PHÁT HIỆN VÀ GIẢI TRÌNH TỰ GEN S CỦA CORONAVIRUS GÂY BỆNH TIÊU CHẢY CẤP TRÊN HEO Ở MỘT SỐ TỈNH MIỀN ĐÔNG NAM BỘ

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH *** TRỊNH THỊ THANH HUYỀN PHÁT HIỆN VÀ GIẢI TRÌNH TỰ GEN S CỦA CORONAVIRUS GÂY BỆNH TIÊU CHẢY CẤP TRÊN HEO Ở MỘT SỐ TỈNH MIỀN ĐÔNG NAM BỘ LUẬN VĂN THẠC SĨ CÔNG NGHỆ SINH HỌC Thành phố Hồ Chí Minh Tháng 08/2011 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH *** TRỊNH THỊ THANH HUYỀN PHÁT HIỆN VÀ GIẢI TRÌNH TỰ GEN S CỦA CORONAVIRUS GÂY BỆNH TIÊU CHẢY CẤP TRÊN HEO Ở MỘT SỐ TỈNH MIỀN ĐƠNG NAM BỘ Chun nghành: Cơng nghệ sinh học Mã số : 60.42.80 LUẬN VĂN THẠC SĨ CÔNG NGHỆ SINH HỌC Hướng dẫn khoa học: TS NGUYỄN TẤT TỒN TS NGUYỄN ĐÌNH QT Thành phố Hồ chí minh Tháng 08/2011 PHÁT HIỆN VÀ GIẢI TRÌNH TỰ GEN S CỦA CORONAVIRUS GÂY BỆNH TIÊU CHẢY CẤP TRÊN HEO Ở MỘT SỐ TỈNH MIỀN ĐÔNG NAM BỘ TRỊNH THỊ THANH HUYỀN Hội đồng chấm luận văn: Chủ tịch: PGS TS TRẦN ĐÌNH TỪ Hội Thú y Việt Nsm Thư ký: TS TRẦN THỊ LỆ MINH Trường Đại học Nông Lâm TP HCM Phản biện 1: PGS TS TRẦN THỊ DÂN Hội Thú y Việt Nsm Phản biện 2: TS NGUYỄN THỊ DIỆU TRANG Trường Đại học Nông Lâm TP HCM Ủy viên: TS NGUYỄN TẤT TỒN Trường Đại học Nơng Lâm TP HCM ii LÝ LỊCH CÁ NHÂN Tôi tên Trịnh Thị Thanh Huyền; sinh ngày 27 tháng 03 năm 1985; thị xã Bỉm Sơn, tỉnh Thanh Hóa Tốt nghiệp PTTH Trường Trung học phổ thông Ngô Quyền, tỉnh Đồng Nai năm 2003 Tốt nghiệp Đại học ngành Công nghệ sinh học hệ quy Đại học Nơng Lâm, tỉnh Đồng Nai năm 2007 Q trình cơng tác (cơ quan cơng tác, chức vụ theo thời gian): từ 2008 đến – chuyên viên sở khoa học công nghệ Đồng Nai Các cơng trình cơng bố (nếu có): 1) Trịnh Thị Thanh Huyền, Lương Quý Phương, Nguyễn Ngọc Tuân, 2007 Phân biệt ba loại thịt heo bò cừu phương pháp multiplex PCR Tạp chí Cơng nghệ sinh học (3B): 1-6 Tháng 09 năm 2008 theo học Cao học ngành Công nghệ sinh học trường đại học Nông Lâm, Thủ Đức, thành phố Hồ Chí Minh Điạ liên lạc: 45D/ cư xá lắp máy 45-4, kp 5, p Trảng Dài, Biên Hòa, tỉnh Đồng Nai Điện thoại: 0917737270 Email (Fax): thanhhuyencnsh@yahoo.com iii LỜI CAM ĐOAN Tôi cam đoan công bố luận văn trung thực phần đề tài cấp Bộ TS Nguyễn Tất Toàn làm chủ nhiệm Những số liệu luận văn phép công bố với đồng ý chủ nhiệm đề tài (Ký tên ghi rõ họ tên HV) Trịnh Thị Thanh Huyền iv LỜI CẢM ƠN Em xin bày tỏ lòng biết ơn chân thành đến: TS Nguyễn Tất Toàn, Giảng viên khoa Chăn nuôi thú y, trường Đại học Nông Lâm TP Hồ Chí Minh TS Nguyễn Đình Qt, Giảng viên khoa Chăn nuôi thú y, trường Đại học Nông Lâm TP Hồ Chí Minh Đã tận tình hướng dẫn, ủng hộ giúp đỡ tơi thực hiện, hồn thành tốt luận án tốt nghiệp Xin chân thành cảm ơn: PGS TS Nguyễn Ngọc Tuân ThS Đỗ Tiến Duy nhiệt tình giúp đỡ, động viên tơi q trình học tập thực luận án Ban Giám Hiệu trường Đại học Nơng Lâm Tp Hồ Chí Minh, Ban Chủ Nhiệm Bộ môn Công nghệ Sinh học, tất quý thầy cô truyền đạt kiến thức quý báu cho suốt thời gian học trường Các thầy cô khoa chăn nuôi thú y cán bệnh viện thú y trường đại học Nơng Lâm thành phố Hồ Chí Minh giúp đỡ tạo điều kiện thuận lợi cho thực tốt luận án tốt nghiệp Ban giám đốc, thầy cô cán công chức Trung tâm Phân tích Thí nghiệm Hóa sinh trường Đại học Nơng Lâm, tạo điều kiện thuận lợi cho thực tập hoàn thành tốt luận án tốt nghiệp Tập thể bạn học viên lớp cao học Công nghệ sinh học khóa 2008 Trường Đại học Nơng Lâm TP HCM ln bên tơi lúc khó khăn, tơi chia sẻ vui buồn q trình học trình thực luận án Và đặc biệt xin thành kính ghi ơn Cha Mẹ sinh thành, dưỡng dục nên người, để ngày hơm Thành phố Hồ Chí Minh, tháng 08 năm 2011 Học viên: Trịnh Thị Thanh Huyền v TÓM TẮT Đề tài “Phát giải trình tự gen S Coronavirus gây bệnh tiêu chảy cấp heo số tỉnh miền Đông Nam Bộ” tiến hành tại Trung tâm Phân tích Thí nghiệm Hóa Sinh - trường Đại học Nơng Lâm TP Hồ Chí Minh bệnh viện Thú - Đại học Nông Lâm TP Hồ Chí Minh, thời gian thực từ tháng 10/2009 đến tháng 10/2010 Mục tiêu nghiên cứu xác định diện tác nhân gây bệnh tiêu chảy cấp heo miền Đông Nam Bộ Việt Nam so sánh khác biệt đoạn gen giải trình tự chủng Corronavirus heo Việt Nam giới Kết đạt được: Thu thập 193 mẫu bệnh phẩm (gồm 57 mẫu phân 136 mẫu ruột) từ heo bị tiêu chảy cấp nghi Coronavirus tỉnh miền Đông Nam Bộ: Đồng Nai, Bình Dương, Bà Rịa -Vũng Tàu, TP.Hồ Chí Minh; ly trích RNA với quy trình kit SV Total RNA Isolation System thu độ tinh cao (tỷ số OD 260/280 1,8 mẫu phân 2,0 mẫu ruột); tối ưu quy trình nRT-PCR chẩn đốn PEDV với nhiệt độ bắt cặp 60oC 45 giây, nồng độ mồi 40pmol Qua chẩn đoán kỹ thuật nested-RT-PCR, phát 102 mẫu dương tính với PEDV chiếm tỷ lệ 52,85 % Trong có 91 mẫu ruột chiếm 66,91% 11 mẫu phân chiếm 19,3% Tỷ lệ nhiễm PEDV TP Hồ Chí Minh cao 88,89%, Bình Dương Bà Rịa -Vũng Tàu với tỷ lệ 72,41 % 36%, thấp Đồng Nai với tỷ lệ 28,24% Trong nghiên cứu này, không phát mẫu nhiễm TGEV quần thể heo khảo sát Chúng chọn 16 mẫu dương tính với PEDV địa phương khác để giải trình tự Sau so sánh kết thu phần mềm Bio Edit, Lasergene Mega Alignment 4.1, mẫu phân lập tỉnh có độ tương đồng với 97,2 -100% với chủng tham chiếu giới 94,3 -100% Dựa vào phân tích sinh dòng, chủng phân lập miền Đông Nam Bộ Việt Nam có di truyền gần với chủng Thái Lan vi ABSTRACT The thesis "Detection and sequencing of the partial S gene of Coronavirus caused acute diarrhea in pigs in some provinces of South Eastern region of Viet Nam" was performed during 12 months from 10/2009 to 10/2010 at Research Institute for Biotechnology and Environment of Nong Lam University, Vietnam The objectives were to identify the cause of acute diarrhea outbreaks in South Eastern region of Viet Nam and to compare the sequences of the partial S gene of isolated Corronavirus strains from Viet Nam with the others from gene bank The results: Total 193 samples were collected from piglets suffering acute diarrhea, including 57 fecal and 136 intestinal samples in suspected Coronavirus outbreaks in some provinces belonging to the South Eastern part of Viet Nam such as Dong Nai, Binh Duong, Ba Ria-Vung Tau and Ho Chi Minh city RNA from the samples were isolated with the protocol of commercial kit (the SV Total RNA Isolation System) which achieved the high purity with OD 260/280 at 1.8 and 2.0 for fecal samples and intestinal samples, respectively Nested-RT-PCR protocol was optimized and used in PEDV diagnosis, in which primers concentration of 40pmol and temperature of annealing at 600C/45 sec Based on nested-RT-PCR in PEDV diagnosis, 102 samples were with PEDV positive equivalently 52.85% included 91 positive intestinal samples accounted for 66.91% and 11 positive fecal samples (19.3%) The percentage of PEDV infection was highest in Ho Chi Minh city at 88.89%, and next to Binh Duong, Ba Ria-Vung Tau provinces at 72.41% and 36%, respectively The lowest positive