Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA ´ ` Therese Astier-Gin, Pantxika Bellecave, Simon Litvak and Michel Ventura ´ UMR-5097 CNRS, Universite Victor Segalen Bordeaux 2, Bordeaux, France Keywords HCV; minus strand RNA; RdRp Correspondence: ´ ` Therese Astier-Gin, CNRS UMR5097, ´ ´ Universite Victor Segalen Bordeaux 2, 146, ´ rue Leo Saignat, 33076 Bordeaux cedex, France Fax: +33 57571766 Tel: +33 57571742 E-mail: Therese.astier@reger.u-bordeaux2.fr (Received 23 March 2005, revised 24 May 2005, accepted June 2005) doi:10.1111/j.1742-4658.2005.04804.x In our attempt to obtain further information on the replication mechanism of the hepatitis C virus (HCV), we have studied the role of sequences at the 3¢-end of HCV minus-strand RNA in the initiation of synthesis of the viral genome by viral RNA-dependent RNA polymerase (RdRp) In this report, we investigated the template and binding properties of mutated and deleted RNA fragments of the 3¢-end of the minus-strand HCV RNA in the presence of viral polymerase These mutants were designed following the newly established secondary structure of this viral RNA fragment We showed that deletion of the 3¢-SL-A1 stem loop significantly reduced the level of RNA synthesis whereas modifications performed in the SL-B1 stem loop increased RNA synthesis Study of the region encompassing the 341 nucleotides of the 3¢-end of the minus-strand RNA shows that these two hairpins play a very limited role in binding to the viral polymerase On the contrary, deletions of sequences in the 5¢-end of this fragment greatly impaired both RNA synthesis and RNA binding Our results strongly suggest that several domains of the 341 nucleotide region of the minus-strand 3¢-end interact with HCV RdRp during in vitro RNA synthesis, in particular the region located between nucleotides 219 and 239 Hepatitis C virus (HCV) is the major causative agent of non-A, non-B hepatitis [1] This virus has a positive-stranded RNA genome and belongs to the Flaviviridae family The RNA contains a large open reading frame that encodes a polyprotein which is cleaved into 10 viral proteins: C, E1, E2, p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B [2] Recently, a frame shift product of HCV core encoding sequence, the F protein, was described [3,4] This protein has no known functions The large open reading frame is flanked by two untranslated regions (UTR) The 341-nucleotide (nt) 5¢UTR in association with the first nucleotides of the core protein contains an internal ribosome entry site (IRES) that directs cap-independent translation of the viral RNA [5,6] The 3¢UTR is composed of a short variable region, a polypyrimidine tract (poly U-UC) of variable length and a highly conserved 98-nucleotide segment (3¢X) The two latter domains are essential for viral infectivity in vivo [7] and RNA replication of HCV in the HCV replicon system [8,9] HCV RNA replication occurs in two steps In the first step the viral replicase synthesizes a minus-strand RNA that serves as a template for the synthesis of new plus-strand RNA molecules Initiation of RNA synthesis at the 3¢-end of the plus- and minus-strand RNA most probably involves interactions between the protein components of the replication complex, in particular with the viral polymerase (NS5B), and structures and ⁄ or sequences of the viral RNA templates The secondary structure of the 3¢-end of the Abbreviations HCV, hepatitis C virus; IRES, internal ribosome entry site; nt, nucleotide; RdRp, RNA-dependent RNA polymerase; TCA, trichloroacetic acid; UTR, untranslated region 3872 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS T Astier-Gin et al plus-strand RNA has been determined [10,11] and the involvement of the three stem loops of the 3¢X has been extensively studied both in vitro, in the replicon system and in vivo [7–9,12] The secondary structure of the 3¢-end of the minus-strand RNA has been established more recently [13,14] It was shown that the 341 nt from the 3¢-end of the minus-strand RNA, complementary to the HCV 5¢UTR, folds into six stem loops With the exception of the short SL-A1 stem loop, the one closest to the 3¢-end, these structures differed from those of the plus-strand RNA Thus the minus-strand 3¢-terminal domain is not the mirror image of its antisense sequence corresponding to 5¢UTR Its role in the initiation of the plus-strand RNA synthesis cannot be directly assessed in the HCV replicon system because translation and replication are linked in this system However, it has been shown that the first 125 nt of the 5¢UTR are essential for RNA replication of HCV replicons in HuH7 cells [15,16] Most probably the 125 nt present at the 3¢-end of the complementary minus-strand RNA is an important element for de novo synthesis of plus-strand RNA Data obtained from in vitro experiments using the recombinant NS5B protein argue for this hypothesis We have previously shown that the recombinant HCV RNA polymerase efficiently replicates the 341 nt of the 3¢-end of the HCV minus-strand RNA in vitro and that deletion of the 3¢ 45 nt greatly impaired RNA synthesis [17] Oh et al [18] showed that RNA synthesis from the HCV minus-strand RNA required a minimum of 239 nt from the 3¢-end Furthermore, we have reported that an oligonucleotide complementary to the SL-B1 domain in the 3¢-end of the HCV minus-strand RNA inhibits in vitro initiation of RNA synthesis by the viral polymerase [19] Kashiwagi et al [20] studied RNA synthesis by recombinant HCV NS5B using deletion mutants of the 3¢ terminus of the minus-strand RNA but deletions were made on the basis of the structure of the 5¢UTR of the plus-RNA, the structure of the 3¢-end of the minusstrand RNA being at that time unavailable In the present study we investigated the involvement of sequences and ⁄ or structures in RNA synthesis directed in vitro by HCV NS5B by using new mutants of the 3¢-end of minus-strand RNA Results Effect of mutations in the 3¢- or the 5¢-end of the (–)IRES HCV RNA template on RNA synthesis The secondary structure of the 3¢-terminal nucleotide region of the HCV minus-strand RNA is illustrated in Fig This fragment contains two domains: domains FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS Binding and replication of 3¢-end of HCV minus RNA I and II Structures of both domain I (A), as determined by Schuster et al [13] and by Smith et al [14], and domain II, as determined, respectively, by Smith et al [14] (B), Schuster et al [13] (C) or predicted by RNA Draw software (D) are represented Nucleotides are numbered increasingly from the 3¢-end of the RNA; the five first