3—values of pullout force obtained from tests on structures table a 4 — estimate of in place compressive strength using results in table a 3
Getting creative solving the top 3 challenges of in house creative teams
... need a thorough understanding of all produc *on work in the pipeline Crea6ve management soQware solu6ons are invaluable for this as they help visualize your team’s ... can be elevated into team leads There are more tips and strategies in our free ebook: The Definitive Guide to Building a World-Class Internal Creative Agency The ebook gives a detailed ... workload and efforts Mix It Up All produc 6on work and no development work makes Jane an unhappy crea6ve Great managers address staff fa6gue by moving people across...
- 14
- 152
- 0
iec 60332-3-24 tests on electric cables under fire conditions - test for vertical flame spread of
... categories, the parts are designated as follows: Part 3- 1O: Apparatus Part 3- 21: Category A F/R Part 3- 22:Category A Part 3- 23: Category Part 3- 24: Category C Part 3- 25:Category D Parts from 3- 21 ... Information Handling Services STDaIEC b 033 2 -3- 24- ENGL 6 033 2 -3- 24 Q IEC:2000 2000 48 448 93 074L3 94 282 m - 13- Definitions For the purpose of this part of IEC 6 033 2 the following definitions apply ... mounting the sample for the test In all categories, cables having at least one conductor of cross-sectional area greater than 35 mm* are tested in a spaced configuration, whereas cables of conductor...
- 28
- 374
- 2
iec 60332-3-25 tests on electric cables under fire conditions - test for vertical flame spread of
... designated as follows: Part 3- 10: Apparatus Part 3- 21: Category A F/R Part 3- 22: Category A Part 3- 23: Category Part 3- 24: Category C Part 3- 25: Category D Parts from 3- 21 onwards define the various categories ... all categories, cables having at least one conductor of cross-sectional area greater than 35 mm2 are tested in a spaced configuration, whereas cables of conductor cross-sectional area of 35 mm2 ... selection of cables A summary of all conditions for type approval testing to this part of IEC 6 033 2 is given in table A. l Table A. l'- Summary of test conditions I I Category and designation I Non-metallic...
- 28
- 291
- 2
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
... binding antibodies N-terminal C-terminal A mouse PrP binding antibodies N-terminal C-terminal kDa kDa 36 36 27 27 SAF 34 P4 6H4 SAF60 SAF70 SAF 84 B 60 40 20 SAF 34 P4 6H4 6H4 SAF60 SAF70 SAF 84 ... SAF 84 60 40 20 SAF60 SAF70 SAF 84 C kDa 6H4 80 glycosylation (%) 80 glycosylation (%) SAF 34 SAF 34 B SAF60 SAF70 SAF 84 SAF70 SAF 84 C kDa 27 27 20 SAF 34 6H4 20 SAF60 SAF70 SAF 84 SAF 34 Fig (A) Western ... N-terminal binding antibodies SAF 34 , P4 and 8G8 or the C-terminal binding antibodies 6H4, SAF60, SAF70 and SAF 84 in consideration of species recognition Values are calculated for the N-terminal antibodies...
- 11
- 536
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGACACTCATACTAACGCCATG ... 5’S2 5’ 34 1 T7 DSLA1 5’ 34 1 T7 DHp2s GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG...
- 15
- 597
- 0
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot
... transforming growth factor -a precursor (TGF -a) from Ovis aries (sheep) (TGFA_SHEEP, P98 135 ; amino acids 7 49 ), fibrillin from the Cnidaria Podocoryne carnea (FBN1_PODCA, AAA9 133 6; amino acids 44 3 48 7), ... (1 3) -b-D-glucan-binding protein was identified biochemically The binding of the linear carbohydrate, curdlan, was abolished by the branched molecule, laminarin, indicating that in S domuncula a binding ... Iwamatsu, A. , Yoshikawa, M., Yamaoka, N & Ishida, I (1997) The structure and function of a soybean b-glucan-elicitor-binding protein Proc Natl Acad Sci USA 94, 1029–10 34 62 Kawabata, S.I., Osaki,...
- 14
- 299
- 0
Báo cáo hóa học: " Comparison of p53 and the PDZ domain containing protein MAGI-3 regulation by the E6 protein from high-risk human papillomaviruses" pdf
... pcDNA3 0.00 33 E6pro-GFP 33 E6var2-GFP 33 E6var3-GFP 33 E6var5-GFP 33 E6var6-GFP 33 E6var7-GFP 33 E6var8-GFP Comparing p 53 protein levels and p 53 transcriptional activity in cells expressing E6-GFP from HPV ... degradation of both p 53 and MAGI -3, there is in increase in detectable p 53 ubiquitination and a decrease in detectable MAGI -3 ubiquitination Discussion Previous studies have demonstrated the ability ... Luciferase Activity Fold Luciferase Activity 5.00 3. 00 2.00 1.00 33 E6var8-GFP 33 E6var7-GFP 33 E6var6-GFP 33 E6var5-GFP 33 E6var3-GFP 33 E6var2-GFP 18E6-GFP 33 E6pro-GFP p 53 18E6-GFP pcDNA3 p 53 pcDNA3 0.00...
