XÁC ĐỊNH SỰ HIỆN DIỆN VÀ PHÁT HIỆN MỘT SỐ GEN ĐỘC LỰC CỦA VIBRIO PARAHAEMOLYTICUS, VIBRIO VULNIFICUS TRÊN TÔM, NHUYỄN THỂ BẰNG KỸ THUẬT PCR

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM TP HỒ CHÍ MINH ******************** NGUYỄN THỊ HỒNG KIỂN XÁC ĐỊNH SỰ HIỆN DIỆN VÀ PHÁT HIỆN MỘT SỐ GEN ĐỘC LỰC CỦA VIBRIO PARAHAEMOLYTICUS, VIBRIO VULNIFICUS TRÊN TÔM, NHUYỄN THỂ BẰNG KỸ THUẬT PCR Chuyên ngành: THÚ Y Mã số ngành: 60 62 50 LUẬN VĂN THẠC SỸ KHOA HỌC NƠNG NGHIỆP Thành phố Hồ Chí Minh - Tháng 12/2011 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NƠNG LÂM TP HỒ CHÍ MINH NGUYỄN THỊ HỒNG KIỂN XÁC ĐỊNH SỰ HIỆN DIỆN VÀ PHÁT HIỆN MỘT SỐ GEN ĐỘC LỰC CỦA VIBRIO PARAHAEMOLYTICUS, VIBRIO VULNIFICUS TRÊN TÔM, NHUYỄN THỂ BẰNG KỸ THUẬT PCR Chuyên ngành: THÚ Y Mã số ngành: 60 62 50 LUẬN VĂN THẠC SỸ KHOA HỌC NÔNG NGHIỆP Hướng dẫn khoa học PGS.TS.NGUYỄN NGỌC TUÂN Thành phố Hồ Chí Minh - Tháng 12/2011 XÁC ĐỊNH SỰ HIỆN DIỆN VÀ PHÁT HIỆN MỘT SỐ GEN ĐỘC LỰC CỦA VIBRIO PARAHAEMOLYTICUS, VIBRIO VULNIFICUS TRÊN TÔM, NHUYỄN THỂ BẰNG KỸ THUẬT PCR NGUYỄN THỊ HỒNG KIỂN Hội đồng chấm luận văn: Chủ tịch: TS PHẠM HÙNG VÂN Đại học Y Dược TP Hồ Chí Minh Thư ký: TS VÕ THỊ TRÀ AN Đại học Nơng Lâm TP Hồ Chí Minh Phản biện 1: TS HỒ THỊ KIM HOA Đại học Nông Lâm TP Hồ Chí Minh Phản biện 2: TS TRẦN THỊ BÍCH LIÊN Hội Thú y Ủy viên: TS TRẦN THỊ QUỲNH LAN Đại học Nơng Lâm TP Hồ Chí Minh i LÝ LỊCH CÁ NHÂN Họ tên: Nguyễn Thị Hồng Kiển Ngày sinh: 23/08/1974 Nơi sinh: Tiền Giang Họ tên Cha: Nguyễn Văn Hai Họ tên Mẹ: Nguyễn Thị Huỳnh Mai Quá trình học tập -Tháng 6/1993: Tốt nghiệp phổ thông trung học trường PTTH Đốc Binh Kiều, Cai Lậy, Tiền Giang -Tháng 8/1998: Tốt nghiệp Đại học ngành Chăn ni Thú y hệ quy trường Đại học Cần Thơ -Tháng 10/1998: làm việc Chi cục Thú y tỉnh Tiền Giang -Tháng 11/1999: đến làm việc Trạm Thú y thị xã Dĩ An, tỉnh Bình Dương -Tháng 10/2009: Học Cao học ngành Thú y Đại học Nơng Lâm Tp Hồ Chí Minh Địa liên lạc Số nhà 13/21 Kp Thắng Lợi 2, P Dĩ An, thị xã Dĩ An, tỉnh Bình Dương Email: kiennguyen74@gmail.com Điện thoại: 0909.209.903 ii LỜI CAM ĐOAN Tôi cam đoan công bố luận văn trung thực phần đề tài cấp mã số B2010 – 12 – 95 PGS TS Nguyễn Ngọc Tuân làm chủ nhiệm Những số liệu luận văn phép công bố với đồng ý chủ nhiệm đề tài XÁC NHẬN CỦA CHỦ NHIỆM ĐỀ TÀI Học viên Nguyễn Thị Hồng Kiển iii LỜI CẢM ƠN Xin chân thành cảm ơn Ban Giám Hiệu Trường Đại Học Nông Lâm Thành Phố Hồ Chí Minh, Ban Chủ Nhiệm Khoa Chăn Ni Thú Y, tất quý thầy cô truyền đạt kiến thức quý báu cho suốt thời gian học trường Con ghi nhớ biết ơn sâu sắc đến thầy Nguyễn Ngọc Tuân, người thầy tận tình dạy dỗ, động viên, hướng dẫn thực đề tài hoàn thành luận văn tốt nghiệp Trân trọng cảm ơn Phòng thực tập Kiểm nghiệm thú sản Môi trường sức khỏe vật nuôi, Khoa Chăn nuôi Thú y, Trường Đại học Nông Lâm TP Hồ Chí Minh; Cơng ty Cổ phần Cơng nghệ Việt Á, Bình Dương tạo điều kiện tốt tơi thực hồn thành đề tài Chân thành cảm ơn Ban lãnh đạo Chi cục Thú y Bình Dương, Chi Phòng Kinh tế, Trạm Thú y Dĩ An anh em đồng nghiệp tạo điều kiện, thông cảm chia sẻ cơng việc tơi theo học hồn thành luận văn tốt nghiệp Chân thành cám ơn anh chị lớp Cao học Thú y khóa 2009 tất bạn bè anh em phòng thực hành Kiểm nghiệm thú sản Môi trường sức khỏe vật nuôi, Công ty CPCN Việt Á nhiệt tình giúp đỡ tơi hồn thành tốt đợt thực đề tài Và khắc ghi công ơn trời biển Cha Mẹ sinh thành, dưỡng dục nên người cho có ngày hơm Cảm ơn chồng, Cô Mai thông cảm, chia sẻ, động viên để có niềm tin, nghị lực vượt qua khó khăn sống học tập Nguyễn Thị Hồng Kiển iv DANH SÁCH CÁC TỪ VIẾT TẮT ASPW Alkaline saline peptone water: nước muối peptone kiềm bp base pairs BLAST Basic Local Aligment Search Tool CDC Centers for Disease Control and Prevention: trung tâm kiểm sốt phòng bệnh CFU Colony Forming Unit FDA Food and Drug Administration ISO International Organization for Standardization ISSC Interstate Shellfish Sanitation Conference MPN Most Probable Number NCBI National Center For Biotechnology Information PCR Polymerase Chain Reaction TCBS Thiosulphate Citrate Bile Salt TDH Thermostable direct hemolysin: yếu tố gây dung huyết trực tiếp chịu nhiệt TLH Thermolabile direct hemolysin: yếu tố gây dung huyết chịu nhiệt TRH Thermostable - related direct hemolysin WHO World Health Organization: tổ chức sức khỏe giới v TÓM TẮT Xác định diện phát số gen độc lực Vibrio parahaemolyticus, Vibrio vulnificus tôm, nhuyễn thể kỹ thuật PCR Vibrio parahaemolyticus nguyên nhân gây viêm dày – ruột người liên quan đến vụ ngộ độc thức ăn thủy hải sản Vibrio vulnificus gây tổn thương mô mềm nhiễm trùng máu Mục tiêu đề tài phát diện V parahaemolyticus, V vulnificus tôm nhuyễn thể hai mảnh vỏ số gen độc lực chúng phương pháp PCR nuôi cấy truyền thống, so sánh hai phương pháp phát Đề tài thu thập xử lý 240 mẫu tôm, nhuyễn thể địa bàn tỉnh