stem-loops (A) are named as reported by Schuster et al [13] The 228 nt of domain I fold into five stable stem-loops (A) It has been found to display the same secondary structure in the three models presented here: the fragment containing 365 nucleotides described in [14], the 416 nt fragment described by [13] and the 341 nt fragment, used in this work On the contrary, the 5¢-end of the different RNA fragments (137 nt in Fig 1B, 188 nt in Fig 1C, and 113 nt in Fig 1D) is less stably organized, thus giving different structures in the three cases Effect of modifications at the 3¢-end: mutations or deletions in the SL-A1 and SL-B1 stem loop We have shown previously that the 3¢-end of the HCV minus-strand RNA is replicated highly efficiently in vitro by purified viral polymerase NS5B [17] This high level of RNA synthesis is associated with the presence of a cytidine residue at the 3¢-end Upstream sequences and ⁄ or structures also seem to be involved, as deletion of 45 nt at the 3¢-end greatly reduces RNA synthesis Moreover, as another indication of the importance of this region, we have recently shown that ODN7, an antisense oligonucleotide complementary to a domain comprised between nt 85 and 103 of the 3¢-terminal minus-strand HCV RNA, was able to inhibit RNA initiation [19] To identify more precisely sequences or structural elements important for RNA synthesis we constructed mutants in the SL-A1 and SL-B1 domains comprised in a 341 nucleotide fragment of the 3¢-end minusstrand RNA called (–)IRES This fragment is efficiently replicated in vitro by the HCV NS5B [17] The mutants were designed in such a way that the deletions or the base changes did not alter the structure of the other domains of the (–)IRES RNA as determined by predicted secondary structure with RNA Draw software The structure of the first 151 nt nucleotides of wild-type and mutated RNA is shown in Fig The mutated RNAs were used as templates in the RdRp assay and the levels of RNA synthesis were compared with that of the wild-type (–)IRES Very different results were obtained when changing either stem-loop As shown in Table 1, the deletion of the SL-A1 stem loop in the (–)IRES DSL-A1 mutant reduced the RNA synthesis by 39% These results were 3873 Binding and replication of 3¢-end of HCV minus RNA T Astier-Gin et al Fig Secondary structure of the 3¢ terminal sequences of HCV minus-strand RNA Model structures of domain I (A) and domain II (B, C and D) are shown (A) Domain I is composed by 228 nt located at the 3¢ end The first five stem loops are named as described in [13] (B) Secondary structure of a fragment spanning from nt 229–365 in domain II as described in [14] (C) Secondary structure of domain II, spanning nt 229–416, as described by in [13] (D) Secondary structure of a fragment spanning from nt 229–341 in domain II (predicted by RNA DRAW software) in accordance with those of Kashiwagi et al [20], which showed that deletion of SL-A1 reduced the RNA synthesis by 25% We then performed different deletions or site-directed mutagenesis in the sequence of the hairpin SL-B1 (Fig 2) We carried out the following mutations of SL-B1: (a) [(–)IRESD91-97)] that contains a deletion of nt 91–97 corresponding to a bulge where the ODN7 antisense hybridized; (b) [(–)IRES Dhp2] that contains a deletion of the 39 nt corresponding to the apical part 3874 of SL-B1; (c) [(–)IRES hp2b] with a change of four nt that induces a dissociation of the stem at the base of SL-B1; (d) [(–)IRES LDH2] with a complete deletion of SL-B1 In contrast to the results obtained when changes were introduced in SL-A1, none of the modifications in SL-B1 reduced RNA synthesis (Table 1) In all cases RNA synthesis was increased Altogether, these results indicated that while the presence of the SL-A1 domain is necessary for efficient RNA synthesis, the SL-B1 region does not contain FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS T Astier-Gin et al Binding and replication of 3¢-end of HCV minus RNA Fig Secondary structure of RNA mutated in the SL-A1 and SL-B1 domains Only the secondary structure of the 151 nt from the 3¢-end of the minus-strand RNA is shown The computer predicted structure at 25 °C of the same domain is shown for each mutant RNA The DG of the wild-type (–)IRES RNA and those of the five mutant RNA are indicated The arrows or the curly bracket showed the location of deletions or mutations, respectively sequences or structural domains necessary for the high level of RNA synthesis obtained when incubating in vitro NS5B and the 3¢-end of the minus-strand HCV RNA as template Moreover, modifications of the latter domain even resulted in enhanced RNA synthesis (Table 1) Effect of deletions at the 5¢-end It has been shown that almost all the 5¢UTR region is required for efficient RNA replication of HCV RNA when using the replicon system [15] Thus, we examined the effect of 5¢-end deletions in the (–)IRES 341 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS template on the amount of RNA synthesized in vitro by the HCV NS5B 1a The predicted secondary structure of three deletion mutants is displayed in Fig As shown in Table deletion of 102 nt at the 5¢-end of (–)IRES RNA leading to (–)IRES 239 reduced RNA synthesis by 51% These results are in agreement with those obtained by Oh et al [18] Further deletion of the 5¢-end by 20 nt to give (–)IRES 219 showed a striking reduction of RNA synthesis to only 19% of that obtained with the (–)IRES wild-type RNA Structure prediction by computer analysis showed that the four bases at the 3¢-end of the (–)IRES 239 and (–)IRES 219 were unannealed as in the wild-type 3875 Binding and replication of 3¢-end of HCV minus RNA T Astier-Gin et al Table RNA synthesis obtained with mutants of (–)IRES RNA without or with heparin Determination of Kd for various (–)IRES RNAs An RdRp assay was performed with the purified NS5B1a (150 nM) and mutant RNAs as templates as described in Experimental procedures The amount of RNA synthesized was determined after TCA precipitation and counting in a Wallac scintillation counter The results were expressed as a percentage of the value obtained with the wild-type (–)IRES in the absence or in the presence of heparin (The addition of heparin during RNA synthesis reduced RNA synthesis by 72%) Data were corrected following the number of A residues in each RNA template and were the mean of at least three experiments For Kd determination, a renatured 32P-labeled RNA (13 nM, 167 Bq) was incubated with NS5B (50 nM, 100 nM, 200 nM, 500 nM and lM) for 20 at 25 °C The Kd was estimated from the concentration of NS5B resulting