... 5’-CGCGGAACCA-GTCGTCGAAGC-3’, (McCaw ctv., 1997) Mẫu dò TaqMan 5’-CTACGAGGGGCCGACGCGAGCCTGGA-3’ 15 2.3 Real-time PCR địnhlượng DNA PrV * Hn hp phn ng (25 àl): àl (500 ng) ca DNA b gene 12,5 àl ca ... virus in dexamethasone treated pigs Virology Section, Central Animal Health Laboratory, MAF Quality Management, Upper Hutt, New Zealand Tài liệu internet www.sanidadanimal.info/ /images/9virus.gif ... Diseaenter, USDA, Agricultural Research Service, PO Box 70, AmeA 50010 K M Tham, M X J Motha, G W Homer, and J C Ralston.1993 Polymerase chain reaction amplification of latent Aujeszky's disease virus...
... truyền (explantation and cocultivation) mô nhiễm bệnh, hai phương pháp tốn nhiều thời gian độ nhạy không cao, sử dụng kỹthuật phân tử giúp ích với việc nâng cao độ nhạy độ xác (McFarlane ctv., ... huyết âm tính (Jacobs và ctv, 1996; McCaw ctv, 1997) Những kỹthuật khác phát triển để phát địnhlượng nhiễm PrV tiềm ẩn (Schang and Osorio, 1994; Denis ctv., 1997) Kỹthuật này, d a vào cấy chuyển ... of the AD virus (nguồn: www.sanidadanimal.info/ /images/9virus.gif ) 1.1.1 Lịch sử phân bố đ a lí Năm 1902, Aladar Aujeszky, giáo sư vi trùng học trường Thú y Budapest phân lập bệnh việc nuôi...
... NanoQuant real-time HBV Cobas AmpliPrep/Cobas Taqman HBV Chúng so sánh định lợng HBV 97 mẫu huyết dơng tính HBV hai kit NanoQuant real-time HBV Cobas AmpliPrep/Cobas Taqman HBV Kết định lợng hai ... quantitative measurement methods Approved guideline 2nd ed CSLI document EP5 -A2 Clinical and Laboratory Standards Institute, Wayne, PA Burd EM 2010 Validation of laboratory-developed molecular assays ... NanoQuant real-time HBV showed a good correlation with those determined with the Cobas AmpliPrep/Cobas Taqman HBV assay (R2 = 0.94) In conclusion, the evaluation results indicated that NanoQuant...
... 250mg Chandigarh-India 500mg 13 AZibey Viên nén 500mg Kolkata- India 1.1.12.Một số phƣơng pháp định lƣợng AZTR chế phẩm Kỹthuậtđịnh lƣợng HPLC.[3], [6] Bảng 2.Một số kỹthuậtđịnhlượng Azithromycin ... nén bao phim 500mg Mekophar Tenamyd Canada Medpro- Viên nén 500mg Cipla Medpro Bột pha tiêm 500mg Cipla Medpro Azithromycin 10 CiplaAzithromycin 11 Azimon Viên nén 500mg Monicopharma 12 Azicern ... Viên nang 250mg Ampharco Azithromycin Viên nang 250mg Traphaco Azithral Viên nén phân tán 250mg, Alembic Bột pha truyền tĩnh 500mg mạch Azibiotic Viên nang 250mg Viên nén bao phim Aziphar 500mg...
... Horovitzia Vasconella) Carica papaya L Hình 2.1 Cây đu đủ (Carica papaya L.) loài thuộc giống Carica (http://www.ogtr.gov.au/pdf/ir/papaya.pdf) Carica papaya L đƣợc biết đến với tên nhƣ paw paw, papaw ... Carica thuộc giống Vasconella (Badillo, 2002) Do đó, phân loại họ Caricaceae đƣợc s a lại, họ Caricaceae gồm giống Cylicomorpha giống Nam Mỹ Trung Mỹ ( Carica, Jacaratia, Jarilla, Horovitzia ... polymerase chain reaction PSDM: papaya sex determination marker RAPD: random amplified polymorphic DNA SCAR: sequence characterized amplified region Ta: annealing temperature TAE: Tris Acetic EDTA...
... spectral analysis Adaptive codebook search Speech Stochastic codebook search ACB-gain ACB-index Spectral parameters Linear prediction filter SCB-gain SCB-index Stochastic excitation + Delay Quá trình ... u ti ng nói d đốn D đốn sau (backward prediction) d đốn b ng cách d a vào m u ph a sau Cơng th c sau d ñoán sau c a m t m u t m u nh n đư c sau đó: t t ph n sau c a frame b m t x ∧ N trư c x f ... weighting Fixed codebook search b l c LPC 10 Thông thư ng, 10 thông s b l c d đốn n tính 2.5 + Adaptive excitation 10110 Gain Fixed codebook search Gain parameters Gp Pitch delay Adaptive codebook LSP...