Đồng Nai TP Hồ Chí Minh Mẫu tăng sinh môi trường nước muối peptone kiềm, bổ sung polymycin B 50UI với hai nồng độ muối khác 3% (môi trường 1) 6% (môi trường 2) Các phản ứng PCR thực trực tiếp từ dung dịch tăng sinh để phát V parahaemolyticus, V vulnificus số gen độc lực chúng Ngoài gốc khuẩn lạc thu từ môi trường tăng sinh thử sinh hóa khẳng định lại m-PCR1 Một số gốc hai loài vi khuẩn thử tính đề kháng với số kháng sinh Phản ứng m-PCR1 trực tiếp từ DNA mẫu tăng sinh phát V parahaemolyticus môi trường 30,42% (73/240 mẫu) 27,92% (67/240 mẫu) môi trường Phương pháp sinh hóa phát V parahaemolyticus hai môi trường 24,58% (59/240 mẫu) 8,33% (20/240 mẫu) Tuy nhiên, gốc thử sinh hóa V parahaemolyticus m-PCR1 xác nhận 58/165 gốc (35,15%) môi trường Tương tự, m-PCR1 phát V vulnificus 26,67% (64/240 mẫu) môi trường 20,42% (49/240 mẫu) mơi trường Trong đó, phương pháp sinh hóa phát 16,25% (39/240 mẫu) 7,5% (13/240 mẫu) môi vi trường Đối với gốc thử sinh hóa V vulnificus m-PCR1 xác nhận 19/65 gốc (29,23%) môi trường Phản ứng m-PCR2 trực tiếp từ DNA dung dịch tăng sinh dương tính gốc xác nhận dương tính với m-PCR1 V parahaemolyticus tất mang gen tlh Phản ứng PCR3 trực tiếp từ DNA dung dịch tăng sinh dương tính gốc xác nhận dương tính với m-PCR1 gen vvp chiếm khoảng 30-40% Như vậy, môi trường tăng sinh có 3% NaCl thích hợp cho việc phát V parahaemolyticus V vulnificus số gen độc lực chúng Phương pháp PCR tầm soát hai lồi vi khuẩn nhanh, nhạy tốn chi phí phương pháp ni cấy truyền thống Các gốc V parahaemolyticus đề kháng hoàn toàn với amoxicillin, polymycin B, vancomycin (100%) nhạy cảm cao với chloramphenicol, gentamicin, ciprofloxacin (100%) tetracycline (88,89%) Các gốc V vulnificus đề kháng hoàn toàn với amoxicillin, polymycin B, erythromycin (100%) nhạy cảm cao với gentamicin, chloramphenicol, ciprofloxacin, tetracycline vancomycin (100%) vii SUMMARY Identification of the presence and detection of some virulence genes of Vibrio parahaemolyticus and Vibrio vulnificus in shrimp and shellfish by PCR V parahaemolyticus is one of the most common causes of seafood-borne bacterial gastroenteritis in human V vulnificus may cause fatal wound infections and septicemia The objectives of this study were to detect the presence of V parahaemolyticus and V vulnificus as well as some their virulence genes in shrimp and shellfish by using multiplex PCR (m-PCR) and traditional method and the comparision between two methods was used Total 240 shrimp and shellfish samples were collected from Dong Nai Province and HoChiMinh City Samples were grown in alkaline peptone water (APW) supplemented with polymycin B 50UI containing either 3% salt (medium No 1) or 6% salt (medium No 2) DNA extracted from enriched samples to identify V parahaemolyticus and V vulnificus by m-PCR1, virulence genes of V parahaemolyticus by m-PCR2 and vvp gene of V vulnificus by PCR3 Besides, isolates from enriched media were examined using conventional method and were confirmed by m-PCR1 The isolates of V parahaemolyticus and V vulnificus were tested for antibiotic resistances By m-PCR1 reaction, V parahaemolyticus was detected from 30.42% of the enriched samples in medium No and 27.92% of the enriched samples in medium No While, the bacteria were isolated from only 24.58% and 8.33% of the samples, respectively However, only 35.15% of V parahaemolyticus isolates (medium No 1) confirmed by m-PCR1 after biochemical analysis was used Similarly, the rates of V vulnificus of the medium No (26.67%) and the medium No (20.42%) using m-PCR2 were also higher than those of the medium No (16.25 %) and the medium No (7.50 %) using biochemical identification In viii biến gen vvp có khả gây bệnh lâm sàng chuột nhờ vào yếu tố ly giải tế bào 3.2.3 Thảo luận kết thử kháng sinh đồ Kết thử kháng sinh đồ cho thấy V parahaemolyticus V vulnificus nhạy cảm với gentamycin, chloramphenicol, ciprofloxacin (100%) tetracyclin (88,89% V parahaemolyticus 100% V vulnificus); hai vi khuẩn đề kháng với amoxicillin, polymycin B Riêng V parahaemolyticus đề kháng với vancomycine, trái lại V vulnificus nhạy cảm với vancomycine (100%) đề kháng erymycin Từ kết nhận thấy loại kháng sinh nhóm có mức độ nhạy cảm tương đương Điều giải thích kháng sinh có chế tác động vi khuẩn đề kháng với loại kháng sinh đề kháng với loại kháng sinh nhóm Kết phù hợp với ghi nhận Diệp Thế Tài cs (2010) Tác giả ghi nhận tỷ lệ V parahaemolyticus nhạy cảm với kháng sinh tetracycline (90,77%), chloramphenicol (97,69%), ciprofloxacin (100%), bactrim, doxycyclin (93,08%); đề kháng với kháng sinh ampicillin (34,62%), tetracycline bactrim (69,2%) Ngoài ra, Jun cs (1999) French cs (1989) ghi nhận tính nhạy cảm V parahaemolyticus với kháng sinh streptomycin, nalidixic acid, rifampicin, ceftriaxone chloramphenicol (98%), sulfamethoxazole (98%) ceftazidime (96%) Thêm vào French cs (1989) ghi nhận đề kháng V parahaemolyticus kháng sinh ampicillin, trimethoprim cefuroxime Đề kháng kháng sinh amoxicillin, polymycin B, vacomycin vi khuẩn V parahaemolyticus V vulnificus nên quan tâm, có xuất gen kháng thuốc môi trường điều nguy hiểm có trao đổi gen plasmid loài vi khuẩn với mơi trường Jun cs (1999) tìm thấy trao đổi gen đề kháng kháng sinh ampicillin, cefuroxime, trimethoprim chủng với Trong tự nhiên, việc sử dụng kháng sinh phòng trị bệnh cho người thú làm tăng số chủng vi khuẩn đề kháng với 55 kháng sinh (Levy, 2001) Sự diện kháng sinh nước thải nhà máy sản xuất thuốc góp phần làm tăng chủng vi khuẩn đề kháng kháng sinh môi trường (Baquero Blazquez, 1997) Ở người, kháng sinh khác nhau, bao gồm tetracycline cephalosporin hệ ba thường dùng điều trị bệnh V vulnificus gây nhiễm trùng nặng Tuy nhiên, trường hợp nhiễm trùng mô mềm nghiêm trọng, phẫu thuật loại bỏ ổ viêm cần thiết (Chuang cs, 1992; Cameron cs, 1998) 56 KẾT LUẬN VÀ ĐỀ NGHỊ Kết luận Môi trường nước muối peptone kiềm bổ sung 3% NaCl polymycin B 50UI mơi trường tăng sinh thích hợp cho hai phương pháp xác định V parahaemolyticus, V vulnificus thử sinh hóa m-PCR Phương pháp m-PCR cho kết nhanh, xác, tốn chi phí thời gian cho việc phát V parahaemolyticus, V vulnificus gen độc lực chúng so với phương pháp truyền thống V parahaemolyticus xuất mẫu khảo sát tương đối cao V vulnificus Tỷ lệ phát gen độc lực tlh V parahaemolyticus 100% (73/73 mẫu), gen độc lực vvp V vulnificus 34,38% (22/64 mẫu) Các gốc V parahaemolyticus đề kháng hoàn toàn với amoxicillin, polymycin B, vancomycin nhạy cảm cao với chloramphenicol, gentamicin, ciprofloxacin tetracycline Các gốc V vulnificus đề kháng hoàn toàn với amoxicillin, polymycin B, erythromycin nhạy cảm cao với gentamicin, chloramphenicol, ciprofloxacin, tetracycline vancomycin Đề nghị Để phát V parahaemolyticus V vulnificus nên sử dụng phương pháp m-PCR Tầm soát với số lượng mẫu lớn địa bàn khảo sát rộng để đánh giá mức diện V parahaemolyticus, V vulnificus gen độc lực chúng Cần tiến hành khảo sát nhiều gen độc lực vvhA, rtxA1 V vulnificus để kiểm sốt tốt tác nhân gây ngộ độc thực phẩm 57 TÀI LIỆU THAM KHẢO Alam M J., Tomochika K I., Miyoshi S I and Shinoda S., 2002 Environmental investigation of potentially pathogenic Vibrio paraheamolyticus in the Seto-Inland Sea, Japan FEMS Microbiol Lett 208: 83 – 87 Andrews L S., Park D L and Chen Y P., 2000.Low temperature pasteurization to redue the risk of Vibrio infections from raw shew – stock oysters Food Add 19: 787 – 791 Anon, 2005 Food Poisoning in Taiwan, 1981-2003 Department of Health, Taiwan Banerjee S K., Pandian S., Todd E C.and Farber J M., 2002 A rapid and improved method for the detection of Vibrio parahaemolyticus and Vibrio vulnificus strain grown on hydrophobic grid membrane filters J Food Prot 65: 1049 – 1053 Baquero F and Blazquez J., 1997 Evolution of antibiotic resistance Trends in Ecology and Evolution 12: 482 – 487 Bej A.K., Patterson D.P., Brasher C.W., Vickery M.C.L., Jones D.D and Kaysner C A., 1999 Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tlh, tdh and trh J Microbiol Meth 36: 215 - 225 Bisharat N and Raz R., 1996 Vibrio infection in Israel due to changes in fish marketing Lancet 348 (9041): 1585 - 1591 Bisharat N., Agmon V., Finkelstein R., Raz R., Ben-Dror G., Lerner L., Soboh S., Colodner R., Cameron D N., Wykstra D L., Swerdlow D L., 1999 Clinical, epidemiological, and microbiological features of Vibrio vulnificus biogroup causing outbreaks of wound infection and bacteraemia in Israel Israel Vibrio Study Group Lancet 354 (9188): 1421 - 1425 Bhuiyan N A., Ansaruzzaman M., Kamruzzaman M., Alam K., Chowdhury N R., Nishibuchi M., Faruque S M., Sack D A., Takeda Y and Nair G B., 2002 Prevalence of the pandemic genotype of Vibrio parahaemolyticus in Dhaka, Bangladesh, and significance of its distribution across different serotypes J Clin Microbiol 40: 284 – 286 10 Bùi Quang Tề, 2006 Bệnh học Thủy sản Nhà xuất Nông nghiệp 11 Buller N B., 2004 Bacteria from fish and other aquatic animals: a practical identification manual CABI 58 12 Cameron D., Wykstra D., Bisharat N and Agmon V., 1998 Phenotypic and molecular characterization of a new Vibrio causing outbreaks of wound infection and bacteremia in Israel Atlanta, GA: Int Conf Emer Infect Dis 13 Centers for Disease Control (CDC), 2006 Vibrio parahaemolyticus infection associated with consumption of raw shellfish from Long Island Sound Connecticut, New Jersey, and New York, 2006 MMWR 55: 854 - 860 14 Chang T M., Chuang Y C., Su J H and Chang M C., 1997 Cloning and sequence analysis of a novel hemolysin gene (vllY) from Vibrio vulnificus Appl Environ Microbiol 63: 3851 - 3857 15 Chen S., Liu S and Zhang L., 1991 Occurrence of Vibrio parahaemolyticus