in 50% shifting of 32P RNA Results correspond to mean values of 3–4 independent experiments for each RNA N.D., not determined RNA synthesis percentage (–)IRES RNA (–)-heparin (+)-heparin Kd (nM) (–)IRES 341 (–)IRES DSL-A1 (–)IRESD91-97 (–)IRESDhp2 (–)IRES hp2b (–)IRES LDH2 (–)IRES 239 (–)IRES 219 (–)IRES 104 (–)IRES 100 61 164 159 186 131 49 19 24 100 59 ± 154 ± 165 ± 173 ± 101 ± 40 ± 13 ± 25 ± ND 340 ± 40 370 ± 10 ND ND ND ND 376 ± 31 290 ± 30 330 ± 30 No binding ± ± ± ± ± ± ± ± 20 15 14 16 28 17 18 (–)IRES RNA and that the secondary structures of the stem loops SL-A1, SL-B1, SL-C1 and SL-D1 were unmodified The 5¢-SL-E1 stem loop was unchanged in (–)IRES 239 whereas in (–)IRES 219, the base of the stem was replaced by a six nt bulge (Fig 3) We also performed a deletion of 237 nt at the 5¢-end to give the (–)IRES 104 This deletion preserved the structure of the SL-A1 and of the SL-B1 hairpin and the nt at the 3¢-end remained free as in the wild-type (–)IRES RNA synthesis obtained with the (–)IRES 104 RNA was only 24% of that of the wild-type (–)IRES RNA, a value similar to that of the (–)IRES 219 RNA The fact that the (–)IRES 104 can be used as a template by the recombinant HCV NS5B differed from the data obtained by Oh et al [18] These authors showed that the 122 nt of the 3¢-end of the HCV minus-strand RNA was unable to sustain RNA synthesis Structure prediction by computer analysis revealed that the secondary structure of the 3¢-end of the 122 nt RNA fragment was unmodified compared to wild-type RNA This discrepancy can be explained by differences between the sensitivity of the assays used in the two 3876 studies Finally, we performed an RdRp assay with an RNA fragment corresponding to 20 nt of the 3¢-end of the minus-strand HCV RNA that formed the four base single-strand region and the SL-A1 hairpin As shown in Table 1, our recombinant NS5B was unable to use this RNA as template for RNA synthesis It could be argue that this data results from a misfolding of this short RNA due to a bimolecular association However, this last hypothesis is unlikely because the (–)IRES 20 migrates as one RNA species of the expected size in native gel (data not shown) Further studies are needed to clarify this point Taken together, these results indicate that regions located at the 5¢-end of the (–)IRES RNA are crucial to obtain a high level of RNA synthesis by NS5B in vitro, in particular the 122 nt located at the 5¢-end Alternatively, the elimination of this less stably structured domain decreased RNA synthesis by increasing the relative amount of structured regions giving rise to templates poorly replicated by the NS5B Analysis of RNAs synthesized using wild-type and mutant (–)IRES RNA as templates To examine the products synthesized in the presence of the mutated (–)IRES, an RdRp assay was performed with the NS5B 1a (Fig 4) The same amount of each product (833 Bq) was loaded onto a 6% denaturing polyacrylamide gel All templates with mutations or deletions in the SL-A1 or the SL-B1 stem loop allowed synthesis of a major RNA product with the size of the input template (Fig 4A) No arrest bands were observed during the synthesis with the exception of RNA (–)IRES DSL-A1 that gave a small amount of a product about 39 nt shorter than the template (Fig 4A) The relative quantity of this short product was variable in different experiments In all cases, slower migrating bands were also observed The major one migrated to a position corresponding to an RNA two times larger than the template For the wild-type (–)IRES RNA we have previously shown that this product corresponds to two successive copies of the template [17] Products of higher molecular weight in very low amounts were also visible They may correspond to three (or more) successive copies of the template When RNA synthesis was performed with (–)IRES RNA templates that have deletions in the 5¢-end, a major product migrating to the same position as the template and slower ones were observed (Fig 4A) In the case of the (–)IRES 104, the product which was two-fold the size of the template was almost as abundant as the product the same size as the template In FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS T Astier-Gin et al Binding and replication of 3¢-end of HCV minus RNA Fig Predicted structure of the (–)IRES RNA with deletions of the 5’-end The computer predicted structure at 25 °C and the DG values are shown for three 5’-deleted mutants addition to the product twice the template size, the (–)IRES 239 RNA gave a product of about 375 nt indicated by a star (Fig 4A) Again no prominent arrest of RNA synthesis was observed when (–)IRES RNAs harboring 5¢ deletions were used as templates Data presented in Fig 4A were obtained by using the NS5B D21 from HCV H77 genotype 1a To examine whether a NS5B of another strain of HCV would give the same results, we performed an RdRp assay with a recombinant NS5B D21 purified from the HCV J4 of genotype 1b The products obtained with both enzymes in the presence of wild-type (–)IRES (–)IRES 239 and (–)IRES 104 are shown in Fig 4B The migration patterns of the products synthesized by NS5B of both HCVs were identical Altogether, these results indicated that the mutations and deletions performed in the RNA fragment corresponding to the 3¢-end of the HCV minus-strand RNA did not significantly alter the initiation site of RNA synthesis by recombinant HCV NS5B from different viral strains Analysis of RNA synthesized in one round of synthesis RNA products shown in Fig were obtained under conditions where HCV NS5B could reinitiate RNA FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS synthesis several times To analyze the RNA synthesized in one round of synthesis, we performed RdRp assays in the presence of heparin in order to prevent reinitiation In a first step we determined the heparin concentration needed to prevent reinitiation during a h RdRp assay As illustrated in Fig 5A, heparin at a concentration of 200 lgỈmL)1 (220 times heparin molar excess with respect to the enzyme) reduced RNA synthesis by 72% Incubation with a higher concentration (400 lgỈmL)1) did not significantly modify the level of RNA synthesis, suggesting that the amount of heparin was sufficient to sequester all enzyme molecules These data were confirmed by performing a kinetic experiment in the presence of heparin at 200 lgỈmL)1 As shown in Fig 5B, the amount of synthesized RNA greatly increased in the first 10 of the reaction to reach a plateau after 30 Analysis of the RNA products on polyacrylamide gel showed that the size of the products did not increase, indicating