rate was in Dong Nai at 28.24% Besides that, the study did not detect any sample infected by TGEV during these acute diarrhea outbreaks vii In addition, 16 positive samples were selected in different provinces to sequence of the partial S gene of PEDV By using Bio Edit, Laser gene and Mega Alignment 4.1 softwares for homologous comparing of nucleotide sequences amongst Vietnamese field isolates and reference ones listed in GeneBank (NCBI) The results revealed high identify among Vietnamese PEDV isolates at 97.2 -100% However, there was marked variation on identity sequences between these field isolates and reference isolates from 94.3 to 100% Moreover, based on the analysis of phylogenetic tree, the field PEDV isolates were closest to PEDV strains isolated from Thailand viii MỤC LỤC TRANG TRANG TỰA i TRANG CHUẨN Y ii LÝ LỊCH CÁ NHÂN iii LỜI CAM ĐOAN iv LỜI CẢM ƠN v LỜI CẢM ƠN v TÓM TẮT .vi ABSTRACT vii MỤC LỤC .ix DANH SÁCH CÁC BẢNG xiii DANH SÁCH CÁC HÌNH xiv DANH SÁCH CHỮ VIẾT TẮT xv Chương ĐẶT VẤN ĐỀ 1.1 Đặt vấn đề 1.2 Mục tiêu 1.3 Yêu cầu Chương TỔNG QUAN 2.1 Bệnh tiêu chảy cấp 2.1.1 Dịch tiêu chảy cấp heo (PED) 2.1.1.1 Lịch sử phát bệnh PED 2.1.1.2 Tác hại bệnh PED 2.1.1.3 Căn bệnh PEDV 2.1.1.4 Dịch tễ bệnh PED ix 20 Haelterman EO., 1962 Epidemiological studies of transmissible gastroenteritis of swine Proc US Livest Sanit Assoc 66:305-315 21 Harada K., Kaki T., Kumagai T., and Sasahara J., 1968 Studies on transmissible gastroenteritis in pigs IV Physicochemical and biological properities of TGE virus Natl Inst Anim Health Q (Tokyo), 8: 140-147 22 Hirsh D.C., Maclachlan N.T., and Walker R.L, 2004 Veterinary Microbiology Wiley-Blackwell 2: 387 23 Hofmann M., and Wyler R., 1988 Propagation of the virus of porcine epidemic diarrhea in cell culture Journal of Clinical Microbiology 26: 2235-2239 24 Horvath I., Mocsari E., 1981 Ultrastructural changes in the small intestinal epithelium of suckling pigs affected with a transmissible gastroenteritis (TGE) – like disease Arch Virol 68:103-113 25 Ishikawa K., Sekiguchi H., Ogino T., Suzuki S., 1997 Direct and rapid detection of porcine epidemic epidemic diarrhea diarrhea virus by RT-PCR Journal of Virological Methods 69: 191-195 26 Jones C T., Hunt R.D., King N.W., 1996 Veterinary pathology 694: 350 - 356 27 Jung K., and Chae C., 2004 Effect of temperature on the detection of porcine epidemic diarrhea virus and transmissible gastroenteritis virus in fecal samples by reverse transcription-polymerase chain reaction J Vet Diagn Invest 16: 237-239 28 Jung K., and Chae C., 2005 RT-PCR-base dot blot hybridization for the detection and differentiation between porcine epidemic diarrhea virus and transmissible gastroenteritis virus in fecal samples using a non-radioactive digoxigenein cDNA probe Journal of Virological Methods 123: 141-146 29 Jung K., Kim J., Kim O., Kim B., and Chae C., 2003 Differentiation between porcine epidemic diarrhea virus and transmissible gastroenteritis virus in formalinfixed paraffin-embedded tissues by multiplex nested-RT PCR and comparison with in situ hybridization Journal of Virological Methods 108: 41-47 66 30 Kim O., and Chae C., 2000 In situ hybridization for the detection and locolization of porcine epidemic diarrhea virus in the intestinal tissues from naturally infected piglets Veterinary Pathology 37: 62-67 31 Kim S.Y., Song