in seawater and some seafoods in the coastal area of Qingdao J Ocean Univ Qingdao 21: 43 – 50 16 Cheng J C., Shao C P and Hor L I., 1996 Cloning and nucleotide sequencing of the protease gene of Vibrio vulnificus Lancet 183 (1-2): 255 - 262 17 Chowdhury A., Ishibashi M., Thiem V D., Tuyet D T., Tung T V., Chien B T., Seidlein L., Canh Lv G., Clemens J., Trach D D and Nishibuchi M., 2004 Emergence and serovar transition of Vibrio parahaemolyticus pandemic strains isolated during a diarrhea outbreak in Vietnam between 1997 and 1999 Microbiol Immun 48: 319 – 327 18 Chuang Y., Yuan Y., Lin C.Y., Lan C K and Huang A., 1992 Vibrio vulnificus infection in Taiwan: report of 28 cases and review of clinical manifestations and treatment Clin Infect Dis 15: 271 – 278 19 Chuang Y C., Chang T M and Chang M C., 1997 Cloning and characterization of the gene (empV) encoding extracellular metalloprotease from Vibrio vulnificus Lancet 189 (2): 163 - 171 20 Cleland D., Thomas M B., Strickland D.and Oliver J D., 1985 A comparison of media for the isolation of Vibrio spp from environmental sources Abstracts of the Annual Meeting of the American Society for Microbiology 16: 220 21 Cohen A L., Oliver J D., DePaola A., Feil E J Boyd E F., 2007 Emergence of a virulent clade of Vibrio vulnificus and correlationwith the presence of a 33-kilobase genomic Island Environ Microbiol 17(73): 5553 – 5565 22 Cook D W., Oleary P., Hunsucker J C., Sloan E M., Bowers J C., Blodgett R J., DePaola A., 2002 Vibrio vulnificus and Vibrio parahaemolyticus in U.S retail shell oysters: a national survey from June 1998 to July 1999 J Food Prot 65: 79 – 87 59 23 Croci L., Suffredini E., Cozzi L and Toti L., 2002 Effects of depuration of molluscs experimentally contaminated with E coli, Vibrio cholerae O1 and Vibrio parahaemolyticus J Appl Microbiol 92: 460 – 465 24 Daniels N A., Mackinnon L., Bishop R., Altekruse S., Ray B., Hammond R M., Thompson S., Wilson S., Bean N H., Griffin P M and Slutsker L., 2000 Vibrio parahaemolyticus infections in the United States, 1973–1998 J Infect Dis 181: 1661 – 1666 25 Daniels N A and Shafaie A., 2000 A review of pathogenic Vibrio infections for clinicians Infect Med 17: 665 – 685 26 Deepanjali A., Kumar H.S., Karunasagar I and Karunasagar I., 2005 Seasonal variation in abundance of total and pathogenic Vibrio parahaemolyticus bacteria in oysters along the southwest coast of India Appl Environ Microbiol 71: 3575 – 3580 27 DePaola A., Capers G M.and Alexander D., 1994 Dentisities of Vibrio vulnificus in the intestines of fish from the US Gulf coast Appl Environ Microbiol 60: 984 - 988 28 Diep The Tai, Au Vinh Thuy, Nguyen Thi Ngoc Nhi, Nguyen Thi Kim Ngoc, Nguyen Thi Phuong Lan 2010 Virulence and antimicrobial resistance characteristics of Vibrio parahaemolyticus isolated from environment, food and clinical samples in the south of Vietnam, 2010 From Institut Pasteur International Network Annual Scientific Meeting Hong Kong 22-23 November 2010 29 EC., 2001 European Commission Health and Consumer Protection Directorategeneral Opinion of the Scientific Committee on veterinary measures relating to public health on Vibrio vulnificus and Vibrio parahaemolyticus (in raw and undercooked seafood) Europa.eu.int/comm /fod/fs/sc/scv/out45on.pdf [05.09.05]) 30 Elliot E L., Kaysner C A., Jackson L and Tamplin M L., 1995 Vibrio cholerae, V parahaemolyticus, V vulnificus and other Vibrio spp, p.901-927 In FDA Bacteriological Analytical Manual, 8th ed AOAC International, Gaithersburg, MD 31 Food and Agriculture Organization (FAO), 2002 Risk assessment of Campylobacter spp In broiler chickens and Vibrio spp in seafood Bangkok, ThaiLand 57: 18 – 41 32 Food and Drug Administration (FDA), 2004 Bacteriological Analytical Manual 33 French G L., Woo M L., Hui Y W and Chan K Y., 1989 Antimicrobial susceptibilities of halophilic Vibrios J Anti Chem 24: 183 - 194 34 Gil A., Miranda H., Lanata C F., Prada A., Hall E R., Barreno C M., Nusrin S., Bhuiyan N A., Sack D A.and Nair G B., 2007 O 3:K6 Serotype of Vibrio 60 parahaemolyticus identical to the global pandemic clone associated with dearrhea in Peru Int J Infect Dis 11 (4): 324 – 328 35 Hara-Kudo Y., Nishina T., Nakagawa H., Konuma H., Hasegawa J and Kumagai S., 2001 Improved Method for Detection of Vibrio parahaemolyticus in Seafood Appl Environ Microbiol 12 (67): 5819 – 5823 36 Harwood V J., Gandhi J P and Wright A C 2004 Methods for isolation and confirmation of Vibrio vulnificus from oysters and environmental sources: a review J Microbiol Met 59: 301 – 316 37 Hervio-Heath D., Colwel R R., Derrien A., Robert-Pillot A., Fountier J M and Pommepuy M., 2002 Occurence of pathogenic Vibrios in coastal areas of France J App Microbiol 92: 1123 - 1135 38 Hlady W G and Klontz K C., 1996 The epidemiology of Vibrio infections in Florida, 1981–1993 J Infect Dis 173: 1176 – 1183 39 Hồ Huỳnh Thùy Dương, 1998 Sinh học phân tử Nhà xuất Giáo dục 40 Hollis D G., Weaver R E., Baker C N., Thornsberry C., 1976 Halophilic Vibrio species isolated from blood cultures J Clin Microbiol 3: 425 – 431 41 Honda T., Ni Y and Miwatani T., 1988 Purification and characterization of a hemolysin produced by a clinical isolate of Kanagawa phenomenon-negative Vibrio parahaemolyticus and related to the thermostable direct hemolysin Infect Immun 56: 961 - 965 42 Hongkong News, Baltimore Sun, Science Daily, 8/2005 Khuẩn “ăn thịt người” ca nhiễm 43 International Organization for Standardization (ISO), 2007 Detection of Vibrio parahaemolyticus and Vibrio cholerae ISO/TS 21872-1: 2007(E) 44 Jeong K C., Jeong H S., Rhee J H., Lee S E., Chung S S., Starks A M., Escudero G M., Gulig P A and Choi S H., 2000 Construction and phenotypic evaluation of Vibrio vulnificus vvpE mutant for elastolytic protease Infect Immun 68: 5096 - 5106 45 Jones M K and Oliver J D., 2009 Vibrio vulnificus: disease and patogenesis Infect Immun 77: 1723 – 33 46 Julie D., Solen L., Antoine V., Jaufrey C., Annick D and Dominique H H., 2010 Ecology of pathogenic and non-pathogenic Vibrio parahaemolyticus on the French Atlantic coast Effects of temperature, salinity, turbidity and chlorophyll a Appl Environ Microbiol 12 (4): 929 - 37 47 Jun L , Jun Y., Rita W T F , Julia M., Ling L and Woo Y S., 1999 Antibiotic resistance and plasmid profiles of Vibrio Isolates from cultured silver Sea Bream, Sparus sarba Marine Pollution Bulletin 39: 245 – 249 61 48 Kaper J B., Campen R K., Seidler R J., Baldini M M and Falkow S., 1984 Cloning of the thermostable direct or Kanagawa phenomenonassociated hemolysin of Vibrio parahaemolyticus Infect Immun 45: 290 – 292 49 Karunasagar I., Venugopal M N and Segar K., 1986 Evaluation of methods for enumeration of Vibrio parahaemolyticus from seafood Appl Environ Microbiol 52: 583 – 585 50 Kaufman G E., Bej A K., Bowers J and DePaola A., 2003 Oyster-to-oyster variability in levels of Vibrio parahaemolyticus J Food Pro 66: 125 – 129 51 Kaufman G E., Bowen M D., Meyer R F., DePaola A., Bowers J., Blackstone G M., Vickery M C L and Bej A K., 2004 Real-time PCR quantification of Vibrio parahaemolyticus in oysters using an alternative matrix J Food Prot 67: 2424 – 2429 52 Kaysner C A., Abeyta Jr C., Wekell M M., DePaola Jr A., Stott R F and Leitch J M., 1987 Virulent strains of Vibrio vulnificus isolated from estuaries of the United States West Coast Appl Environ Microbiol 53: 1349 – 1351 53 Kaysner C A., 2000 Vibrio species In The Microbiological Safety and Quality of Food (Eds: B M Lund , A D Baird-Parker and G W Gould ) Vol II Chapter 48 Aspen Publishers, Gaithersburg, MD Pp1336 – 1362 54 Kelly M T., 1982 Effect of temperature and salinity on Vibrio (Beneckea) vulnificus occurrence in a Gulf Coast environment Appl Environ Microbiol 44, 820–824 55 Kelly M T and Stroh E M D., 1988 Temporal relationship of Vibrio parahaemolyticus in patients and the environment J Clin Microbiol 26: 1754 - 1756 56 Kelly M T and Stroh E M D., 1989 Urease-positive, Kanagawa-negative Vibrio parahaemolyticus from patients and the environment in the Pacific Northwest J Clin Microbiol 27: 2820 - 57 Kitaura T., Doke S., Azuma I., Imaida M., Miyano K., Harada K and Yabuuchii E., 1983 Halo production by sulfatase activity of V vulnificus and V cholerae-01 on a new selective sodium dodecyl sulfate-containing agar medium: a screening marker in environmental surveillance FEMS Microbiol Lett.17: 205 - 209 58 Klontz K C., Williams L., Baldy L M and Campos M., 1994 Raw oysterassociated Vibrio infections: linking epidemiologic data with laboratory testing of oysters obtained from a retail outlet J Food Prot 56: 977 – 979 59 Kothary M H and Kreger A S., 1987 Purification and characterization of an elastolytic protease of Vibrio vulnificus J Gen Microbiol 133: 1783 62 60 Lake R., Hudson A and Cressey P., 2003 Risk profile: Vibrio parahaemolyticus in seafood A Crown Research Institute 61 Lee J K., Jung D W., Eom S Y., Oh S W., Kim Y., Kwak H S and Kim Y H., 2007 Occurrence of Vibrio parahaemolyticus in oysters from Korean retail outlets Food Control 19: 990 – 994 62 Levy S B., 2001 Antibacterial Household Products: Cause for Concern Emer Infect Dis 63 Liston J., 1990 Microbial hazards of seafood consumption Food Tech: 56 – 62 64 Liu X., Chen Y., Wang X and Ji R., 2004 Foodborn disease outbreaks in China from 1992 to 2001 – national foodborn disease surveillance system J Hygiene Res 33: 725 – 727 65 Lozano L A., Tones J., Osorio C R.and Marti U J., 2003 Identification of tdhpositive Vibrio parahaemolyticus from an outbreak associated with raw oyster consumption in Spain FEMS Microbiol