that the elongation step was achieved (data not shown) We then compared the total level of RNA synthesized in the presence or absence of heparin at 200 lgỈmL)1, using the various templates Results reported in Table show that the level of RNA synthesis obtained with the mutated templates (compared 3877 Binding and replication of 3¢-end of HCV minus RNA A T Astier-Gin et al B Fig RNA synthesized by NS5B in the presence of wild-type and mutated RNAs Wild-type and mutated (–)IRES RNAs were used in RdRp assays An aliquot of the reaction products was precipitated by 10% TCA and the radioactivity incorporated in newly synthesized RNA determined as described in Experimental procedures section The remaining of the products was purified by phenol ⁄ chloroform extraction (1 : 1, v ⁄ v) and precipitated by one volume of isopropanol in the presence of 0.5 M ammonium acetate 32 P-labeled reaction products (833 Bq each) were denatured and loaded onto a 6% denaturing polyacrylamide gel (A) Products synthesized by HCV NS5B genotype 1a (B) Products synthesized by HCV NS5B genotype 1a or NS5B 1b as indicated in the figure A labeled 0.16–1.77 kb RNA ladder (Gibco-BRL) and the labeled RNA templates were used as size markers to wild-type RNA) was very similar under both conditions The only exception was observed in the case of the (–)IRES LDH2 template, where the entire SL-B1 stem loop has been deleted Results with this construction displayed a slightly but significantly reduced RNA synthesis in the presence of heparin compared to that observed in the absence of this compound Our further step was to study RNA products formed under single-round conditions, i.e in the presence of heparin as the trapping molecule As shown in Fig 6A when the wild-type (–)IRES was used as template for HCV NS5B in the presence of heparin, a template sized RNA was the major RNA product Interestingly, the high molecular weight RNA corresponding to two (or more) successive copies of the template disappeared Heterogeneous RNA of smaller sizes were also observed but in very low amounts These data indicate: (a) that the HCV NS5B is highly processive and (b) that the high molecular weight product was the result of a reinitiation process The same results were obtained when (–)IRES RNA mutated or deleted in the SL-A1 or in the SL-B1 stem loops were used as templates in the presence of heparin (data not shown) When one round of RdRp assay was performed with the 5¢ deleted (–)IRES RNA 239 and 104 different 3878 patterns were observed (Fig 6B) With the (–)IRES 239 the major product was always a template size RNA, while the high molecular weight RNA twofold the size of the template was absent In contrast, the 375 nt RNA product was synthesized (Fig 6B) The same type of experiment undertaken with the (–)IRES 104 showed that all the products two to four times the size of the template (and visible in Fig 4A) disappeared almost completely, as only a faint high molecular weight band was visible (Fig 6B) In this latter case, in addition to the template size product, a short RNA product was present in relatively high amounts suggesting that under these conditions HCV NS5B often released from the 104 nt RNA template after initiation of RNA synthesis In addition to RNA synthesized from the 3¢-end of the HCV minus-strand RNA, we have previously described the products using the 3¢-end of the plus-strand HCV RNA as template [17] To assess whether the high molecular weight RNA produced from one of these plus-strand RNA fragments called (+) 3¢UTRNDX also disappeared, we performed experiments in the presence of heparin The (+) 3¢UTRNDX template corresponded to 150 nt 3¢ of the NS5B coding sequence plus the 3¢UTR sequence deleted from FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS T Astier-Gin et al Binding and replication of 3¢-end of HCV minus RNA of the template size but, even in the absence of heparin, no high molecular weight RNA were observed suggesting a different initiation mechanism of RNA synthesis for both viral polymerases Binding of wild-type and mutated (–)IRES RNA to HCV NS5B Fig Effect of heparin on RNA synthesized by NS5B (A) Wildtype (–)IRES RNA was preincubated for 30 at 25 °C in the RdRp reaction mixture without ATP and UTP Various concentrations of heparin were then added followed by ATP and 3H-UTP The reaction mixture was further incubated at 25 °C for h The amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against heparin concentration (B) An RdRp assay using 32P-UTP as labeled nucleotide was performed as above in the presence of heparin (200 lgỈmL)1) with wild-type (–)IRES RNA as template Twenty microliters were removed from the reaction mixture at different times The amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against the incubation time in minutes the 3¢X 98 nt As shown in Fig 6A, in the absence of heparin this RNA gave a major RNA product of the template size (282 nt) and a slower migrating product twice the size of the template This high molecular mass RNA was not observed in the presence of heparin (Fig 6A) indicating that the mechanism of reinitiation operates in RNA synthesis using both the plus and the minus 3¢-ends of HCV RNA as templates Finally, we wanted to see if a recombinant NS5B purified from a highly related virus, the GBV-B was able to synthesize the same type of RNA as HCV NS5B from the wild-type (–)IRES RNA Data presented in Fig 6A showed that as in the case of HCV NS5B, the GBV-B NS5B synthesized a major product FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS Data described above indicate that deletions of the stem loop SL-A1 at the 3¢-end or of 102, 122 or 237 nucleotides at the 5¢-end of the (–)IRES 341 nt RNA diminished in vitro RNA synthesis directed by the HCV NS5B To assess whether the low level of RNA synthesis was related to the binding of these templates to the HCV RdRp, we performed gel shift assays Results of such an experiment are presented in Fig They showed that the binding of both wild-type and 239 (–)IRES RNA was complete at lm NS5B In a native polyacrylamide gel, the two RNA migrated as one species (Fig 7A); however, in some experiments a slowly migrating band of RNA was observed (see below) In our experimental conditions the [32P]RNA ⁄ NS5B complex remained at the top of the gel The Kd values for the wild-type and deleted RNAs were determined from curves obtained as in Fig 7B As shown in Table 1, with the unique exception of the (–)IRES20 RNA that did not bind the NS5B, all four mutated RNAs bound the viral polymerase with the same affinity as the wild-type (–)IRES RNA