- 9
- 383
- 0
Báo cáo hóa học: " A Study on Field Emission Characteristics of Planar Graphene Layers Obtained from a Highly Oriented Pyrolyzed Graphite Block" potx
... electrons are emitted from the graphene tip creating an electron current that can be modulated on and off Fig Fabrication process of graphene sheets using a mechanical exfoliation method The graphene ... f) In order to find and evaluate the graphene layers, the thickness of SiO2 layer on Si was set to 30 0 nm considering optical interference [8] A Zyvex Nanomanipulator operating inside a scanning ... Technology (KAUST) and National Science Foundation (Major Research Instrumentation Program, Award No DMI-0619762) References W .A de Heer, A Chatelain, D Uarte, Science 270, 1179 (1995) H.M Manohara, M.J...
- 4
- 353
- 0
ENGLISH 12 (2010 – 2011) UNIT 3: WAYS OF SOCIALIZING (from period 11 to 15) pptx
... necessary - T calls on a pair of students displaying in front of the class AFTER YOU SPEAK: T asks Ss this situation: - Today! I don’t think that all of you work such hard! T gives comments and ... control and give help if necessary - T calls on a pair of students displaying in front of the class - T gives comments and makes necessary corrections Task 3: T asks Ss to work in pairs task ... front of the class - T gives feedback and correct answers if necessary Task 3: T rereads the passage faster and asks Ss to scan the passage to find out answers of task - T divides the class into...
- 13
- 1,121
- 0
Báo cáo y học: "Ultrasound has the potential to detect degeneration of articular cartilage clinically, even if the information is obtained from an indirect measurement of intrinsic physical characteristics" pdf
... T, Kawai S, Saito T: Non-contact evaluation for articular cartilage using ultrasound JSME Int J Ser A 2006, 49 : 242 - 249 Yasura K, Mizuno Y, Nakagawa Y, Mori K, Takenaka M, Ohashi T, Yamada K, ... enzymatic digestion J Orthop Res 2007, 25:8 84- 8 93 Nishitani K, Nakagawa Y, Gotoh T, Kobayashi M, Nakamura T: Intraoperative acoustic evaluation of living human cartilage of the elbow and knee during ... K, Kobayashi M, Yasura K, Okamoto Y, Suzuki T, Nishitani K, Nakamura T: Ultrasound properties of articular cartilage in the tibio-femoral joint in knee osteoarthritis: relation to clinical assessment...
- 2
- 334
- 0
Báo cáo khoa hoc:" No evidence of enhanced oxidant production in blood obtained from patients with obstructive sleep apnea" potx
... Calibration was performed with a FRAP reagent containing the addition of FeCl2 (total sample volume 1.02 ml, final concentrations from 20 to 2000 μM, concentration points) Absorbance was linear ... of apneas-induced IH events on FRAP obtained after various times of incubation Figure shows the mean evening and morning FRAP of OSAS patients obtained after plasma sample incubation from till ... collections, in addition to the Ferric reducing ability of plasma The incubation of a plasma sample with a FRAP reagent (containing Fe3+ and TPTZ) is recommended in receiving the most reliable results...
- 11
- 347
- 0
Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc
... data are available so far on the prevalence of MetS in schizophrenia patients in Germany In our observational study we addressed this gap, assessing the prevalence of MetS at baseline and month -3 ... contributed to the data analysis, interpretation of data and writing of this report AM contributed to the data analysis, interpretation of data, and writing of this report HPH, DK and TF contributed to ... http://www.biomedcentral.com/ 147 1- 244 X/11/1 73 29 30 31 32 33 34 35 36 37 38 Page 11 of 11 (CATIE) schizophrenia trial and comparison with national estimates from NHANES III Schizophr Res 2005, 80(1):19 -32 Gesundheitsberichterstattung...
- 11
- 425
- 0
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot
... replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) in mammalian cells Acta Virol 2001, 45 : 2 43 - 247 Vanderplasschen A, Pastoret PP: The uses of poxviruses as vectors ... Natl Acad Sci USA 2005, 102:2772-2777 http://www.virologyj.com/content/6/1/55 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 Gallego-Gomez JC, Risco C, Rodriguez D, Cabezas ... adenocarcinoma Rat/liver; hepatoma Human/small intestine; normal Human/duodenum; adenocarcinoma African Green Monkey/kidney; normal Rabbit/kidney; normal Hamster Chinese/ovary Human/lung; carcinoma...