Lett 226: 281 – 284 66 Martinez-Urtaza J., Simental L., Velasco D., DePaola A., Ishibashi M., Nakaguchi Y., Nishibuchi M., Carrera-Flores D., Rey-Alvarez C and Pousa A., 2005 Pandemic Vibrio parahaemolyticus O3:K6, Europe Emerg Infect Dis 11: 1319 – 1320 67 Mead P S., Slutsker L., Dietz V., McCaig L F., Bresee J S., Shapiro C., Griffin P.M and Tauxe R.V., 1999 Food-related illness and death in the United States Emerg Infect Dis 5: 607 – 625 68 Miyoshi N., Shimizu C., Miyoshi S and Shinoda S., 1987 Purification and characterization of Vibrio vulnificus protease Microbiol Immun 31: 13 - 25 69 Miyoshi S and Shinoda S., 1992 Activation mechanism of human Hageman factor-plasma kallikrein-kinin system by Vibrio vulnificus metalloprotease FEBS Lett 308: 315 – 319 70 Miyoshi S., Nakazawa H., Kawata K., Tomochika K., Tobe K.and Shinoda S., 1998 Characterization of the hemorrhagic reaction caused by Vibrio vulnificus metalloprotease, a member of the thermolysin family Infect Immun 66: 4851 71 Miwatani T., Takeda Y., Honda T., 1977 Role of toxin in Vibrio parahaemolyticus infections Lancet 35 (3): 1542 - 1550 72 Miyamoto Y., Obara Y., Nikkawa T., Yamai S., Kato T., Yamada Y and Ohashi M., 1980 Simplified purification and biophysico chemical characteristics of Kanagawa phenomenon-associated hemolysin of Vibrio parahaemolyticus Infect Immun 28 (2): 567 – 576 63 73 Mohammad A R., Hashim J K., Gunasalam J and Radu S., 2005 Microbiological risk assessement: Risk Assessment of Vibrio parahaemolyticus in Black 74 Molenda J R., Johnson W G., Fish M., Wentz B., Mehlman I J and Dadisman T A., 1972 Vibrio parahaemolyticus gastroenteritis in Maryland Appl Microbiol 24: 444 – 448 75 Molero X., Bartolome R M., Vinuesa T., Guamer L., Accarino A., Casellas F and Garcia R., 1989 Acute gastroenteritis due to Vibrio parahaemolyticus in Spain Med Clin 92: – 76 Morris J G., 1999 Vibriosis on the half-shell Culture 20: - 77 Motes M L., DePaola A., Cook D W., Veazey J E., Hunsucker J C., Garthright W E., Blodgett R J.and Chirtel S J., 1998 Influence of water temperature and salinity on Vibrio vulnificus in Northern Gulf and Atlantic Coast oysters (Crassostrea virginica) Appl Environ Microbiol 64: 1459 – 1465 78 Nair G B., Ramamurthy T., Bhattacharya S K., Dutta B., Takeda Y and Sacj D A., 2007 Global dissemination of Vibrio parahaemolyticus serotype O3:K6 and its serovariants Clin Microbiol Rev 20 (1): 39 - 48 79 Nakasone N and Iwanaga M., 1990 Pili of a Vibrio parahaemolyticus strain as a possible colonization factor Infect Immun 58: 61 - 70 80 Neogi S B., Chowdhury N., Asakura M., Hinenoya A., Haldar S., Saidi S.M., Kogure K., Lara R J and Yamasaki S., 2010 A highly sensitive and specific multiplex PCR assay for simultaneous detection of Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus Lett Appl Microbiol 51 (3): 293 – 300 81 Nguyễn Văn Thành, 2007 Sinh học phân tử Nhà xuất giáo dục 82 Nguyễn Ngọc Hải Nguyễn Thị Kim Loan, 2009 Thực hành nghiên cứu vi sinh Nhà xuất Nông Nghiệp 83 Nishibuchi M., Hill W E., Zon G., Payne W L and Kaper J B., 1986 Synthetic oligodeoxyribonucleotide probes to detect Kanagawa phenomenon-positive Vibrio parahaemolyticus J Clin Microbiol 23: 1091 – 1095 84 Nishibuchi M., Fasano A., Russel R G and Kaper J B., 1992 Enterotoxigenity of Vibrio parahaemolyticus with and without genes encoding thermostable direct hemolysisn Infect Immun 60 (9): 3539 - 3545 85 Nichibuchi M and Kaper J B., 1995 Thermostable direct hemolysin gene of Vibrio parahaemolyticus: a virulence gene acquired by a marine bacterium Infect Immun 63: 2093 – 2099 64 86 Nishina Y., Miyoshi S., Nagase A and Shinoda S., 1992 Significant role of an exocellular protease in utilization of heme by Vibrio vulnificus Infect Immun 60: 2128 – 2132 87 Nolan C M., Ballard J., Kaysner C A., Lilja J., Williams L B and Tenover F C., 1984 Vibrio parahaemolyticus Gastroenteritis: An outbreak associated with raw oysters in the Pacific Northwest Diag Microbiol Infect Dis 2: 119 – 128 88 Ogawa H., Tokunou H., Kishimoto T., Fukuda S., Umemura K and Takata M, 1989 Ecology of Vibrio parahaemolyticus in Hiroshima Bay Hiroshima J Vet Med 4: 47 – 57 89 Okabe S., Fujino T., Sakaguchi G., Sakazaki R and Takeda Y., 1974 Statistical review of food poisoning in Japan - Especially that by Vibrio parahaemolyticus Int J Infect Dis.20: – 90 Okuda J., Ishibashi M., Abbott S L., Janda J M and Nishibuchi M., 1997 Analysia of the thermostable direct hemolysin (tdh) gene and the tdhrelated hemolysin (trh) genes in urease-positive strains of Vibrio parahaemolyticus isolated on the west coast of the United States J Clin Microbiol 35: 1965-1971 91 Okujo N., Akiyama T., Miyoshi S., Shinoda S and Yamamoto S., 1996 Involvement of vulnibactin and exocellular protease in utilization of transferrin- and