Competition experiments were then performed with all mutated RNAs and the wild-type (–)IRES RNA for binding to the enzyme NS5B (500 nm) and wildtype [32P](–)IRES RNA (13 nm) were incubated with increasing amounts of cold RNAs and analyzed by electrophoresis on nondenaturing polyacrylamide gel Free 32P-labeled (–)IRES migrated as two bands, a major one indicated by an arrow and a minor one that migrated more slowly (Fig 8) Repeated experiments indicated that the latter band was not visible in every electrophoresis analysis of a same 32P-labeled RNA preparation Small variations in denaturation–renaturation conditions or during electrophoresis could explain these differences In the presence of NS5B, a clear shift of both RNA species was observed As shown in Table and illustrated in Fig 8A, 44 nm of wild-type RNA released half of the labeled RNA in the complex with NS5B This dissociation is specific as lm yeast tRNA was unable to release the (–)IRES RNA bound to NS5B (data not shown) The five RNAs with deletions or mutations in the two stem loops SL-A1 or SL-B1 located close to the 3¢-end displaced the 32P-labeled (–)IRES RNA at slightly higher concentrations ranging from 53 nm for (–)IRES Dhp2b 3879 Binding and replication of 3¢-end of HCV minus RNA A T Astier-Gin et al B Fig Effect of heparin on RNA synthesized by NS5B Wild-type and mutated (–)IRES RNAs were preincubated for 30 at 25 °C in the RdRp reaction mixture without ATP and UTP Heparin (200 lgỈmL)1) was then added followed by ATP and [32P]UTP The reaction mixture was further incubated at 25 °C for h [32P]RNA products were quantified after TCA precipitation of an aliquot of the reaction mixture as described in Experimental procedures section 32 P-labeled reaction products (833 Bq each) were denatured and loaded onto a 6% denaturing polyacrylamide gel (A) RNA products synthesized without or with heparin (200 lgỈmL)1) by HCV or GBV-B NS5B The templates used corresponded to 3’ domains of plus or minus-strand HCV RNA (B) RNA products synthesized by HCV NS5B in the presence of heparin with wild-type or 5’ deleted (–)IRES RNA to 97 nm for (–)IRES hp2b On the contrary, higher amounts of 5¢ deleted RNAs were needed to dissociate the NS5B ⁄ [32P](–)IRES RNA complex (Table and Fig 8B) As expected no competition was observed between the wild-type (–)IRES and the (–)IRES 20 RNAs (data not shown) These results strongly suggest that multiple domains of the 341 nt of the minusstrand RNA 3¢-end are involved in the binding to NS5B in particular the region located between nt 219 and 239 Consequently, one can hypothesize that the 5¢ deleted RNA did not bind NS5B in the same manner as the wild-type RNA and could not efficiently displaced this RNA in complex with NS5B Discussion The replication mode of Flaviviridae, which involves synthesis of a minus-strand RNA serving as template for synthesis of the plus RNA genomic strand, would 3880 seem to indicate that the 3¢-end of HCV minus-strand RNA should play an important role in the initiation of synthesis of the viral genome In this report we investigated the template and binding properties of mutated and deleted RNA fragments of the 3¢-end of the minus-strand HCV RNA in further detail This study should lead to interesting interpretations since it is facilitated by the recent determination of the secondary structure of this region [13,14] We first analyzed the effect of mutations or deletions in the two stem loops SL-A1 and SL-B1 located near the 3¢-end The deletion of SL-A1 significantly reduced the level of RNA synthesis directed by NS5B but mutations or deletions performed on SL-B1 (including its complete deletion) not have a deleterious effect on the level of RNA synthesis in one or several rounds of synthesis Our results showed that, unlike for SL-A1, the deletion of the entire stem loop SL-B1 or part of this domain increased in vitro RNA FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS T Astier-Gin et al A B Fig Gel shift assay with wild-type or 239 (–)IRES RNA After denaturation and renaturation, 32P-labeled RNA 341 (–)IRES and 239 (–)IRES (13 nM, 167 Bq) were incubated with NS5B (50 nM, 100 nM, 200 nM, 500 nM, 1000 nM and 2500 nM) in the RdRp reaction mixture without nucleotides for 20 at 25 °C The reaction products were analyzed on a 4% polyacrylamide nondenaturing gel The gel was autoradiographied and the amount of unbound RNA determined by scanning with NIH image (A) Autoradiogram of the gel (B) The percentage of wild-type (d) or 239 (s) RNA bound with enzyme was plotted against NS5B concentration synthesis by NS5B It looks like, when increasing the relative amount of unstructured domains in the template, the RNA synthesis by NS5B is enhanced However, the level of RNA synthesis observed with the RNA mutant (–)IRES D91–97 did not fit with this hypothesis, suggesting that interactions of the bulge formed by the deleted sequences with other regions of the RNA or with NS5B could occur FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS Binding and replication of 3¢-end of HCV minus RNA Analysis of the products showed that the synthesized RNAs are homogenous in size suggesting that initiation occurred by a de novo mechanism at the 3¢-end of all SL-A1 or SL-B1 mutated templates, as previously shown for the wild-type (–)IRES RNA [17] The HCV NS5B polymerase appeared to be highly processive in all cases as no major product shorter than the template could be observed even in the presence of heparin We have also shown that the NS5B is unable to synthesize RNA from the (–)IRES20 RNA corresponding to the four free nucleotides of the 3¢-end and the SL-A1 hairpin RNA products were only obtained when sequences corresponding to the SL-B1 stem loop were added at the 5¢-end giving the (–)IRES104 RNA A significant level of RNA produced from the (–)IRES 104 RNA was obtained even though it is about 25% that of the wild-type (–)IRES However in the latter case the synthesis is less processive as a pause is observed in about half of the initiation events These results indicate that the polymerase frequently dissociates from the template after initiation from (–)IRES 104 RNA suggesting that sequences between nt 104 and 341 stabilize the RNA polymerase complex during the elongation process Data obtained with other 5¢ deleted mutants (–)IRES 219 and (–)IRES 239, confirmed these results In both cases, these two templates can sustain efficient elongation without polymerization arrest and NS5B release from the template The level of RNA synthesized from (–)IRES 219 is in the range of that observed with (–)IRES 104 but the addition of 20 