D.S., and Park B.K., 2001 Differential detection of transmissible gastroenteritis virus and porcine epidemic diarrhea virus by duplex RT-PCR Journal Veterinary Diagnostics Invest 13: 516-520 32 Kocherhans R., Bridgene A., Ackermann M., and Tobler K., 2001 Completion of the Porcine epidemic diarrhea Coronavirus (PEDV) geneome sequence Virus Genes 23(2): 137-144 33 Krieg P A., 1996 A laboratory guide to RNA isolation, analysis and sythesis Call Wiley 34 Kubota S., Sasaki O., Amimoto K., Okada N., Kitazima T., and Yasuhara H., 1999 Detection of porcine epidemic diarrhea virus using polymerase chain reaction and comparison of the nucleocapsid protein genes among strains of the virus J Vet Med Sci 61: 827-830 35 Kweon C.H., Kwon B.J., and Jung T.S, 1993 Isolation of porcine epidemic diarrhea virus (PEDV) in Korea Korea J Vet Res 33: 249-254 36 Kwon H.M., Saif L.J., and Jackwood J., 1998 Field isolates of transmissible gastroenteritis virus differ at the molecular level from the miller purdue virulent and attenuated strains and from porcine respiratory Coronaviruses Journal Veterinary Medicine Sciences 60: 589-597 37 Lee H M., Lee B J, Tae J H., Kweon C H., Lee Y S., and Park J H., 1999 Detection of Porcine Epidemic Diarrhea Virus by Immonohistochemistry with Recombinant Antibody Produced in Phages J.Vet.Med Sci 62(3):333-337 38 Lee H.K., and Yeo S.G., 2003 Biological and physicochemical properties of porcine epidemic diarrhea virus chinju99 strain isolated in Korea J Vet Clin 2: 150-154 67 39 Lee H.M., Lee B.J., Tae J.H., Kweon C.H., Lee Y.S., and Park J.H., 2000 Detection of porcine epidemic diarrhea virus by immunohistochemistry with recombinant antibody produced in phages J Vet Med Sci 62: 333-337 40 Morilla A., Yoon K J., and Zimmerman J J., 2002 Trends in emerging viral infections of swine Iowa state press 387 : 321-327 41 Moya A., Holmes E.C., and González-Candelas F., 2004 The population genetics and evolutionary epidemiology of RNA viruses Nat Rev Microbiol 2(4): 279-289 42 Murphy F.A., Gibbs J., Horzinek M.C., and Studdert M.J., 1999 Veterinary virology Elsevier 3: 495-508 43 Oldham J., 1972 Pig farming Suppl 72—73 44 Pensaert M B., and Debouck P., 1978 A new Coronavirus-Like particle associated with diarrhea in swine Archives of Virology 58: 243-247 45 Pensaert M.B., Callebaut P., and DeBouck P., 1982 Porcine epidemic diarrhea (PED) caused by a corronavirus: Present knowledge Proc Congr Int Pig Vet Soc 7: 52 46 Pensaert MB, DeBouck P, and Reynolds DJ 1981 An immuno- electron microscopic and immunofluorescent study on the antigenic relationship between the coronavirus-like agent, CV 777, and several coronaviruses Arch Virol 68:45–52 47 Pensaert MB, Callebaut P, and Vergote J 1986 Isolation of aporcine respiratory, non-enteric coronavirus related to transmissible gastroenteritis Vet Q 8:257–261 48 Pensaert M.B., and Yeo S.G 2006 Porcine epidemic diarrhea In: Diseases of swine 9th ed (B.E Straw., J.J Zimmerman., S D’Allaire and D.J Taylor) Oxford: Wiley-Blackwell 367–372 49 Pospischil A., Hess R.G., and Bachmann P.A., 1981 Light microscopy and ultrahistology of intestinal changes in pigs infected with enzootic diarrhea virus (EVD): Comparison with transmissible gastroenteritis (TGE) virus and porcine Rotavirus infections Zentralbl Vet Med 28: 564-577 68 50 Pospischil A., Stuedli A., and Kiupel