lactoferrin-bound iron by Vibrio vulnificus Microbiol Immun 40: 595 – 598 92 Okujo N., Saito M., Yamamoto S., Yoshida T., Miyoshi S and Shinoda S., 1994 Structure of vulnibactin, a new polyamine-containing siderophore from Vibrio vulnificus Biometals 7: 109 – 116 93 Oliver J D., Warner R A and Cleland D R., 1983 Distribution of Vibrio vulnificus and other lactose-fermenting vibrios in the marine environment Appl Environ Microbiol 45: 985 – 998 94 Oliver J D., 1989 Vibrio vulnificus In Foodborne Bacterial Pathogens (Ed: M P Doyle ) Marcel Dekker, Inc., New York p 569 – 600 95 Oliver J D and Kaper J B., 2001 Vibrio species In Food Microbiology Fundamentals and Frontiers (Eds: M P Doyle, L R Beuchat and T J Montville) Washington, DC: ASM Press, pp 263 – 300 96 Pace J L., Chai T J., Rossi H A and Jiang X., 1997 Effect of bile on Vibrio parahaemolyticus Appl Environ Microbiol 63: 2372 - 2377 97 Pinto A D., Ciccarese G., Corato R D., Novello L and Terio V., 2007 Detection of pathogenic Vibrio parahaemolyticus in southern Italian shellfish Int J Food Microbiol 65 98 Pinto A D., Terio V., Novello L and Tantillo., 2011 Comparison between thiosulphate citrate bile salt sucrose (TCBS) agar and Chromagar Vibrio for isolating Vibrio parahaemolyticus Food control 22: 124 - 127 99 Raghunath P., Karunasagar I., Karunasagar I., 2009 Improved isolation and detection of pathogenic Vibrio parahaemolyticus from seafood using a new enrichment broth Int J Food Microbiol 29: 200 - 203 100 Rippey S R., 1994 Infectious diseases associated with molluscan shellfish consumption Clin Microbiol Rev 7: 419 – 425 101 Roberts N C., Siebling R J., Kaper J B and Bradford H B., 1982 Vibrios in the Louisiana Gulf Coast environment Microbiol Ecol 8: 299 – 312 102 Robert P A., Guenole A., Lesne J., Delesmont R., Foumier J M and Quilici M L., 2004 Occurrence of the tdh and trh genes in Vibrio parahaemolyticus isolates from waters and shellfish collected in two French coastal areas and from seafood imported into France Int J Food Microbiol 91: 319 – 325 103 Shao C P and Hor L I., 2000 Metalloprotease is not essential for Vibrio vulnificus in mice Infect Immun 68: 3569 – 3573 104 Shapiro R L., Altekruse S., Hutwagner L., Bishop R., Hammond R., Wilson S., Ray B., Thompson S., Tauxe R V., Griffin P M., 1998 The role of Gulf Coast oysters harvested in warmer months in Vibrio vulnificus infections in the United States, 1988-1996 Vibrio Working Group J Infect Dis 178 (3): 752 – 761 105 Shirai H., Ito H., Hirayama T., Nakamoto Y., Nakabayashi N., Kumagai K., Takeda Y and Nishibuchi M., 1990 Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis Lnfect Immun 58: 3568 - 3573 106 Simpson L M and Oliver J D., 1983 Siderophore production by Vibrio vulnificus Infect Immun 41 (2): 644 – 649 107 Smith G C and Merkel J R., 1982 Collagenolytic activity of Vibrio vulnificus: potential contribution to its invasiveness Infect Immun 35 (3): 1155 – 1156 108 Smith C B., Johnson C N., King G M., 2011 Assessment of polyaromatic hydrocarbon degradation by potentially pathogenic environmental Vibrio parahaemolyticus isolates from coastal Louisiana, USA 109 Strom M S and Paranjpye R N., 2000 Epidemiology and pathogenesis of Vibrio vulnificus Microbes Infect 2: 177 – 188 110 Su Y C and Liu C., 2007 Vibrio parahaemolyticus: A concern of seafood safety Food Microbiol 24: 549 – 558 66 111 Takeda Y., 1983 Thermostable direct hemolysin of Vibrio parahaemolyticus Pharmac Ther 19: 123 – 146 112 Tacket C O., Brenner F., Blake P A., 1984 Clinical features and an epidemiological study of Vibrio vulnificus infections J Infect Dis 149 – 558 113 Tamplin M L., 1992 The seasonal occurrence of Vibrio vulnificus in shellfish, seawater and sediment of United States coastal waters and the influence of environmental factors on survival and virulence In Final Report SaltonstallKennedy Program National Marine Fisheries Service, Washington, D.C.pp 87 114 Taniguchi H., Hirano H., Kubomura S., Higashi K and Mizuguchi Y., 1986 Comparison of the nucleotide sequences of the genes for the thermolabile hemolysin from Vibrio parahaemolyticus Microbiol Patho 1: 425 - 432 115 Tarr C L., Patel J S., Puhr N D., Sowers E G., Bopp C A., and Nancy A Strockbine., 2007 Identification of Vibrio isolates by a multiplex PCR assay and rpoB sequence determination Clin Microbiol 45(1): 134 - 140 116 Testa J., Daniel L W and Kreger A S., 1984 Extracellular phospholipase A2 and lysophospholipase produced by Vibrio vulnificus Infect Immun 45 (2): 458 – 463 117 Tison D L., Nishibuchi M., Grennwood J D and Seidler R J., 1982 Vibrio vulnificus biotype 2; new biogroup pathogenic for eels Appl Environ Microbiol 44: 640 - 646 118 Tison D L and Kelly M T., 1986 Virulence of Vibrio vulnificus strains from marine environments Appl Environ Microbiol 51: 1004 - 1006 119 Thompson F.L., Iida T and Swing J., 2004 Biodiversity of vibrio Microbiol Mol Biol Rev 68 (3): 403 - 431 120 Trần Linh Thước, 2003 Phương pháp phân tích vi sinh vật Nhà xuất giáo dục 121 Tuyet D T., Them V D., Seidlein L V., Chowdhury A., Park E., Canh D G.,Chien B T., Tung T V., Naficy A., Rao M R., Ali M., Lee H., Sy T H., Nichibuchi M., Clemens J and Trach D D., 2002 Clinical, Epidemiological, and Socioeconomic Analysis of an Outbreak of Vibrio parahaemolyticus in Khanh Hoa Province, Viet Nam Infect 186 : 1615 - 1620 122 Warnock E W., Terry L.and MacMath M D., 1993 Primary Vibrio vulnificus septicemia J Emer Med 11 (2): 153 – 156 123 Watanabe H., Miyoshi S., Kawase T., Tomochika K and Shinoda S., 2004 High growing ability of Vibrio vulnificus biotype is essential for production of a toxic metalloprotease causing systemic diseases in humans Microbiol 36: 117 - 123 67 124 Wong H C., Chen M C., Liu S H and Liu D P., 1999 Incidence of highly genetically diversified Vibrio parahaemolyticus in seafood imported from Asian countries Int J Food Microbiol 52: 181 – 189 125 Wong H C., Liu S H., Wang T K., Lee C L., Chiou C S., Liu D P., Nishibuchi M and Lee B K., 2000 Characteristics of Vibrio parahaemolyticus O3:K6 from Asia Appl Environ Microbiol 66: 3981 3986 126 Wright A C., Simpson L M., Oliver J D and Morris J G., 1990 Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus Infect Immun 58: 1769 - 1773 127 Wright A C and Morris J G., 1991 The extracellular cytolysin of Vibrio vulnificus: inactivation and relationship to virulence in mice Infect Immun 59 (1): 192 – 197 128 Wright A C., Hill R T., Johnson J A., Roghman M C., Colwell R R and Morris Jr J G., 1996 Distribution of Vibrio vulnificus in the Chesapeake Bay Appl Environ Microbiol 62: 717– 724 129 Wright A C., Powell J L., Tanner M K., Ensor L A., Karpas A B., Morris J G., Sztein Jr and Sztein M B., 1999 Differential expression of Vibrio vulnificus capsular polysaccharide Infect Immun 67: 2250 – 2257 130 Wright A C., Powell J L., Kaper J B and Morris J G., 2001 Identification of a group 1-like capsular polysaccharide operon for Vibrio vulnificus Infect Immun 69: 6893 - 6901 131 Yamamoto T and Yokota T., 1989 Adherence Targets of Vibrio parahaemolyticus in human small intestines Infect Immun 57 (8): 2410 – 2419 132 Yamamoto K., Honda T and Miwatani T., 1992 Enzyme – labeled oligonucleotide probes for detection of the genes for thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) of Vibrio parahaemolyticus J Microbiol 38: 410 – 416 133 Yeung P S and Boor K J., 2004 Epidemiology, pathogenesis and prevention of foodborne Vibrio parahaemolyticus infections Foodborne Patho Dis 1: 74 – 88 134 Zuppardo A B and Siebeling R J., 1998 An epimerase gene essential for capsule synthesis in Vibrio vulnificus Infect Immun 66: 2601 – 2606 68 PHỤ LỤC Phụ lục Kết giải trình tự gen vvp V vulnficus AAC72410.1 metalloprotease [Vibrio vulnificus] Vùng Trị số Tỷ lệ bao tương tương phủ đồng đồng E 96% 3e-121 96% BAI66359.1 metalloprotease [Vibrio vulnificus] 96% 4e-121 96% 96% 4e-121 96% 96% 4e-121 96% 96% 9e-121 96% 96% 1e-120 96% 96% 1e-119 95% 96% 7e-117 93% Ký hiệu ACP30470.1 AAC44789.1 NP_937521.1 AAC45343.1 ABI95803.1 BAI66361.1 Protein metalloprotease precursor [Vibrio vulnificus] zinc metalloprotease [Vibrio vulnificus] Zinc metalloprotease, vibriolysin [Vibrio vulnificus YJ016] metalloprotease [Vibrio vulnificus] zinc metalloprotease vulnificus] metalloprotease [Vibrio >110518-11_L02_VVP-F-vvp.ab1 635 GTGTCAGTCTCGATAGTGCCGATATTGGACAGGCTTTATCCGTTCAAGCTCGTAGT CTCGCGCCAGTCGAAAATGGCTTCGAGGCGGTTAAAACGATTCAACTGCCGAATGG CAAAACCAAAGTTCGATATCAGCAAACCTATTTGGGCCTGCCTGTGTTTGATACCG CCGTTGTCGCGACAGAAGGACGTTCAGGGTTGAGTAATGTGCATGGCACCATGGCA CAAGGTTTGGCAGCCGATCTGCCTTCTGTGTCGGTTAATCTTGATCAGCAACAAGC CATCGCCCTCGGGAAGCAGCGCCACCAAGCGAAGCATGCCAATGCTAAAGCGCTCA ACACCGAGAACGAAACCGCACAACTGATGGTGCGTTTAGACGCAAACAACAAAGCT CAATTGGTCTATTTGGTGAGTTTCTTTGTCGCGGAAGAAGAGCCTTCTCGCCCCTT TATGTTCATAGACGCCAACAGTGGCGAGATATTGCAGGTGTGGGATGGCTTAAATC ATGCGCAAGCAGGCGGTACTGGACCTGGAGGCAACAGTAAAACGGGCCGTTATGAG TTTGGTACTGATTACCCAAGCTTTGTCATCGATAAAGTCGGAACGACTTGTACGAT GAAAAGAGCGTGGTGAAAA 69 ... Minh Địa liên lạc Số nhà 13/21 Kp Thắng Lợi 2, P Dĩ An, thị xã Dĩ An, tỉnh Bình Dương Email: kiennguyen74@gmail.com Điện thoại: 0909.209.903 ii LỜI CAM ĐOAN Tôi cam đoan công bố luận văn trung... phương pháp 28 giảm lượng mẫu cần thi t ban đầu, gia tăng số lượng thí nghiệm, giảm tiêu tốn hóa chất phản ứng Tuy nhiên, thực m-PCR cần phải xem xét số yếu tố thi t kế sử dụng đoạn mồi Các mồi... gastroenteritis in human V vulnificus may cause fatal wound infections and septicemia The objectives of this study were to detect the presence of V parahaemolyticus and V vulnificus as well as some their