- 13
- 377
- 0
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps
... replicating (Praha) and non-replicating (modified vaccinia virus strain Ankara, MVA) in mammalian cells Acta Virol 2001, 45 : 2 43 - 247 Vanderplasschen A, Pastoret PP: The uses of poxviruses as vectors ... Natl Acad Sci USA 2005, 102:2772-2777 http://www.virologyj.com/content/6/1/55 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 Gallego-Gomez JC, Risco C, Rodriguez D, Cabezas ... adenocarcinoma Rat/liver; hepatoma Human/small intestine; normal Human/duodenum; adenocarcinoma African Green Monkey/kidney; normal Rabbit/kidney; normal Hamster Chinese/ovary Human/lung; carcinoma...
- 13
- 294
- 0
PROJECT 3: RECONSTRUCTION OF SIGNALS FROM SAMPLES
... xlabel('Nghiem 2'); grid; t=0:0.01:2; x2=2*cos((2*pi+pi /3) *t); % ham omega=(2+1 /3) pi plot(t,x2); EXERCISE 3. 2: Linear and Polynomial Interpolation A. Kết nối tín hiệu mẫu đề hàm plot.thời gian ... (1/10))+sin(2*pi*1*( -4) /10+pi /4) *sin(pi*(x 4* 1/10)/(1/10))/(pi*(x 4* 1/10)/ (1/10))+sin(2*pi*1*( -3) /10+pi /4) *sin(pi*(x 3* 1/10)/(1/10))/(pi*(x 3* 1/10)/ (1/10))+sin(2*pi*1*(-2)/10+pi /4) *sin(pi*(x ... +sin(2*pi*1*(1)/10+pi /4) *sin(pi*(x-1*1/10)/(1/10))/(pi*(x-1*1/10)/(1/10)) +sin(2*pi*1*(2)/10+pi /4) *sin(pi*(x-2*1/10)/(1/10))/(pi*(x-2*1/10)/(1/10)) +sin(2*pi*1* (3) /10+pi /4) *sin(pi*(x -3* 1/10)/(1/10))/(pi*(x -3* 1/10)/(1/10)) +sin(2*pi*1* (4) /10+pi /4) *sin(pi*(x -4* 1/10)/(1/10))/(pi*(x -4* 1/10)/(1/10))...
- 14
- 314
- 0
Period 3: exercises of unit 10
... late to learn! Where are the eggs… were in the fridge A who B where C when D which What was the name of the man….wife became ill and was taken to hospital A who B whom C whose D which I have a ... whose A widow is a person……husband is dead A who B which C whom D whose 10 Thank you very much for your letter…you told me a very interesting story of your holiday A on which B which C in which ... …….I must read A who B when C where D which He was the first man ……left the burning building A who B which C whom D whose John is the man ….we are going to recommend for the job A who B which...
- 2
- 917
- 0
BT 3 optimization of medium for indole 3 acetic acid production using pantoea agglomerans strain PVM
... compounds, and its application to Arabidopsis thaliana Planta 216, 44 –56 Pedraza, R.O., Ramırez-Mata, A. , Xiqui, M.L and Baca, B.E (20 04) Aromatic amino acid transferase activity and indole -3- acetic acid ... of indole -3- acetic acid O .A Apine and J.P Jadhav Pantoea agglomerans is wide spread in many diverse natural and agricultural habitats, in particular it is associated with many plants as common ... Biosci 4, 23 32 Khandaswami, C and Vaidyanathan, C.S (19 73) Enzymatic assay of tyrosinase catechole oxidase activity J Biol Chem 249 , 40 35 Kravchenko, L.V., Azarova, T.S., Makarova, N.M and Tikhonovich,...
- 10
- 543
- 1
Tài liệu ADC KRONE - White Paper - Data Center - 3 principles of Data Center Infrastructure Design (with n pptx
... cable makes a bend — both at initial installation and when cables are accessed or added The separation of cable types in horizontal pathways and physical protection of both cable and connections ... identification, access and reconfiguration Because the use of a central patching location in a cross-connect scenario provides a logical and easy-to-manage infrastructure that helps manage growth ... horizontal cabling due to its costeffective electronics, familiar plug-and-play connections, and easy installation Data center horizontal cabling is no exception As businesses evolve and data center...
- 8
- 523
- 0
Tài liệu Activity 4.3: Value of Information Models docx
... 22 Activity 4. 3: Value of Information Models Exercise 1: Identifying the Value of Information Models ! Identify the value of information models Think of how you have used information models in ... Brainstorm as a class the value that informational modeling provides to the design process and specifically to the analysis step of conceptual design The instructor will write your answers on a ... specifically to the analysis step of conceptual design The instructor will write your answers on a flip chart ...
- 2
- 393
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25