M., 2002 Update on porcine epidemic diarrhea J Swine Health Prod 10(2):81-85 51 Puranaveja S., Poolperm P., lertwatcharasarakul P., Kesdaengsakonwut S., Boonsoongnern A., Urairong K., Kepkovid R., Reankum K., and Thanawongnuwech R., 2009 Chinese-like strain of porcine epidemic diarrhea virus, Thailand Emerging Infectious Diseases 15: 1112-1115 52 Qinghua C., et al., 1992 Investigation on epidemic diarrhea in pigs in Qinghai region Qinghai Xumu Shaoyl Zazhi 22: 22-23 53 Saif L.J., Bohl E.H., Kohler E.M., and Hughes J.H (1977) Immune electron microscopy of transmissible gastroenteritis virus and Rotavirus (reovirus-like agenet) of swine Am J Vet Res., 38: 13–20 54 Segalés J., Ramos-Vara J.A., Duran C.O., Porter A., and Domingo M., 1999 Diagnosing infectious diseases using in situ hybridization Swine Health Prod 7: 125128 55 Shibata I., Ono M., and Mori M., 2001 Passive protection againt porcine epidemic diarhea (PED) virus in piglets by colostum from immunized cows J Vet Med Sci 63: 655-658 56 Shoup D.I., Swayne D.E., Jackwood D.J., and Saif L.J (1996) Immunohistochemistry of transmissible gastroenteritis virus antigenes in fixed paraffin-embedded tissues Journal Veterinary Diagnostic Invest 8: 161–167 57 Siddell S., Wege H., and Meulen V.T., 1983 The biology of Coronaviruses J Gene Virol 64: 761-776 58 Sirinarumitr T., Paul P.S., Kluge J.P., and Halbur P.G (1996) In situ hybridization technique for the detection of swine enteric and respiratory Coronaviruses, transmissible gastroenteritis virus (TGEV) and porcine respiratory Coronavirus (PRCV), in formalin-fixed paraffin-embedded tissues Journal Virological Methods 56: 149–160 69 59 Song D S., Kang B K., Oh J S., Ha G W., Yang J S., Moon H J., Jang Y.S., and Park B K., 2006 Multiplex reverse transcription-PCR for rapid differential detection of porcine epidemic diarrhea virus, transmissible gastroenteritis virus, and porcine group A Rotavirus Journal Veterinary Diagnostics Invest 18: 278-281 60 Song D S., Oh J S., Kang B K., Yang J S., Moon H J., Yoo H.S., Jang Y.S., and Park B K., 2003 Oral efficacy of vero cell attenuated porcine epidemic diarrhea virus DR13 strain Research in Veterinary Science 82: 134-140 61 Sueyoshi M., Tsuda T., Yamazaki K., Yoshida K., Nakazawa M., Sato K., Minami T., Iwashita K., Watanabe M., Suzuki Y., and Mori M., 1995 An immunohistochemical investigation of porcine epidemic diarrhea J Comp Pathol 113: 59-67 62 Takahashi K., Okada K., and Ohshima K., 1983 An outbreak of swine diarrhea of a new type associated with corronavirus-like particles in Japan Jpn J Vet Sci 45: 829-832 63 Tsuda T., 1997 Porcine epidemic diarrhea: Its diagnosis and control Proc Jpn J Vet Sci 45:829-832 64 Turgeon DC., Morin M., Jolette J, Higgins R., Marsolais G., and Difrarico E., 1980 Coronavirus-like particles associated with diarrhea in baby pigs in Quebec Can Vet J 21: 100-101 65 Van Nieuwstadt A.P., Cornelissen J.B., and Vreeswijk J., (1988) Solid phase immune electron microscopy for diagnosis of transmissible gastroenteritis in pigs Res Vet Sci 44: 286–294 66 Weber O., and Schmidt A., 2005 Coronavirus infections in medicine Birkhauser Verlag Base 55-69 67 Wesley R.D., Woods R.D., Hill H.T., and Biwer J.D., 1990 Evidence for a porcine respiratory Coronavirus antigenetically similar to transmissible gastroenteritis virus, in the United States