... human plasma”, Journal of Chromatography, 491 page 468- 472 23 20.Wirasto, Skrisi (2008) “Analisis Rhodamine B dan metanil yellow danam minuman jajana anak sd di kecamatan laweyan kotamadya surakarta ... kotamadya surakarta dengan metade kromatography lapis tipis” Fakultas Farmasi, Muhammaadiyah surakarta, Indonesia, pp 2-17 21 http://en.wikipedia.org/wiki/Rhodamine_B (7/2011) 22 http://vietbao.vn/Suc-khoe/Phat-hien-chat-doc-Rhodamine-B-trong-giavi/70077015/248/ ... Rhodamine B, OSHA analytical Laboratory- Salt Lake city- Utah 13.Geertruida Sihombing (2001), “An Exploratory Study on three Synthetic Colouring Matters Commonly Used as Food colours in Jakarta”,...
... spectral analysis Adaptive codebook search Speech Stochastic codebook search ACB-gain ACB-index Spectral parameters Linear prediction filter SCB-gain SCB-index Stochastic excitation + Delay Quá trình ... u ti ng nói d đốn D đốn sau (backward prediction) d đốn b ng cách d a vào m u ph a sau Cơng th c sau d ñoán sau c a m t m u t m u nh n đư c sau đó: t t ph n sau c a frame b m t x ∧ N trư c x f ... weighting Fixed codebook search b l c LPC 10 Thông thư ng, 10 thông s b l c d đốn n tính 2.5 + Adaptive excitation 10110 Gain Fixed codebook search Gain parameters Gp Pitch delay Adaptive codebook LSP...
... Monitoring) Trang 1.4 Quy trình định tính địnhlượng β- agonists (salbutamol clenbuterol) Hầu hết phương pháp phân tích sắc ký dùng phát địnhlượng salbutamol clenbuterol trãi qua ba giai đoạn sau • Chiết ... nuôi việc kiểm tra diện chúng thức ăn gia súc, gia cầm vào năm 2005-2008 phần lớn dừng lại mức độ định tính địnhlượng ELISA với độ xác ch a cao Việc địnhlượng xác dư lượng β-agonist thức ăn ... đạm (Nitrogen free extractives): 62,93%, Năng lượng trao đổi (Metabolizable Energy):3224kcal/Kg)* * Metabolizable Energy: tính theo Jansen, 1989 2.5.2 Phương pháp thí nghiệm a Bố trí thí nghiệm:...
... Somalia, Tanzania, Togo, Uganda, Zimbabwe Ở vùng tây bán cầu có quốc gia nhƣ: Argentina, Barbados, Bermuda, Bolivia, Brazil, Parana, Canada, British Columbia, Costa Rica, Cuba, Dominica, El Salvador, ... Salvador, Guatemala, Haiti, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico Ở nƣớc Mỹ, bệnh xuất bang nhƣ: California, Florida, Georgia, Hawaii, Illinois, Michigan, New York, Washington, ... Xanthomonas campestris pv armoraciae, Xanthomonas campestris pv campestris, Pseudomonas syringae pv maculicola Trong hai lồi vi khuẩn Xanthomonas campestris pv armoraciae, Xanthomonas campestris pv campestris...
... encephalitis among hospitalized pediatric and adult patients with acute encephalitis syndrome in Hanoi, Vietnam 1995 Am J Trop Med Hyg 58: 324 – 329 Martin D A. , Muth D A. , Brown T Johnson A J., Karabatsos ... Summary applying mac-elisa for etiological surveillance of Japanese encephalitis, west Nile and nam dinh viruses cause acute encephalitis syndrome, 2003 - 2004 During 2003 – 2004, in total 976 ... Hygiene and Epidemiology, Tay nguyen for screening viral etiologies which cause AES by MAC-ELISA with Japanese encephalitis (JE), West Nile and Nam dinh virus antigens The results showed that: - Examination...
... DNA thực theo bước mơ tả trước KAPLAN et al., MC Manus Bowles; Vargas et al Phương pháp chỉnh s a sau: Các mẫu ký sinh trùng đồng dung dịch phân giải (8% triton 100X, 0,25 M Sucroza, 50 mm EDTA, ... với RNAse 37 ° C 1h, sau kết t a lần thứ hai phenol cloroform ethanol Dịch huyền phù bảo quản -20°C L a chọn mồi Để tối ưu h a điều kiện PCR, ba mồi (5'-TCG TCG CATT -3 '(OSA09), 5'-AGC AGC AGGC ... band mẫu cho DNA gen ký sinh trùng (5ng) Nồng độ DNA xác định nhờ ultraviolet absorbance spectrophotometry bước sóng 260nm Lượng xạ tia tử ngoại hấp thu dung dịch DNA tỷ lệ thuận với lượng DNA...
... mơi trường thạch cao men, glucoza oxitetraxilin/gentamixin (5.3), tan chảy giữ 47oC nồi cách thuỷ (6.4) Thời gian từ kết thúc chuẩn bị mẫu thử đến thời điểm mơi trường rót sang đ a không 15 phút ... hai; d - hệ số pha loãng tương ứng với độ pha loãng thứ giữ lại (tức có nồng độ mẫu thử cao hơn) Làm tròn kết tính đến hai chữ số có ngh a Như vậy, chữ số sau nhỏ số đứng trước số khơng bị thay ... luỹ th a tương ứng 10 Thí dụ Số đếm trực tiếp nấm men nấm mốc cho kết sau (hai đ a Petri cho độ pha loãng ủ): - độ pha loãng thứ (10-2) : 83 khuẩn lạc 97 khuẩn lạc; - độ pha loãng thứ hai (10-3)...
... outbreak of bacterial leaf spot caused by Xanthomonas campestris on Canola in argentina Plant Disease 89: 683 – 684 Goncalves, E.R., and Rosato, Y.B., 2002 Phylogenetic analysis of Xanthomonas species ... cause z leaf spot of brassica as Xanthomonas campestris pv raphani and pathogenic and genetic coparison with related pathovars Phytopathology 96: 735 – 745 23 Youfu Zhao, Damicone, J.P., and Bender, ... bacterial leaf spot disease of several Brasssica varieties, Aust Plant Pathology Soc 5: 30 – 32 15 Pernezny, K., and Dickstein, E., 2003 An outbreak of bacterial leaf spot disease of cabbage in...
... Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’ Xan 322 5’ – GGT TCT TTT CAC CTT TCC CTC – 3’ (nguồn: Young Jin Park ctv, 2004) XCF 5’ – CGATTCGGCCATGAATGACT – 3’ XCR 5’ – CTGTTGATGGTGGTCTGCAA ... SX agar, SM agar, NSCAA, BSCAA Các môi trƣờng thƣờng dùng phân lập vi khuẩn Xanthomonas campestris pv Campestris đất hạt giống XCS MD – Tween Bảng 1.1 Sự phát triển số loài vi khuẩn XPSa + Xanthomonas ... Zhao ctv Goncalves, E.R., Rosato, Y.B (2002), nghiên cứu phát sinh lồi vi khuẩn Xanthomonas campestris dùng kỹthuật PCR sử dụng cặp primer Xan 1330 5’ – GTT CCC GGG CCT TGT ACA CAC – 3’ Xan...
... Somalia, Tanzania, Togo, Uganda, Zimbabwe Ở vùng tây bán cầu có quốc gia nhƣ: Argentina, Barbados, Bermuda, Bolivia, Brazil, Parana, Canada, British Columbia, Costa Rica, Cuba, Dominica, El Salvador, ... Salvador, Guatemala, Haiti, Honduras, Jamaica, Mexico, Nicaragua, Panama, Puerto Rico Ở nƣớc Mỹ, bệnh xuất bang nhƣ: California, Florida, Georgia, Hawaii, Illinois, Michigan, New York, Washington, ... Xanthomonas campestris pv armoraciae, Xanthomonas campestris pv campestris, Pseudomonas syringae pv maculicola Trong hai lồi vi khuẩn Xanthomonas campestris pv armoraciae, Xanthomonas campestris pv campestris...
... (P.mutocida) KMT1SP6 ATCCGCTATTTACCCAGTGG GCTGTAAACGAACTCGCCAC 460 bp A CAPA-FWD CAPA-REV TGCCAAAATCGCAGTCAG TTGCCATCATTGTCAGTG 1044 bp B CAPB-FWD CAPB-REV CATTTATCCAAGCTCCACC GCCCGAGAGTTTCAATCC 760 ... GCCCGAGAGTTTCAATCC 760 bp D CAPD-FWD CAPD-REV TTACAAAAGAAAGACTAGGAGCCC 657 bp CATCTACCCACTCAACCATATCAG 2.4 Phương pháp nghiên cứu 2.4.1 Xác định đặc tính sinh vật 2.4.1.1 Phương pháp nhuộm Gram Mục đích tiến ... e Vi e N y c CAPB-FWD: 5’ -CATTTATCCAAGCTCCACC- 3’ CAPB-REV: 5’ -GCCCGAGAGAGTTTCAATCC- 3’ Cả hai cặp mồi HSB CAPB dùng để xác định chủng thuộc serotype B 1.2.Vi khuẩn P multocida 1.2.1 Đặc điểm...