nucleotides at the 3¢-end to give (–)IRES 239 enhances this process by doubling the amount of RNA product (Table 1) A striking observation when analyzing the products obtained with our recombinant NS5B-1a is the presence of high molecular weight RNA two to three times the size of the template These products correspond to successive copies of the (–)IRES RNA [17] In this study, we showed that these high molecular weight products were also synthesized with the recombinant RdRp of an HCV of genotype 1b (Fig 4B) but not with the NS5B of the highly related GBV-B virus (Fig 6A) These products were not specifically produced from templates derived from the 3¢-end of HCV minus-strand RNA as they were also present when RNA fragments of the 3¢UTR were used as templates Data from RdRp assays performed in the presence of heparin indicated that these products occurred after a reinitiation event on a different template except in the case of a product of about 375 nt when using the (–)IRES 239 as template The nature of the latter 375 nt RNA remains to be elucidated 3881 Binding and replication of 3¢-end of HCV minus RNA T Astier-Gin et al A B Fig Competition gel shift assay with wild-type and deleted (–)IRES RNA 32P-labeled (–)IRES RNA was incubated with NS5B (500 nM) and different amounts of unlabelled RNAs in a 10 lL reaction mixture RNA was renatured as described in material and methods section After 20-min incubation at 25 °C, the products were analyzed in non denaturing polyacrylamide gels Table Determination of Kd by competition gel shift assay with wild-type and mutated (–)IRES RNA 32P-labeled (–)IRES was incubated with NS5B (500 nM) and the various mutated unlabelled RNAs (10 nM, 50 nM, 200 nM, 400 nM and 800 nM) The dissociation constant was estimated from the concentration of the unlabelled RNA resulting in 50% dissociation of [32P]RNA Experiments were repeated at least three times with each RNA RNA (–)IRES (–)IRES (–)IRES (–)IRES (–)IRES (–)IRES (–)IRES (–)IRES (–)IRES Kd (nM) 341 DSLA1 D91-97 Dhp2 hp2b LDH2 239 219 104 44 64 85 53 97 67 178 344 670 ± ± ± ± ± ± ± ± ± 10 23 11 34 34 47RNA A similar study [20] analyzed the template properties of different deletion mutants of the 3¢-end of the minus-strand HCV RNA Apparently our results obtained with the (–)IRES DSL-A1 are in accordance with their observations using a similar template called SL234–1D However, in the absence of secondary structure available for the 3¢-end of the minus-strand RNA at that time, they designed their mutations following the secondary structure of the 5¢UTR that differs completely except at the level of the first stem 3882 Consequently their results are hardly comparable with those described in this report Moreover, it should be noted that they observed products corresponding to polymerase arrests when sequences comprised between nt 247 and 313 from the 3¢-end were present in their templates derived from the 3¢-end of the minus-strand RNA This differed from our data that showed that short products were only visible with (–)IRES 104 This discrepancy could be explained by differences in RdRp assays, particularly the divalent cation used Kashiwagi et al [20] used manganese whereas we use magnesium which is assumed to be the divalent cation involved in the viral polymerase activity in infected cells With the exception of the (–)IRES 20, all our RNA mutants bound the HCV NS5B but they compete with the wild-type sequence with varying efficiencies The five RNAs carrying deletions or mutations in SL-A1 or SL-B1 domains (DSL-A1, D91-97, Dhp2, hp2b and LDH2) competed with (–)IRES RNA for binding on NS5B with a slightly lower efficiency than the wild-type RNA On the contrary, the 5¢ deleted mutants were poor competitors Indeed, the amount of (–)IRES 239, 219 and 104 needed to displace labeled (–)IRES RNA were four-, eight- and 16-fold higher than that of wild-type RNA, respectively The strong effect of the deletion of nt 219–239 on RNA binding correlated with the effect of this deletion on RNA synthesis, suggesting an important interaction between this domain and the FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS T Astier-Gin et al HCV NS5B during RNA synthesis It should be noted that this deletion affected the hinge between stem loops SL-E1 and SL-AII Notably, the apical loop and the upper part of the stem of SL-E1 has a primary sequence homology with the SL-II stem loop of the 3¢UTR [13,14] It has been previously shown that a recombinant NS5B interacts with the 3¢X sequence of the 3¢UTR by binding the stem of the SL-II stem loop and the hinge between SL-I and SL-II [12] More precise analysis by site directed mutagenesis in the context of the 341 nt RNA fragment is needed to identify the role of this stem loop in NS5B binding and RNA synthesis from the HCV minus-strand RNA Altogether these results suggest that several domains of the RNA fragment comprising the 341 nt from the 3¢end of the minus-strand RNA are able to interact with NS5B This is reminiscent of the observation by Friebe et al [15] showing that the 341 nt of the 5¢UTR are needed for efficient replication of HCV RNA in the replicon system Their study showed that the first 125 nt of the 5¢UTR are sufficient for a low level of RNA replication in agreement with our results However, our data differ from theirs since they observed that a deletion between nucleotides 72–96 and 61–104 abolished RNA synthesis whereas in our experiments deletion in this domain had no such effect This discrepancy may be explained by the fact that we have used different systems to study RNA synthesis and also that sequences identified in the replicon system may be involved in replication step(s) other than the synthesis of plus-strand RNA from the minus-strand In our case, we used the soluble recombinant NS5B alone whereas in the replicon system, NS5B is bound to reticulum membranes and is included in a complex formed by viral and cellular proteins [22–24] We are currently developing a cellular system with a reporter gene which will allow the measurement of plus-strand RNA synthesis from minus-strand RNA in HuH7 cells constitutively expressing the HCV nonstructural proteins Such a system should permit a direct means of determining the cissequences of the HCV minus-strand RNA involved in synthesis of the viral genome Data presented in this report provide a basis to test the relevance of sequences and ⁄ or structures implicated in this step of viral RNA replication in the infected cells Experimental procedures Recombinant HCV RdRp The recombinant HCV NS5B-D21 of H77 (genotype 1a) was expressed in