải lên: 09/09/2015, 18:55

... resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the ... expressed at a high level (data not shown) DISCUSSION Computer analysis of b-expansins reveals significant similarity to cathepsins, which are members of the C1 fami...

Ngày tải lên: 08/03/2014, 22:20

... stearothermophilus adenylate kinase with bound Ap5A, Mg2+ Ap5A, and Mn2+ Ap5A reveal an intermediate lid position and six coordinate octahedral geometry for bound Mg2+ and Mn2+ Proteins 32, 27 6 28 8 29 Kanaani, ... M (1996) Ancient divergence of long and short isoforms of adenylate kinase: molecular evolution of the nucleoside monophosphate kinase family FEBS Lett...

Ngày tải lên: 21/02/2014, 00:20

... conformations of these peptides and to analyse the interaction between peptides and the mAb to obtain clear evidence that the peptides are real mimotopes of GAs and to confirm the existence of peptidyl ... GA4 for the mAb So far, quite a number of peptidyl mimics for carbohydrates or double-stranded DNA have been prepared [1–3] Mimicry peptides for water-soluble ligan...

Ngày tải lên: 16/03/2014, 23:20

... both clinical and scientific purposes, as well as for developing new ways of vaccination Results Obtaining Arabidopsis transgenic plants containing Ole e and Ole e cDNAs Binary pROK2-OLEE3 and pROK2-OLEE8 ... using total RNA from independent transgenic lines and a specific DNA probe for each allergen A band around the predicted size was visualized in the transgenic lines (40...

Ngày tải lên: 30/03/2014, 10:20

... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotid...

Ngày tải lên: 18/02/2014, 06:20

... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...

Ngày tải lên: 18/02/2014, 18:20

... blocked the 3889 Mapping of transcobalamin using antibodies S N Fedosov et al Table Specicity of monoclonal anti- (human transcobalamin) sera and their effect on the functional properties of transcobalamin ... effect of some mAbs on the functional properties of TC (this study, [16]) supplemented the epitope mapping and provided a deeper insight into opera...

Ngày tải lên: 20/02/2014, 01:20

... On the basis of the results with antibodies, a series of PrP mutants were made to assess whether deletions of certain domains of the protein decrease the SOD-like activity of the protein The domains ... the SOD activity We determined that the active site consists of two domains The first includes the Cu-binding domain and the second includes the conser...

Ngày tải lên: 21/02/2014, 00:20

... Pavlova lutheri (AAQ98793), Thraustochytrium sp (AAN75710), Thalassiosira pseudonana (AAX14506); D5 desaturases from Caenorhabditis elegans (AAC95143), Mortierella alpina (AAC72755), Phaeodactylum ... gracilis It is reasonably clear from the analysis of this branch that D5 desaturases in nematodes and vertebrates may have diverged from an ancestral D6 desaturase in each of the...

Ngày tải lên: 07/03/2014, 12:20

... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efficient in the stimulation of cAMP productio...

Ngày tải lên: 07/03/2014, 15:20

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the nor...

Ngày tải lên: 24/03/2014, 03:21

... Kroo|zrrg lv d qhw0surwv frqwudfw/ lq zklfk qhw surwv lv d frqwudfwxdoo| ghqhg whup/ qrw surw dv fdofxodwhg dffruglqj wr Jhqhu0 doo| Dffhswhg Dffrxqwlqj Sulqflsohv +JDDS,1 Vhyhudo glvsxwhv kdyh dulvhq ... ryhukhdg fkdujhv/ dqg lwv vkduh ri qhw surwv1 Hdfk frvw frpsrqhqw kdv vrph pdujlq ri surw fdofxodwhg lqwr lw1 Wkh vwxglr kdv d srwhqwldo frq lfw ri lqwhuhvw ehfdxvh lw pxvw eh wuxvwh...

Ngày tải lên: 30/03/2014, 12:21