Xác định sự lưu hành của porcine parvovirus (ppv) ở lợn nuôi tại hà nội và vùng phụ cận

HỌC VIỆN NÔNG NGHIỆP VIỆT NAM ĐẶNG THỊ CẨM NHUNG XÁC ĐỊNH SỰ LƯU HÀNH CỦA PORCINE PARVOVIRUS (PPV) Ở LỢN NUÔI TẠI HÀ NỘI VÀ VÙNG PHỤ CẬN Ngành: Thú y Mã số: 60.64.01.01 Người hướng dẫn khoa học: TS Nguyễn Văn Giáp NHÀ XUẤT BẢN ĐẠI HỌC NÔNG NGHIỆP - 2017 LỜI CAM ĐOAN Tôi xin cam đoan cơng trình nghiên cứu riêng tơi, kết nghiên cứu trình bày luận văn trung thực, khách quan chưa dùng để bảo vệ lấy học vị Tôi xin cam đoan giúp đỡ cho việc thực luận văn cám ơn, thông tin trích dẫn luận văn rõ nguồn gốc Hà Nội, ngày tháng năm2017 Tác giả luận văn Đặng Thị Cẩm Nhung i LỜI CẢM ƠN Trong thời gian học tập, nghiên cứu hoàn thành luận văn, nhận hướng dẫn, bảo thầy cô giáo; giúp đỡ, động viên bạn bè, đồng nghiệp gia đình.Nhân dịp hồn thành luận văn, cho phép gửi lời cảm ơn TS Nguyễn Văn Giáp tạo điều kiện dành thời gian hướng dẫn thực đề tài nghiên cứu Tơi xin bày tỏ lịng biết ơn chân thành tới Ban Giám đốc, Ban Quản lý đào tạo, Bộ môn Vi sinh vật – Truyền nhiễm, Khoa Thú y tạo thuận lợi để hồn thành khóa học, thực đề tài hồn thiện luận văn Tôi xin chân thành cảm ơn gia đình, người thân, bạn bè, đồng nghiệp giúp đỡ, động viên tơi mặt để hồn thành tốt luận văn Hà Nội, ngày tháng năm2017 Tác giả luận văn Đặng Thị Cẩm Nhung ii MỤC LỤC Lời cam đoan i Lời cảm ơn ii Mục lục iii Danh mục chữ viết tắt .v Danh mục bảng vi Danh mục hình vii Trích yếu luận văn viii Thesis abtract x Phần Mở đầu 1.1 Đặt vấn đề .1 1.2 Ý nghĩa khoa học thực tiễn đề tài Phần Tổng quan tài liệu 2.1 Giới thiệu chung porcine parvovirus 2.1.1 Căn bệnh 2.1.2 Dịch tễ học 2.1.3 Triệu chứng 10 2.1.4 Bệnh tích 12 2.1.5 Chẩn đoán 15 2.1.6 Phản ứng huyết học để chẩn đoán PPV 17 2.1.7 Phòng chống bệnh 18 2.2 Tình hình nghiên cứu porcine parvovirus giới Việt Nam 21 2.2.1 Nghiên cứu giới 21 2.2.2 Nghiên cứu Việt Nam 22 Phần Vật liệu phương pháp nghiên cứu 23 3.1 Đối tượng nghiên cứu 23 3.2 Nội dung nghiên cứu 23 3.3 Địa điểm thời gian nghiên cứu 23 3.4 Vật liệu nghiên cứu 23 3.5 Phương pháp nghiên cứu 25 3.5.1 Thiết kế thí nghiệm 25 3.5.2 Phương pháp lấy mẫu máu lợn .25 iii 3.5.3 Phương pháp chế hồng cầu chuột lang 0,5% 25 3.5.4 Phương pháp thực phản ứng ngưng kết hồng cầu (HA) 26 3.5.5 Phương pháp chuẩn độ ngược 27 3.5.6 Phương pháp xử lý huyết xét nghiệm 27 3.5.7 Phản ứng ngăn trở ngưng kết hồng cầu (HI) 28 3.5.8 Phương pháp tách chiết ADN 29 3.5.9 Phương pháp PCR phát PPV 30 3.5.10 Phương pháp xây dựng phát sinh chủng loại 30 Phần Kết thảo luận 32 4.1 Kết chuẩn hóa phản ứng ngăn trở ngưng kết hồng cầu (HI) 32 4.1.1 Tối ưu nồng độ hồng cầu 32 4.1.2 Tối ưu thời gian tương tác huyết thanh- virus 33 4.1.3 Loại trừ yếu tố ngưng kết huyết xét nghiệm 33 4.2 Kết nghiên cứu lưu hành ppv phương pháp huyết học 35 4.2.1 Sự lưu hành kháng thể kháng PPV theo địa phương 36 4.2.2 Sự lưu hành kháng thể kháng PPV theo quy mô chăn nuôi 38 4.2.3 Đặc điểm nguồn gốc kháng thể kháng PPV lợn thịt 40 4.3 Kết nghiên cứu lưu hành ppv phương pháp PCR 43 4.3.1 Kết PCR phát PPV mẫu huyết 43 4.3.2 Kết phân nhóm PPV lưu hành giải trình tự gen 45 Phần Kết luận kiến nghị 48 5.1 Kết luận 48 5.2 Kiến nghị .48 Tài liệu tham khảo 49 iv DANH MỤC CÁC CHỮ VIẾT TẮT Chữ viết tắt Nghĩa tiếng Việt DNA Deoxyribonucleic acid ELISA Enzyme-Linked ImmunoSorbent Assay HA Haemagglutination HAU Hemagglutinating Unit HI Hemagglutinin Inhibition test IgG Immunoglobulin G IgM Immunoglobulin M PBS Phosphate buffer saline PCR Polymerase chain reaction PCV2 Porcine circovirus type PCVAD Porcine circovirus associated disease PMWS Postweaning multisystemic wasting syndrome PPV Porcine Parvovirus PRRS Porcine Reproductive and Respiratory Syndrome PRV Porcine pseudorabies virus RLSS Rối loạn sinh sản v DANH MỤC BẢNG Bảng 2.1 Hậu nhiễm porcine parvovirus giai đoạn mang thai Bảng 2.2 Hiệu giá kháng thể bệnh khô thai, sẩy thai truyền nhiễm 20 Bảng 2.3 Hiệu chủng ngừa liều vacxin “Suvaxyn Parvo” 21 Bảng 3.1 Trình tự mồi đặc hiệu phát PPV 30 Bảng 3.2 Chu trình nhiệt phản ứng PCR 30 Bảng 3.3 Trình tự gen NS1 dùng nghiên cứu 31 Bảng 4.1 Kết thu thập mẫu huyết địa phương 36 Bảng 4.2 Kết xét nghiệm kháng thể kháng PPV 37 Bảng 4.3 Tỷ lệ dương tính huyết học theo hiệu giá HI 38 Bảng 4.4 Kết PCR phát PPV huyết 45 vi DANH MỤC HÌNH Hình 2.1 Tế bào bị gây nhiễm PPV Hình 2.2 Mơi trường tế bào thận bào thai lợn sơ cấp gây nhiễm PPV Hình 2.3 Lát cắt mơ lợn tuần tuổi bị nhiễm PPV kiểm tra KHV huỳnh quang 10 Hình 2.4 Triệu chứng thai chết tùy thuộc vào giai đoạn sảy thai 11 Hình 2.5 Phôi lợn nái gây nhiễm virus thực nghiệm qua đường mũi miệng sau chửa bị giết sau 22 ngày 13 Hình 2.6 Lát cắt tử cung cho thấy tượng hoại tử phôi bị nhiễm PPV 13 Hình 2.7 Thai lợn bị nhiễm PPV 14 Hình 2.8 Mô bào thai lợn bị nhiễm PPV thu từ lợn nái gây bệnh thực nghiệm qua đường mũi miệng 15 Hình 2.9 Lát cắt phổi thai bị nhiễm PPV kiểm tra phản ứng miễn dịch huỳnh quang (Mengeling, 1978) 16 Hình 3.1 Phương pháp lấy máu vịnh tĩnh mạch cổ chuột lang 25 Hình 4.1 Kết xác định nồng độ hồng cầu tối ưu 32 Hình 4.2 Ảnh hưởng thời gian tương tác virus- huyết 33 Hình 4.3 Hiện tượng ngưng kết hồng cầu huyết xét nghiệm 34 Hình 4.4 Kết loại bỏ tượng ngưng kết hồng cầu huyết 35 Hình 4.5 Kết phản ứng HI phát kháng thể kháng PPV 36 Bảng 4.2 Kết xét nghiệm kháng thể kháng PPV 37 Bảng 4.3 Tỷ lệ dương tính huyết học theo hiệu giá HI 38 Hình 4.6 Kết HI phát kháng thể kháng PPV 39 Hình 4.7 Kết kiểm định sai khác tỷ lệ dương tính huyết học quy mô chăn nuôi 39 Hình 4.8 So sánh tỷ lệ dương tính huyết học nhóm lợn 41 Hình 4.9 Kết kiểm định sai khác hiệu giá HI nhóm lợn 42 Hình 4.10 Biến động hiệu giá HI thời điểm tuần tuổi 42 Hình 4.11 Minh họa kết phản ứng PCR phát PPV 44 Hình 4.12 Trình tự nucleotide gen mã hóa protein NS1 46 Hình 4.13 Cây phát sinh chủng loại PPV .47 vii TRÍCH YẾU LUẬN VĂN Tên tác giả: Đặng Thị Cẩm Nhung Tên luận văn: “Xác định lưu hành Porcine Parvovirus (PPV) lợn nuôi Hà Nội vùng phụ cận” Ngành: Thú y Mã số: 60.64.01.01 Tên sở đào tạo: Học viện Nông nghiệp Việt Nam Mục đích nghiên cứu: - Xác định lưu hành virus kháng thể kháng porcine parvovirus (PPV) lợn nuôi Hà Nội vùng phụ cận Phương pháp: * Phương pháp lấy mẫu máu lợn Mẫu máu lấy vịnh tĩnh mạch cổ lợn (2- 3ml/cá thể), sau để đơng tự nhiên syringe Mẫu huyết bảo quản -20oC xét nghiệm * Phương pháp thực phản ứng ngưng kết hồng cầu (HA) Kháng nguyên chuẩn porcine parvovirus (PPV) tiến hành phương pháp ELISA * Phương pháp tách ADN tổng số Tách chiết ADN tổng số từ mẫu bệnh phẩm lợn nhiễm bệnh * Phương pháp PCR phát PPV Sử dụng cặp mồi đặc hiệu PPVF/PPVR dùng phát PPV Mối quan hệ di truyền PPV xây dựng dựa phần trình tự gen mã hóa protein NS1, sử dụng phần mềm MEGA6 Kết kết luận: (1) Về lưu hành huyết kháng PPV: - Có 94,51% (155/164) số mẫu dương tính với kháng thể PPV - Những đàn lợn có quy mơ lớn tỷ lệ dương tính cao (P1000 tỷ lệ lưu hành kháng thể kháng PPV huyết cao - Tỷ lệ kháng thể PPV dương tính thấp lợn thịt (88,24%); thấp rõ rệt so với hai lứa tuổi lợn theo mẹ lợn nái (P ” Kết hình 4.11 cho biết, mẫu số 5, xuất vạch đặc hiệu với kích thước 265 bp Mẫu số xuất số vạch PCR có kích thước khơng đặchiệu đánh giá âm tính Như vậy, phản ứng PCR, xác định có mặt PPV mẫu huyết Tổng hợp kết xét nghiệm trình bày bảng 4.4 Kết tổng hợp bảng 4.4 cho biết 18 mẫu huyết xét nghiệm, có 10/18 mẫu dương tính với PPV có 8/18 mẫu âm tính với PPV Bằng phân tích phương sai (ANOVA) chúng tơi nhận xét hàm lượng kháng thể nhóm lợn có virus huyết (PCR dương tính) nhóm lợn khơng có virus huyết (PCR âm tính) khơng có khác biệt (giá trị F lý thuyết = 1,59< F thực nghiệm mức p= 0,22 > 0,05) 44 Bảng 4.4 Kết PCR phát PPV huyết TT Ký hiệu Hiệu giá HI (1/x) PCR Ký hiệu trình tự gen NS1 VP2-12 /512 + P1 VP2-13 /64 + P2 VP2-15 /8 + P3 BN2-17 /64 + P4 BN2-18 /4 + P5 BN11-45 /128 + P6 HY12-41 /16 + P7 HY12-42 /32 - HY12-45 /256 + 10 HB14-0403 /128 - 11 HB15-0401 /16 - 12 HB15-0405 /8 - 13 HN15-42 /16 - 14 HN18-0401 /32 - 15 HN18-0406 /512 - 16 HD18-45 /32 - 17 HD2-15 /16 + P9 18 HD2-195 /8 + P11 P8 Bên cạnh kết xác định lưu hành PPV phản ứng huyết học, kết PCR khẳng định có lưu hành virus nhóm lợn lấy mẫu nghiên cứu Kết nghiên cứu thu chúng tơi hồn tồn phù hợp với kết luận Streck cộng (Streck, 2011) cho biết PPV lưu hành lợn ni nhiều phương thức chăn nuôi khác không phụ thuộc vào hàm lượng kháng thể dịch thể đặc hiệu 4.3.2 Kết phân nhóm PPV lưu hành giải trình tự gen Để làm rõ đặc điểm chủng PPV nhóm mẫu xét nghiệm,chúng tơi tiến hành giải trình tự phân đoạn gen NS1 10 chủng PPV (đã trình bày bảng 4.4) Kết hình 4.12 cho thấy 10 chủng PPV thực địa Việt Nam có trình tự phân đoạn gen NS1 thay đổi, với mức tương đồng cao từ 99,7% đến 100% So với chủng tham chiếu mức tương đồng trình tự gen 96,5% đến 99,6% 45 1470 1480 1490 1500 1510 1520 1530 1540 1550 1560 1570 | | | | | | | | | | | | | | | | | | | | | | AY502114_SD-68 D00623_POVG M32787_POVCAP M38367_POVNADL-2 U44978_Kresse NC_001718_NADL-2 AY390557_VRI-1 AY739664_Nanjin-1 AY789532_NJ-2 AY789533_HN-Z1 AY789534_HN-Z3 AY684869_Tornau AY684871_27a AY684872_IDT AY686601_NJ DQ675456_SR1 EU790641_BQ EU790642_ZJ P1 P2 P3 P4 P5 P6 P7 P8 P9 P11 GTTAGAATAGGATGCGAGGAAAGACCAGAACATACACAACCAATAAGAGACAGAATGTTAAACATAAACCTAACCAGAAAACTGCCAGGTGATTTTGGACTTTTAGAAGA T .C A A C A A .G 1580 1590 1600 1610 1620 1630 1640 1650 1660 1670 1680 | | | | | | | | | | | | | | | | | | | | | | AY502114_SD-68 D00623_POVG M32787_POVCAP M38367_POVNADL-2 U44978_Kresse NC_001718_NADL-2 AY390557_VRI-1 AY739664_Nanjin-1 AY789532_NJ-2 AY789533_HN-Z1 AY789534_HN-Z3 AY684869_Tornau AY684871_27a AY684872_IDT AY686601_NJ DQ675456_SR1 EU790641_BQ EU790642_ZJ P1 P2 P3 P4 P5 P6 P7 P8 P9 P11 AACTGAATGGCCACTAATATGTGCTTGGTTGGTAAAGAAAGGTTACCAAGCAACAATGGCTAGCTATATGCATCATTGGGGAAATGTACCTGATTGGTCCGAAAAATGGG A .A .A .A A A .A T .A G T .A T .A T .A C A .A G T .A .A .A .A .A .A .A .A .A .A .A .A .A .A Hình 4.12 Trình tự nucleotide gen mã hóa protein NS1 Dấu “.” biểu thị vị trí có nucleotide giống với chủng tham chiếu SD-68 P1-P11 trình tự gen chủng PPV Việt Nam thu nghiên cứu Như vậy, kết PCR kết giải trình tự khẳng định lưu hành PPV đàn lợn nuôi địa phương lấy mẫu Mối quan hệ di truyền chủng PPV thực địa xác định phương pháp phân tích phát sinh chủng loại Kết phân tích phát sinh chủng loại (hình 4.13) xác định 10 chủng PPV giải trình tự nghiên cứu thuộc nhóm 1, bao gồm chủng châu Mỹ (American strain, ví dụ: NADL-2, POVG, Kresse), chủng Trung Quốc (Chinese strain, ví dụ: SR-1, BQ, NJ) chủng Hàn Quốc (Korean strain, VRI-1) Đặc điểm phân loại dựa vào trình tự gen NS1 thu nghiên cứu chúng tơi hồn tồn phù hợp với cách phân loại tương tự cơng bố (Hao, 2011) 46 Hình 4.13 Cây phát sinh chủng loại PPV 47 PHẦN KẾT LUẬN VÀ KIẾN NGHỊ 5.1 KẾT LUẬN Từ kết trình bày chúng tơi rút số kết luận sau: Sự lưu hành huyết học PPV phổ biến lợn thịt với tỷ lệ trung bình 86,76% Trong tỷ lệ dương tính đàn có quy mô ≤ 100 cao rõ rệt so với đàn có quy mơ > 100 Đã xác định lưu hành virus phản ứng PCR, tượng virus huyết khơng phụ thuộc vào hàm lượng kháng thể kháng PPV 10 chủng PPV giải trình tự gen nghiên cứu xếp vào nhóm 1, gồm chủng châu Mỹ, chủng Trung Quốc chủng Hàn Quốc 5.2 KIẾN NGHỊ PPV xác định nhiều yếu tố kết hợp quan trọng chế sinh bệnh PCV2 Kết nghiên cứu lưu hành phổ biến PPV lợn thịt Do đó, cần nghiên cứu sâu để làm rõ vai trò PPV hội chứng bệnh PCV2 gây Các kết nghiên cứu góp phần điều chỉnh lịch vacxin phòng bệnh PPV lợn 48 TÀI LIỆU THAM KHẢO Tiếng Việt: Hồ Đình Chúc(1993) Kết điều tra phân lập virus từ lợn bị rối loạn sinh sản số tỉnh phía Bắc Báo cáo khoa học Hội nghị Chăn nuôi – Thú y toàn quốc Tháng 6, năm 1993 Hồ Đình Chúc, N., Thị Phương Đơng, Trần Duy Khanh (1995) Tình hình hội chứng loạn sinh sản lợn nái Thái Bình Tạp chí Thú y, tr 1-4 Trần Duy Khanh (2004) Hội chứng rối loạn sinh sản lợn Thái Bình vai trò porcine parvovirus Luận án Tiến sĩ, Viện Thú Y: 143 tr Tiếng Anh: Awad, A M., M Okela and B A Mohamed, 2012: Factors affecting hemagglutination activity of avian influenza virus subtype H5N1 Alexandria Journal of Veterinary Sciences, 35, 123-130 Bachmann, P A., 1969: Vorkommen und Verbreitung von Picodna (Parvo)—Virus beimSchwein Zentralbl Veterinarmed B., 16 (4), 341–345 Bachmann, P A., 1972: Porcine Parvovirus Infection In Vitro: A Study Model for the Replication of Parvoviruses I Replication at Different Temperatures Proceedings of the Society for Experimental Biology and Medicine, pp 1369-1374 Bachmann, P A., Hoggan, M D., Kurstak, E., Melnick, J L., Pereira, H G., Tattersall, P., and Vago, C., 1979: Parvoviridae: second report Intervirology, 11(4), 248-254 Berns, K I., 1984: The Parvoviruses.New York: Plenum Press Brown, J T T., 1981: Laboratory evaluation of selected disinfectants as virucidal agents against porcine parvovirus, pseudorabies virus, and transmissible gastroenteritis virus American journal of veterinary research, 42(6), 1033-1036 10 Brown, J T T., Paul, P S., and Mengeling, W L., 1980: Response of conventionally raised weanling pigs to experimental infection with a virulent strain of porcine parvovirus American journal of veterinary research, 41(8), 1221-1224 11 Cartwright, S F., 1970: Tests available for the detection of some virus infections of pigs and their interpretation Vet Annu., 11, 77–82 12 Cartwright, S F., Lucas, M., and Huck, R A., 1969: A small haemagglutinating porcine DNA virus: I Isolation and properties Journal of comparative pathology, 79(3), 371IN25377-25376IN25326 49 13 Chaniago, T D., Watson, D L., Owen, R A., and Johnson, R H., 1978: Immunoglobulins in blood serum of foetal pigs Australian veterinary journal, 54(1), 30-33 14 Coackley W and & Smith V W., 1972: Porcine parvoviruses in Western Australia Australian veterinary journal, 48(9), 536-536 15 Cotmore, S F., Sturzenbecker, L J., and Tattersall, P., 1983: The autonomous parvovirus MVM encodes two nonstructural proteins in addition to its capsid polypeptides Virology, 129(2), 333-343 16 Cropper, M., Dunne, H W., Leman, A D., Starkey, A L., and Hoefling, D C., 1976: Prevalence of antibodies to porcine enteroviruses and procine parvovirus in body fluids of fetal pigs from small vs large litters Journal of the American Veterinary Medical Association, 168(3), 233–235 17 Cutlip R C and Mengeling W L., 1976: Experimentally induced infection of neonatal swine with porcine parvovirus American journal of veterinary research, 36(8), 1179–1182 18 Darbyshire J H and Roberts D H., 1968: Some respiratory virus and mycoplasma infections of animals J Clin Pathol., 21(Suppl 2, 61–92 19 Dea, S., Elazhary, M A., Martineau, G P., and Vaillancourt, J., 1985: Parvoviruslike particles associated with diarrhea in unweaned piglets Canadian Journal of Comparative Medicine, 49(3), 343-345 20 Dias, A S., Gerber, P F., Araujo, A S., Auler, P A., Gallinari, G C., and Lobato, Z I P., 2013: Lack of antibody protection against Porcine circovirus and Porcine parvovirus in naturally infected dams and their offspring Research in veterinary science, 94(2), 341-345 21 Ellis, J A., A Bratanich, E G Clark, G Allan, B Meehan, D M Haines, J Harding, K H West, S Krakowka, C Konoby, L Hassard, K Martin and F McNeilly, 2000: Coinfection by porcine circoviruses and porcine parvovirus in pigs with naturally acquired postweaning multisystemic wasting syndrome J Vet Diagn Invest, 12, 21-27 22 Forman, A., Lenghaus, C., Hogg, G., and Hale, C., 1977: Association of a parvovirus with an outbreak of foetal death and mummification in pigs Australian veterinary journal, 53(7), 326-329 50 23 Fujisaki, Y., Morimoto, T., Sugimori, T., and Suziki, H., 1975: Experimental infection of pigs with porcine parvovirus Natl Inst Anim Health Q (Tokyo), 22, 205–206 24 Hallauer, C., Siegl, G., and Kronauer, G., 1972: Parvoviruses as contaminants of permanent human cell lines III Biological properties of the isolated viruses Archives of Virology, 38(4), 366-382 25 Hao, X., Lu, Z., Sun, P., Fu, Y., Cao, Y., Li, P., and Li, D., 2011: Phylogenetic analysis of porcine parvoviruses from swine samples in China 8(1), 8(1), 320 26 Hogg, G G., Lenghaus, C., and Forman, A J., 1977: Experimental porcine parvovirus infection of foetal pigs resulting in abortion, histological lesions and antibody formation Journal of comparative pathology, 87(4), 539-549 27 Hohdatsu, T., Baba, K., Ide, S., Tsuchimoto, M., Nagano, H., Yamagami, T., Yamagishi, H., Fujisaki, Y., and Matumoto, M T., 1988: Detection of antibodies against porcine parvovirus in swine sera by enzyme-linked immunosorbent assay Vet Microbiol., 17(1), 11-19 28 Johnson R H and Collings D F., 1969: Experimental infection of piglets and pregnant gilts with a parvovirus Veterinary Record, 85(16), 446-447 29 Johnson, R H., 1973: Isolation of swine parvovirus in Queensland Australian veterinary journal, 49(3), 157-159 30 Johnson, R H., Donaldson‐Wood, C., Jod, H., and Allender, U., 1976: Observations on the epidemiology of porcine parvovirus Australian veterinary journal, 52(2), 80-84 31 Joo, H S., Donaldson-Wood, C R., and Johnson, R H., 1977: Observations on the pathogenesis of porcine parvovirus infection Archives of Virology, 51(1), 123-129 32 Kawamura, H., Fujita, T., Imada, T., Hitoshi, F., T., and Imada, T., 1988: Plaque formation and replication of porcine parvovirus in embryonic swine kidney cell line, ESK cells Jpn J Vet Sci., 50(3), 803–808 33 Kim, Y H., 1974: Studies on hemagglutination and hemagglutination- inhibition reaction of porcine parvovirus Bull AZABU Vet Coll., 27, 61–65 34 Krakowka, S., Ellis, J A., Meehan, B., Kennedy, S., McNeilly, F., and Allan, G., 2000: Viral wasting syndrome of swine: experimental reproduction of postweaning multisystemic wasting syndrome in gnotobiotic swine by coinfection with porcine circovirus and porcine parvovirus Veterinary Pathology, 37(3), 254-263 51 35 Kresse, J I., Taylor, W D., Stewart, W W., and Eernisse, K A., 1985: Parvovirus infection in pigs with necrotic and vesicle-like lesions Veterinary microbiology,, 10(6), 525-531 36 Lenghaus, C., Forman, A J., and Hale, C J., 1978: Experimental infection of 35, 50 and 60 day old pig foetuses with porcine parvovirus Australian veterinary journal, 54(9), 418-422 37 Lucas M H and Napthine P., 1971: Fluorescent antibody technique in the study of three porcine viruses: Transmissible gastroenteritis virus, vomiting and wasting disease virus and the parvovirus 59e/63 Journal of comparative pathology, 81(1), 111-117 38 Marrable A W and Ashdown R R, 1967: Quantitative observations on pig embryos of known ages J Agric Sci., 69(3), 443–447 39 Mayr, A., Bachmann, P A., Siegl, G., Mahnel, H., and Sheffy, B E., 1968: Characterization of a small porcine DNA virus Archives of Virology, 25(1), 38-51 40 McAdaragh J P and Anderson G A., 1975: Transmission of viruses through boar semen In: Proc 18th Annu Meet Am Assoc Vet Lab Diagn, pp 69-76 41 Mengeling W L and Cutlip R C., 1975b: Pathogenesis of in utero infection: experimental infection of five-week-old porcine fetuses with porcine parvovirus American journal of veterinary research, 36(08), 1173-1177 42 Mengeling W L and Cutlip R C., 1976: Reproductive disease experimentally induced by exposing pregnant gilts to porcine parvovirus American journal of veterinary research, 37(12), 1393-1400 43 Mengeling, W L., 1972: Porcine parvovirus: Properties and prevalence of a strain isolated in the United States American journal of veterinary research, 33(11), 2239–2248 44 Mengeling, W L., 1975a: Porcine parvovirus: frequency of naturally occurring transplacental infection and viral contamination of fetal porcine kidney cell cultures American journal of veterinary research, 36(1), 41-44 45 Mengeling, W L., 1978: Elimination of porcine parvovirus from infected cell cultures by inclusion of homologous antiserum in the nutrient medium American journal of veterinary research, 39(2), 323-324 52 46 Mengeling, W L., Lager, K M., and Vorwald, A C., 2000: The effect of porcine parvovirus and porcine reproductive and respiratory syndrome virus on porcine reproductive performance Animal reproduction science, 60, 199-210 47 Mengeling, W L., Lager, K M., Zimmerman, J K., Samarikermani, N., and Beran, G W., 1991: A current assessment of the role of porcine parvovirus as a cause of fetal porcine death Journal of veterinary diagnostic investigation, 3(1), 33-35 48 Mengeling, W L., Paul, P S., and Brown, T T., 1980: Transplacental infection and embryonic death following maternal exposure to porcine parvovirus near the time of conception Archives of Virology, 65(1), 55-62 49 Mengeling, W L., Paul, P S., Bunn, T O., and Ridpath, J F., 1986: Antigenic relationships among autonomous parvoviruses Journal of general virology, 67(12), 2839-2844 50 Mengeling, W L., Ridpath, J F., and Vorwald, A C., 1988: Size and antigenic comparisons among the structural proteins of selected autonomous parvoviruses Journal of general virology, 69(4), 825-837 51 Molitor, T W., Joo, H S., and Collett, M S., 1983: Porcine parvovirus: virus purification and structural and antigenic properties of virion polypeptides Journal of virology, 45(2), 842-854 52 Molitor, T W., Oraveerakul, K., Zhang, Q Q., Choi, C S., and Ludemann, L R., 1991: Polymerase chain reaction (PCR) amplification for the detection of porcine parvovirus Journal of virological methods, 32(2-3), 201-211 53 Morimoto, T., Kurogi, H., Miura, Y., Sugimori, T., and Fujisaki, Y., 1972: Isolation of Japanese encephalitis virus and a hemagglutinating DNA virus from the brain of stillborn piglet Tokyo Nat Inst Anim Health Quart., 12, 127–136 54 Narita, M., Inui, S., Kawakami, Y., Kitamura, K., and Maeda, A., 1974: Histopathological changes of the brain in swine fetuses naturally infected with procine parvovirus National Institute of Animal Health Quarterly, 15(1), 24-28 55 Opriessnig, T., Fenaux, M., Yu, S., Evans, R B., Cavanaugh, D., Gallup, J M., and Halbur, P G., 2004: Effect of porcine parvovirus vaccination on the development of PMWS in segregated early weaned pigs coinfected with type porcine circovirus and porcine parvovirus Veterinary microbiology, 98(3), 209-220 53 56 Oravainen, J., M Heinonen, A Tast, J Virolainen and O Peltoniemi, 2005: High porcine parvovirus antibodies in sow herds: prevalence and associated factors Reprod Domest Anim, 40, 57-61 57 Parke C R and Burgess G W., 1993: An economic assessment of porcine parvovirus vaccination Australian veterinary journal, 70(5), 177-180 58 Paul P S and Mengeling W L., 1980: Evaluation of a modified live-virus vaccine for the prevention of porcine parvovirus-induced reproductive disease in swine American journal of veterinary research, 41(12), 2007-2011 59 Pini, A., 1975: Porcine parvovirus in pig herds in Southern Afric Journal of the South African Veterinary Association, 46(3), 241-244 60 Prikhod'ko, G G., Reyes, H., Vasilyeva, I., and Busby, T F., 2003: Establishment of a porcine parvovirus (PPV) DNA standard and evaluation of a new LightCycler nested-PCR assay for detection of PPV Journal of virological methods, 111(1), 13-19 61 Rasool, A., S Akhtar, K Muhammad, M Rabbani, A A Anjum, J Muhammad, A Ahmad, A A Sheikh, F Liaqat, F Akhtar and R Tahir, 2016: Comparative evaluation of factors affecting hemagglutinating activity of avian influenza (H9) virus Turk J Vet Anim Sci, 40, 102-106 62 Robinson, B T., Cartwright, S F., and Danson, D L., 1985: Porcine parvovirus: a serological survey in the United Kingdom January 1984 to January 1985 Veterinary Record, 117(23), 611-612 63 Rodeffer, H E., Leman, A D., Dunne, H W., Cropper, M., and Sprecher, D J., 1975: Reproductive failure in swine associated with maternal seroconversion for porcine parvovirus Journal of the American Veterinary Medical Association, 166(10), 991-992 64 Rondhuis P R and Straver P J., 1972: Enigekenmerken van eenklien, hemagglutinerend DNA-virus, geisoleeruiteenverworpenvarkensfoetus TijdschrDiergeneeskd, 97, 1257–1267 65 Ruckerbauer, G M., Dulac, G C., and Boulanger, P., 1978: Demonstration of parvovirus in Canadian swine and antigenic relationships with isolates from other countries Canadian Journal of Comparative Medicine, 42(3), 278-285 66 Siegl, G., 1976: The parvoviruses (Vol 15).Vienna New York: Springer 54 67 Soares, R M., Durigon, E L., Bersano, J G., and Richtzenhain, L J., 1999: Detection of porcine parvovirus DNA by the polymerase chain reaction assay using primers to the highly conserved nonstructural protein gene, NS-1 Journal of virological methods, 78(1), 191-198 68 Stojanac, N., M Gagrčin, O Stevančević, I Stančić and A Potkonjak, 2012: Passive and active immunity against parvovirus infection in piglets African Journal of Biotechnology, 11, 7771-7774 69 Streck, A., D Gava, C Souza, K Gonỗalves, F Bortolozzo, I Wentz and C Canal,, 2011: Presence of porcine parvovirus in sera from pigs is independent of antibody titers Berl Munch Tierarztl Wochenschr., 124, 242-246 70 Suzuki H and Fujisaki Y., 1976: Immunizing effects of inactivated porcine parvovirus vaccine on piglets Natl Inst Anim Health Q (Tokyo), 16, 81 71 Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S., 2013: MEGA6: molecular evolutionary genetics analysis version 6.0 Molecular biology and evolution, 30(12), 2725-2729 72 Tummaruk, P and R Tantilertcharoen, 2012: Seroprevalence of porcine reproductive and respiratory syndrome, Aujeszky's disease, and porcine parvovirus in replacement gilts in Thailand Trop Anim Health Prod, 44, 983-989 73 Van Leengoed, L A., Vos, J., Gruys, E., Rondhuis, P., and Brand, A., 1983: Clinical papers: Porcine Parvovirus infection: Review and diagnosis in a sow herd with reproductive failure Veterinary Quarterly, 5(3), 131-141 74 Vannier P and Tillon, J P., 1979: Diagnostic de certitude de l'infection parvovirus dans les troubles de la reproduction de l'espèce porcine Rec Med Vet., 155, 151–158 75 Waldvogel, A S., Broll, S., Rosskopf, M., Schwyzer, M., and Pospischil, A., 1995: Diagnosis of fetal infection with porcine parvovirus by in situ hybridization Veterinary microbiology, 47(3-4), 377-385 76 Westenbrink, F., Veldius, M A., and Brinkhof, J M A F., Veldhuis, M A., Brinkhof, J M., 1989: An enzyme-linked assay for detection of antibodies to porcine parvovirus J Virol Methods., 23(2), 169-178 77 Xu, X G., Chen, G D., Huang, Y., Ding, L., Li, Z C., Chang, C D., and Liu, H J., 2012: Development of multiplex PCR for simultaneous detection of six swine DNA and RNA viruses Journal of virological methods, 183(1), 69-74 55 78 Yasuhara, H., Matsui, O., Hirahara, T., Ohgtani, T., Tanaka, M L., Kodama, K., Nakai, M., Sasaki, N., H., Matsui, O., Hirahara, T., Ohgitani, T., Tanaka, M., Kodama, K., Nakai, M., Sasaki, N., 1989: Characterization of parvovirus isolated from diarrheic feces of a pig Jpn J Vet Sci., 51 (2), 337–344 56 ... vấn đề nêu trên, tiến hành nghiên cứu đề tài ? ?Xác định lưu hành Porcine Parvovirus (PPV) lợn nuôi Hà Nội vùng phụ cận? ?? nhằm: - Xác định lưu hành (huyết học virus) PPV đàn lợn nuôi khu vực nghiên... văn: ? ?Xác định lưu hành Porcine Parvovirus (PPV) lợn nuôi Hà Nội vùng phụ cận? ?? Ngành: Thú y Mã số: 60.64.01.01 Tên sở đào tạo: Học viện Nơng nghiệp Việt Nam Mục đích nghiên cứu: - Xác định lưu hành. .. khángPorcine parvovirus (PPV) mẫu huyết lợn nuôi Hà Nội vùng phụ cận - PPV có mẫu huyết lợn thu thập địa phương lấy mẫu 3.2 NỘI DUNG NGHIÊN CỨU Trong khuôn khổ đề tài, thực nội dung sau: - Xác định