Escherichia coli and purified as previously described [17] For construction of an expression vector of FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS Binding and replication of 3¢-end of HCV minus RNA a HCV NS5B-D21 (genotype 1b), a 1728 bp DNA fragment was amplified from the HCV infectious molecular clone pCV-J4L6S [21] kindly provided by J Bukh (NIH, Bethesda, MD, USA) The primers used were NS5Bj4s2: 5¢-GATATCATGTCAATGTCCTATACGTGGAC-3¢ and NS5Bj4r 5¢-AAACTCGAGGCGGGGTCGGGCACGAGA CAGG-3¢ The PCR fragment was cleaved with restriction enzymes EcoRV and Xho1 and inserted between the Nde1 site (blunted by Klenow enzyme) and the Xho1 site of the pET21b vector For construction of an expression vector of the GBV-B NS5B-D19, a 1728 bp DNA fragment was amplified from the sequence coding for the GBV-B-NS5B kindly provided by A Martin (Institut Pasteur, Paris, France) The primers used were VB1: 5¢-AAACATATGA GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG AGCTTCACAAGAAACTTCTGC-3¢ The PCR fragment was cleaved by the restriction enzymes Nde1 and Xho1 and inserted between the Nde1 and the Xho1 sites of the pET21b The HCV NS5B-1b and the GBV-B NS5B were purified following the same procedure as for the HCV NS5B-1a except that for the GBV-B NS5B a desalting column (HiTrap mL desalting, Amersham Pharmacia Biotech) was used instead of the monoS column after IMAC RNA templates RNA (–)IRES corresponding to the 3¢-end of the minusstrand RNA was synthesized by in vitro transcription of DNA obtained by PCR amplification from the pGEM9Zf(–) containing the 341 nucleotides of the 5¢UTR of HCV-H77 (pCU-UTRu) The PCR primers were designed to introduce a T7 RNA polymerase promoter in the correct orientation (Table 3) PCR was performed with the AmpliTaq gold DNA polymerase kit (Applied Biosystem, Branchburg, USA) RNAs were synthesized using the MEGAscript kit (Ambion, Austin, TX, USA) DNA templates were digested with DNase for 15 After phenol ⁄ chloroform extraction, the RNAs were precipitated with isopropanol The purity and the integrity of RNAs were determined by analysis on a 6% polyacrylamide gel containing m urea in TBE buffer (90 mm Tris ⁄ borate pH 8.0, mm EDTA) All RNA mutants were obtained by modification of the 5¢UTR sequence contained in the pCV-UTR4 The RNA (–)IRES D91-97 and (–)IRES hp2b were obtained by mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) with oligonucleotides D91–97a and D91–97b and oligoncleotides hp2bs and hp2br, respectively The RNA (–)IRES Dhp2 was obtained by replacement of the Not1-Nco1 fragment of the pCV-UTR4 with the corresponding sequence deleted of the nucleotides 38–77 (olignucleotides DHp2s and DHp2r) Before ligation these oligonucleotides were hybridized and cleaved by Not1 and Nco1 The RNA (–)IRES LDH2 was obtained by changing the Not1-Age1 fragment of the pCV-UTR4 with the corresponding fragment deleted from all nucleotides of SLB1 3883 Binding and replication of 3¢-end of HCV minus RNA T Astier-Gin et al Table Oligonucleotides used in PCR and mutagenesis experiments The sequence corresponding to the T7 RNA polymerase promoter is underlined RNA Oligonucleotide Sequence (5¢ fi 3¢) (–)IRES 341 (–)IRES DSLA1 (–)IRES Dhp2 5’S2 5’341T7 DSLA1 5’341T7 DHp2s GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGACACTCATACTAACGCCATG GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGCCGGCTGGACTTGTCCGG GGAGCCACCATTAAAGAAGGG DHp2r (–)IRES D91–97 (–)IRES hp2b (–)IRES LDH2 D91–97a D91–97b hp2bs hp2br LDH2s LDH2r (–)IRES 239 (–)IRES 219 (–)IRES 104 +UTR3’ NDX 239r 5’S2 219r 5’S2 104r 5’S2 UTR 3a2 UTR3d (oligonucleotides LDH2s and LDH2r) The RNA (–)IRES DSLA1 (–)IRES 239 (–)IRES 219 (–)IRES 104 were obtained by PCR on pCV-UTR with primers indicated in Table The (–)IRES20 RNA was chemically synthesized by Dharmacon RNA technologies (Chicago, USA) RNA labeling RNAs were labeled by in vitro transcription using the MEGAscript kit (Ambion) and 15 lCi [32P]UTP[aP] (Amersham Pharmacia Biotech, Piscataway, NJ, USA) The amount of radioactivity incorporated into the nucleic acids was measured by precipitating lL aliquots with 10% (v ⁄ v) trichloroacetic acid (TCA) and counting in a Wallac scintillation counter RNA were precipitated with isopropanol and dissolved in water RdRp assay The assay was performed in a total volume of 20 lL containing 20 mm Tris ⁄ HCl pH 7.5, mm DTT, mm MgCl2, 40 mm NaCl, 17 U RNasin (Promega, Madison, WI, USA), 0.5 mm each of the NTP (ATP, CTP, GTP), 86 nm of RNA template, 150 nm of purified NS5B and either 10 lCi [32P]UTP[a P] (3000 CiỈmmol)1, Amersham Pharmacia Biotech) and lm UTP or lCi [3H]UTP (46 CiỈmmol)1) The reaction mixture was incubated for h 3884 at 25 °C and stopped by the addition of 10% (v ⁄ v) TCA The radioactivity incorporated into newly synthesized RNA was then determined To quantify and analyze the 32P-labeled RNA, the synthesis was stopped by adding 6.25 mm EDTA, 10 mm Tris ⁄ HCl pH 7.5 and 0.125% (w ⁄ v) SDS An aliquot of the reaction products was precipitated by 10% (v ⁄ v) TCA and the radioactivity incorporated in newly synthesized RNA determined as above The remaining of the products was purified by phenol ⁄ chloroform extraction (1 : 1, v ⁄ v) and precipitated by volume of isopropanol in the presence of 0.5 m ammonium acetate RNAs were dissolved in 95% formamide, 0.5 mm EDTA, 0.025% (w ⁄ v) SDS, 0.025% (w ⁄ v) bromophenol blue, 0.025% (w ⁄ v) xylene cyanol, then heated for at 94 °C and a same amount of each sample was loaded onto a 6% (w ⁄ v) polyacrylamide denaturing gel containing m urea in TBE buffer After electrophoresis, the gel was dried and autoradiographied using Kodak Xomat-AR-5 films For single-round replication assay, HCV RdRp and RNA were preincubated for 30 at 25 °C in the same reaction mixture as above but without ATP and UTP Heparin (MW 4000–6000 Da, 200 lg mL)1) was then added followed by ATP and [32P]UTP The reaction mixture was further incubated at 25 °C for h The 32P-labelled RNA products were quantified after TCA precipitation and a same amount of each product was analyzed on a denaturing polyacrylamide gel as described in the above paragraph FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS T Astier-Gin et al Gel shift assay Labeled RNA was thermally denatured for at 94 °C, and then quickly cooled on ice for RNA at a concentration of 13 nm (167 Bq) was renaturated at 25 °C during 10 in lL RdRp reaction mixture (without NTP) before adding various amounts of enzyme (in a lL volume) The incubation was continued for 20 at 25 °C Two lL of electrophoresis loading buffer [10 mm Tris pH 8.0, mm EDTA, 0.1% (w ⁄ v) bromophenol