J Vet Diagn Invest 2: 312-317 70 68 Wood E N., 1977 An apparently new syndrome of porcine epidemic diarrhea Vet Rec 100: 243-244 69 Woods RD, and Wesley RD., 1992 Seroconversion of pig in contact with dogs exposed to canine coronavirus Can J Vet Res., 56:78-80 70 Woods RD 1997 Development of PCR-based techniques to identify porcine transmissible gastroenteritis coronavirus isolates Can J Vet Res 61:167–172 71 Weber O., and Schmidt A., 2005 Coronavirus infection in veterinary medicine Birkausse verlag base/Switzerland 55-69 72 Young GA, Hinz RW., and Underdahl NR., 1955 Some characteristics of transmissible gastroenteritis in disease-free antibody-devoid pigs Am J Wet Res 16: 529-535 71 PHỤ LỤC Phụ lục 1: Kết giải trình tự gen S chủng PEDV phân lập Mẫu VNLd01 72 Mẫu VNLd02 73 Mẫu VNLd03 74 Mẫu VNLd04 Mẫu VNLd05 75 Mẫu VNLr06 76 Mẫu VNLb07 Mẫu VNLb08 77 Phụ lục 2: Thành phần nucleotide trình tự PEDV phân lập Trình tự VNLd01: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTACGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGGTTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLd02: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLd03: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTACGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGGTTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLd04: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTACGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGGTTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLd05: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTACGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGGTTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLr06: 78 TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLb07: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLb08: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA ACTCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLb09: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGAACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGACTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACGCTG Trình tự VNLb10: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLb11: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT 79 GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACGCTG Trình tự VNLh12: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLh13: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLh14: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLh15: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG Trình tự VNLh16: TTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTATGTGTCTA AATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCT GTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACC ATAGATCTTTTTGGTTACCCTG 80 ... Trường Đại học Nơng Lâm TP HCM ii LÝ LỊCH CÁ NHÂN Tôi tên Trịnh Thị Thanh Huyền; sinh ngày 27 tháng 03 năm 1985; thị xã Bỉm Sơn, tỉnh Thanh Hóa Tốt nghiệp PTTH Trường Trung học phổ thông Ngô Quyền,... lắp máy 45-4, kp 5, p Trảng Dài, Biên Hòa, tỉnh Đồng Nai Điện thoại: 0917737270 Email (Fax): thanhhuyencnsh@yahoo.com iii LỜI CAM ĐOAN Tôi cam đoan công bố luận văn trung thực phần đề tài cấp... heo với tỷ lệ tử vong cao, chưa có thuốc đặc trị (Phạm Sĩ Lăng Nguyễn Thi n, 2004) Bệnh tiêu chảy cấp heo loại bệnh gây nhiều thi t hại Nếu khơng có biện pháp ngăn ngừa triệt để dường theo mùa bệnh