blue, 0.1% (w ⁄ v) xylene cyanol, 30% (v ⁄ v) glycerol] were added to the samples before loading onto a nondenaturing 4% (w ⁄ v) polyacrylamide gel (acrylamide ⁄ bis acrylamide 59 : 1) The electrophoresis was run at 200 V at room temperature The gel was autoradiographed and scanned using the NIH image program The amount of unbound [32P]RNA was calculated from scanning analyses The percentage of bound RNA was deduced and plotted against NS5B concentration The 0% and 100% unbound [32P]RNA corresponded to the values obtained at saturating concentration of NS5B and in the absence of enzyme, respectively The dissociation constant was estimated from the concentration of the NS5B resulting in 50% shifting of [32P]RNA For competitive EMSA, labeled RNA was incubated in the same conditions as above with unlabelled RNAs at different concentrations and with NS5B (500 nm) The amount of [32P]RNA released from the NS5B protein was calculated from scanning analyses and plotted against the concentration of unlabelled RNA The and 100% released [32P]RNA corresponded to the values obtained in the absence of unlabelled RNA with enzyme and without enzyme, respectively The dissociation constant was estimated from the concentration of the unlabelled RNA resulting in 50% dissociation of [32P]RNA Acknowledgements We thank Laura Tarrago-Litvak for helpful discussions and critical reading of the manuscript This work was supported by the Agence Nationale de Recherche contre le Sida (ANRS), the Centre National de la Recherche Scientifique (CNRS), the Institut National ´ ´ de la Sante et de la Recherche Medicale (INSERM), The University Victor Segalen Bordeaux 2, the Ligue ´ contre le Cancer (Comite de la Dordogne), and the ´ ´ Reseau National hepatite P B was supported by a graduate fellowship from ANRS References Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW & Houghton M (1989) Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome Science 244, 359–362 FEBS Journal 272 (2005) 38723886 ê 2005 FEBS Binding and replication of 3Â-end of HCV minus RNA Clarke B (1997) Molecular virology of hepatitis C virus J Gen Virol 78, 2397–2410 Walewski JL, Keller TR, Stump DD & Branch AD (2001) Evidence for a new hepatitis C virus antigen encoded in an overlapping reading frame RNA 7, 710– 721 Xu Z, Choi J, Yen TS, Lu W, Strohecker A, Govindarajan S, Chien D, Selby MJ & Ou J (2001) Synthesis of a novel hepatitis C virus protein by ribosomal frameshift EMBO J 20, 3840–3848 Wang C, Sarnow P & Siddiqui A (1993) Translation of human hepatitis C virus RNA in cultured cells is mediated by an internal ribosome-binding site J Virol 67, 3338–3344 Rijnbrand R, Bredenbeek P, Van Der Straaten T, Whetter L, Inchauspe G, Lemon S & Spaan W (1995) Almost the entire 5¢ non-translated region of hepatitis C virus is required for cap-independent translation FEBS Lett 365, 115–119 Yanagi M, St Claire M, Emerson SU, Purcell RH & Bukh J (1999) In vivo analysis of the 3¢ untranslated region of the hepatitis C virus after in vitro mutagenesis of an infectious cDNA clone Proc Natl Acad Sci USA 96, 2291–2295 Friebe P & Bartenschlager R (2002) Genetic analysis of sequences in the 3¢ nontranslated region of hepatitis C virus that are important for RNA replication J Virol 76, 5326–5338 Yi M & Lemon SM (2003) 3¢ nontranslated RNA signals required for replication of hepatitis C virus RNA J Virol 77, 3557–3568 10 Tanaka T, Kato N, Cho MJ, Sugiyama K & Shimotohno K (1996) Structure of the 3¢ terminus of the hepatitis C virus genome J Virol 70, 3307–3312 11 Blight KJ & Rice CM (1997) Secondary structure determination of the conserved 98-base sequence at the 3¢ terminus of hepatitis C virus genome J Virol 71, 7345– 7352 12 Oh JW, Sheu GT & Lai MM (2000) Template requirement and initiation site selection by hepatitis C virus polymerase on a minimal viral RNA template J Biol Chem 275, 17710–17717 13 Schuster C, Isel C, Imbert I, Ehresmann C, Marquet R & Kieny MP (2002) Secondary structure of the 3¢ terminus of hepatitis C virus minus- strand RNA J Virol 76, 8058– 8068 14 Smith RM, Walton CM, Wu CH & Wu GY (2002) Secondary structure and hybridization accessibility of hepatitis C virus 3¢-terminal sequences J Virol 76, 9563–9574 15 Friebe P, Lohmann V, Krieger N & Bartenschlager R (2001) Sequences in the 5¢ nontranslated region of hepatitis C virus required for RNA replication J Virol 75, 12047–12057 3885 Binding and replication of 3¢-end of HCV minus RNA 16 Kim YK, Kim CS, Lee SH & Jang SK (2002) Domains I and II in the 5¢ nontranslated region of the HCV genome are required for RNA replication Biochem Biophys Res Commun 290, 105–112 17 Reigadas S, Ventura M, Sarih-Cottin L, Castroviejo M, Litvak S & Astier-Gin T (2001) HCV RNA-dependent RNA polymerase replicates in vitro the 3¢ terminal region of the minus-strand viral RNA more efficiently than the 3¢ terminal region of the plus RNA Eur J Biochem 268, 5857–5867 18 Oh JW, Ito T & Lai MM (1999) A recombinant hepatitis C virus RNA-dependent RNA polymerase capable of copying the full-length viral RNA J Virol 73, 7694– 7702 19 Reigadas S, Ventura M, Andreola ML, Michel J, Gryaznov S, Tarrago-Litvak L, Litvak S & Astier-Gin T (2003) An oligonucleotide complementary to the SLB1 domain in the 3¢-end of the minus-strand RNA of the hepatitis C virus inhibits in vitro initiation of RNA synthesis by the viral polymerase Virology 314, 206– 220 20 Kashiwagi T, Hara K, Kohara M, Iwahashi J, Hamada N, Honda-Yoshino H & Toyoda T (2002) Promoter ⁄ 3886 T Astier-Gin et al 21 22 23 24 origin structure of the complementary strand of hepatitis C virus genome J Biol Chem 277, 28700– 28705 Yanagi M, St Claire M, Shapiro M, Emerson SU, Purcell RH & Bukh J (1998) Transcripts of a chimeric cDNA clone of hepatitis C virus genotype 1b are infectious in vivo Virology 244, 161–172 Mottola G, Cardinali G, Ceccacci A, Trozzi C, Bartholomew L, Torrisi MR, Pedrazzini E, Bonatti S & Migliaccio G (2002) Hepatitis virus nonstructural proteins are localized in a modified endoplasmic reticulum of cells expressing viral subgenomic replicons Virology 293, 31–43 Moradpour D, Gosert R, Egger D, Penin F, Blum HE & Bienz K (2003) Membrane association of hepatitis C virus nonstructural proteins and identification of the membrane alteration that harbors the viral replication complex Antiviral Res 60, 103–109 Aizaki H, Lee K-J, Sung VM, Ishiko H & Lai MM (2004) Characterization of the hepatitis C virus RNA replication complex associated with lipid rafts Virology 324, 450–461 FEBS Journal 272 (2005) 3872–3886 ª 2005 FEBS ... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG