26-Lê Huyền Ái Thúy- Quốc Tế.pdf

i ỦY BAN NHÂN DÂN BỘ GIÁO DỤC VÀ ĐÀO TẠO THÀNH PHỐ HỒ CHÍ MINH TRƯỜNG ĐẠI HỌC MỞ TP HCM SỞ KHOA HỌC VÀ CÔNG NGHỆ CHƯƠNG TRÌNH KHOA HỌC VÀ CÔNG NGHỆ CẤP THÀNH PHỐ BÁO CÁO TỔNG HỢP KẾT QUẢ NHIỆM VỤ NGHI[.]

ỦY BAN NHÂN DÂN THÀNH PHỐ HỒ CHÍ MINH SỞ KHOA HỌC VÀ CÔNG NGHỆ BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC MỞ TP HCM CHƯƠNG TRÌNH KHOA HỌC VÀ CÔNG NGHỆ CẤP THÀNH PHỐ BÁO CÁO TỔNG HỢP KẾT QUẢ NHIỆM VỤ NGHIÊN CỨU KHOA HỌC VÀ CƠNG NGHỆ NGHIÊN CỨU MỘT SỐ TÍNH CHẤT PHÂN TỬ CỦA UNG THƯ VÒM HỌNG TRÊN NGƯỜI BỆNH VIỆT NAM Cơ quan chủ trì nhiệm vụ: Trường Đại học Mở, TPHCM Chủ nhiệm nhiệm vụ: PGS.TS Lê Huyền Ái Thúy Thành phố Hồ Chí Minh - 2019 i ỦY BAN NHÂN DÂN THÀNH PHỐ HỒ CHÍ MINH SỞ KHOA HỌC VÀ CÔNG NGHỆ BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC MỞ TP HCM CHƯƠNG TRÌNH KHOA HỌC VÀ CÔNG NGHỆ CẤP THÀNH PHỐ BÁO CÁO TỔNG HỢP KẾT QUẢ NHIỆM VỤ NGHIÊN CỨU KHOA HỌC VÀ CÔNG NGHỆ NGHIÊN CỨU MỘT SỐ TÍNH CHẤT PHÂN TỬ CỦA UNG THƯ VÒM HỌNG TRÊN NGƯỜI BỆNH VIỆT NAM Chủ nhiệm nhiệm vụ: Cơ quan chủ trì nhiệm vụ Thành phố Hồ Chí Minh- 2019 ii MỤC LỤC MỤC LỤC .i DANH MỤC HÌNH iii DANH MỤC BẢNG v CHƯƠNG MỞ ĐẦU 1.1 Tổng quan vấn đề nghiên cứu .1 1.1.1 Yếu tố nhiễm EBV ung thư vòm họng 1.1.2 Epigenetic ung thư vòm họng .4 1.1.2.1 Cơ chế thứ – Methyl hóa bất thường ung thư vịm họng .4 1.1.2.2 Cơ chế thứ hai – Sự biểu microRNA; ung thư vòm họng .8 1.2 Dịch phết tế bào vịm họng – loại mẫu khơng xâm lấn, phát sớm biomarker bệnh ung thư vòm họng .20 1.3 Tình hình nghiên cứu Việt Nam .22 1.4 Mục tiêu nhiệm vụ 23 1.4.1 Mục tiêu tổng quát 23 1.4.2 Mục tiêu cụ thể .23 CHƯƠNG VẬT LIỆU - PHƯƠNG PHÁP 25 2.1 Phương pháp thu nhận mẫu nghiên cứu 25 2.2 Phương pháp tách chiết DNA xác định nồng độ DNA 26 2.3 Phương pháp biến đổi bisulfite DNA sử dụng bisulfite kit 26 2.4 Phản ứng MSP (Methylation Specific PCR) 27 2.5 Phương pháp tách chiết RNA tổng số, định lượng mRNA virus EBV .27 2.6 Phương pháp tách chiết định lượng miRNA 28 2.7 Phương pháp thống kê, xử lý số liệu 29 CHƯƠNG NỘI DUNG KHOA HỌC ĐÃ ĐĂNG KÝ THỰC HIỆN 30 iii CHƯƠNG CÁC KẾT QUẢ ĐẠT ĐƯỢC 33 4.1 Các sản phẩm “Dạng II” 33 4.1.1 Công việc Thu nhận mẫu nghiên cứu 33 4.1.2 Công việc Khảo sát diện biểu gen mục tiêu: họ gen biểu sớm EBNA (EBNA-1, EBNA-2), họ gen biểu muộn LMP (LMP-1, LMP-2), BARTs 36 4.1.2.1 Kết khảo sát diện gen mục tiêu EBNA-1, EBNA-2, LMP-1, LMP-2, BARTs .37 4.1.2.2 Kết khảo sát biểu gen mục tiêu EBNA-1, EBNA-2, LMP-1, LMP-2 BARTs .49 4.1.3 Cơng việc Khảo sát tính chất methyl hóa cao bất thường (hypermethylation) số gen ức chế khối u: RASSF1A, p16INK4α, DAPK, Blu 69 4.1.4 Công việc Khảo sát biểu số miRNA người có liên quan đến NPC .79 4.2 Các sản phẩm “Dạng III”: 88 4.3 Các sản phẩm “Dạng IV” 90 5.1 Kết luận 92 5.2 Kiến nghị .93 TÀI LIỆU THAM KHẢO 94 PHỤ LỤC Giấy chấp nhận đạo đức nghiên cứu y sinh học đối tượng người bệnh viện chợ rẫy cấp 105 PHỤ LỤC Danh sách mẫu mơ sinh thiết vịm họng - kết thí nghiệm 106 PHỤ LỤC Danh sách mẫu dịch phết vịm họng - kết thí nghiệm 110 PHỤ LỤC Danh sách mẫu mô dịch phết lành vịm họng - kết thí nghiệm 114 iv DANH MỤC HÌNH Hình 1.1 Cấu trúc phân tử Drosha người Hình 1.2 Cấu trúc phân tử Dicer Hình 1.3 Quá trình sinh tổng hợp miRNA trưởng thành Hình 1.4 Sự bắt cặp mạch “guide” miRNA với mạch mRNA mục tiêu Hình 1.5 miRNA đóng vai trị (a) ức chế khối u; (b) oncogene Hình 1.6 Nguyên tắc kỹ thuật stem-loop RT PCR Hình 2.1 Nguyên tắc biến đổi bisulfite: chuyển Cytosine thành Uracil Hình 2.2 Nguyên tắc phản ứng MSP Hình 4.1 Kết khuếch đại gen (A) (a) EBNA-1, (b)EBNA-2, β-actin; (B) (a) LMP1, (b) LMP-2, β-actin Hình 4.2 Kết giải trình tự (thể phần) gen mục tiêu (A) EBNA-1; (B) EBNA-2; (C) LMP-1; (D) LMP-2 Hình 4.3 Kết phân tích Real-time RT-PCR đường cong nóng chảy gen mục tiêu: (A)(B) EBNA-1, (C)(D) EBNA-2; (E)(F): LMP-1; (G)(H) GAPDH Hình 4.4 Kết real-time phân tích diện RPMS1, BARF0 A73 thuộc BARTs số mẫu Hình 4.5 Kết điện di sản phẩm Nested-MSP gen Blu số mẫu sinh thiết mơ UTVH Hình 4.6 Kết điện di sản phẩm Nested-MSP gen DAPK số mẫu sinh thiết mơ UTVH Hình 4.7 Kết điện di sản phẩm Nested-MSP gen RASSF1A số mẫu sinh thiết mơ UTVH Hình 4.8 Kết điện di sản phẩm Nested-MSP gen p16INK4α số mẫu sinh thiết mơ UTVH Hình 4.9 Kết giải trình tự sản phẩm có hypermethylation gen Blu, DAPK, RASSF1A p16INK4α v Hình 4.10 Kết giải trình tự sản phẩm khơng hypermethylation gen Blu, DAPK, RASSF1A p16INK4α Hình 4.11 Kết khuếch đại gen chứng nội U6snRNA mẫu thí nghiệm (A) chu kỳ khuếch đại; (B) Đường cong nóng chảy gen U6snRNA Hình 4.12 Kết Real-time RT-PCR (A) miR-155 (B) miR-21 số mẫu thực nghiệm vi DANH MỤC BẢNG Bảng 1.1 Các protein EBV chức chúng Bảng 1.2 Các dạng tiềm tan biểu gen liên quan Bảng 1.3 Cơ sở liệu miRNA ung thư vòm họng Bảng 2.1 Chu trình nhiệt phản ứng biến đổi bisulfite Bảng 2.2 Thành phần phản ứng Reverse Transcriptase PCR Hình 2.3 Sơ đồ nhiệt phản ứng Reverse Transcriptase PCR Bảng 2.4 Thành phần phản ứng cho định lượng miRNA Bảng 2.5 Chu trình nhiệt cho phản ứng Realtime định lượng miRNA Bảng 4.1 Bảng thông tin mẫu nghiên cứu thu nhận Khoa Tai Mũi Họng – Bệnh viện Chợ Rẫy, TPHCM Bảng 4.2 Tỷ lệ dạng UTVH thống kê theo WHO, 2005 số nước giới Bảng 4.3 Trình tự mồi sử dụng nghiên cứu Bảng 4.4 Kết khảo sát tương đồng sản phẩm khuếch đại Bảng 4.5 Kết phân tích thống kê diện gen EBNA-1, EBNA-2, LMP-1, LMP2 mẫu sinh thiết mô UTVH Bảng 4.6 Hệ thống điểm giá trị kappa AUC y học (Medcalc © 2018) Bảng 4.7 Hệ thống điểm giá trị OR RR y học (Medcalc © 2018) Bảng 4.8 Kết phân tích mối tương quan diện gen EBNA1, EBNA2, LPM1, LMP2 yếu tố lâm sàng Bảng 4.9 Kết phân tích mối tương quan diện gen EBNA1, EBNA2, LMP1, LMP2 yếu tố lâm sàng Bảng 4.10 Kết phân tích thống kê diện gen EBNA-1, EBNA-2, LMP-1, LMP2 mẫu dịch phết tế bào vịm họng, nhóm bệnh nhân UTVH Bảng 4.11 Cặp mồi sử dụng khuếch đại gen GAPDH vii Bảng 4.12 Kết phân tích biểu EBNA-1, EBNA-2, LMP-1, LMP2, RPMS1, BARF0 A73 mẫu sinh thiết mơ UTVH Bảng 4.13 Giá trị trung bình Ct mẫu sinh thiết mô UTVH giá trị 2-Ct Bảng 4.14 Kết phân tích mối tương quan biểu gen EBNA-1, EBNA-2, LMP-1, LMP-2 yếu tố lâm sàng, mẫu sinh thiết mơ UTVH Bảng 4.15 Kết phân tích mối tương quan số RPI (RT-PCR index) biểu bốn gen EBNA-1, EBNA-2, LMP-1, LMP-2 yếu tố lâm sàng, mẫu sinh thiết mơ UTVH Bảng 4.16 Kết phân tích mối tương quan biểu gen RPMS1, BARF0, A73 với đặc điểm lâm sàng, mẫu sinh thiết mơ UTVH Bảng 4.17 Kết phân tích mối tương quan số RPI biểu ba loại mRNA RPMS1, BARF0, A73 yếu tố lâm sàng, mẫu sinh thiết mô UTVH Bảng 4.18 Kết phân tích biểu gen ba họ gen Bảng 4.19 Kết phân tích tính chất biểu đồng thời ba họ gen với đặc điểm lâm sàng, mẫu sinh thiết mô UTVH Bảng 4.20 Kết phân tích biểu EBNA-1, EBNA-2, LMP-1, LMP2, RPMS1, BARF0 A73 mẫu dịch phết tế bào UTVH Bảng 4.22 Giá trị trung bình Ct mẫu dịch phết tế bào UTVH giá trị 2-Ct, gen mục tiêu chứng nội GAPDH Bảng 4.23 Tỷ lệ chênh lệch biểu gen virus EBV mẫu dịch phết tế bào UTVH mẫu lành Bảng 4.24 Trình tự mồi DAPK, Blu, RASSF1A p16 sử dụng nghiên cứu Bảng 4.25 Kết phân tích thống kê tính chất methyl hóa cao bất thường gen Blu, DAPK, RASSF1A p16INK4α mẫu sinh thiết mô UTVH Bảng 4.26 Kết phân tích tương quan tính chất hypermethylation với yếu tố lâm sàng, mẫu sinh thiết mô UTVH viii Bảng 4.27 Kết phân tích thống kê tính chất methyl hóa cao bất thường gen Blu, DAPK, RASSF1A p16INK4α mẫu dịch phết tế bào UTVH Bảng 4.28 Kết khảo sát miR-155 miR-21 mẫu sinh thiết mô UTVH Bảng 4.29 Giá trị trung bình Ct mẫu sinh thiết mô UTVH giá trị 2-Ct đánh giá biểu miR-155 miR-21 so với chứng nội U6snRNA Bảng 4.30 Tỷ lệ chệnh lệch biểu miRNA mẫu sinh thiết mô UTVH mẫu lành Bảng 4.31 Kết thể tính tương quan miR-155 miR-21 với đặc điểm lâm sàng, mẫu sinh thiết mô UTVH Bảng 4.32 Kết khảo sát miR-155 miR-21 mẫu dịch phết tế bào UTVH Bảng 4.33 Giá trị trung bình Ct mẫu dịch phết tế bào UTVH giá trị 2-Ct đánh giá biểu miR-155 miR-21 so với chứng nội U6snRNA Bảng 4.34 Tỷ lệ chệnh lệch biểu miRNA mẫu dịch phết tế bào UTVH mẫu lành Bảng 4.35 Tính chất phân tử 33 mẫu mô, dịch phết UVTH ix CHƯƠNG MỞ ĐẦU 1.1 Tổng quan vấn đề nghiên cứu Ung thư vòm họng (Nasopharyngeal carcinoma – NPC) loại khối u ác tính xuất phát từ lớp biểu mơ vùng vịm họng, khu vực phía sau khoang mũi phần họng; loại ung thư phổ biến loại ung thư vùng đầu cổ với tỷ lệ mắc bệnh quốc gia thuộc vùng Đông Nam Á ngày gia tăng (Globocan, 2012) Cũng dựa thống kê Globocan, Việt Nam, NPC loại ung thư đứng đầu loại ung thư vùng đầu cổ với tỷ lệ mắc bệnh ung thư vòm họng số liệu năm 2012 tính chung cho hai giới 3,9% (4931 trường hợp) tỷ lệ tử vong 3,0% (2885 trường hợp) Ba nhóm nguyên nhân gây nên NPC tóm lược trong: (1) Yếu tố di truyền nội (có liên quan đến DNA người); (2) Yếu tố nhiễm (Epstein-Barr Virus – EBV) (3) Yếu tố môi trường (Tao and Chan, 2007; Frappier, 2012) Các chẩn đoán thường quy bao gồm: chẩn đốn hình ảnh (chụp X quang, chụp cộng hưởng từ…), giải phẫu bệnh, hóa mơ miễn dịch, … Bệnh nhân NPC giai đoạn sớm bệnh thường triệu chứng có triệu chứng khơng rõ ràng, dễ bị bỏ sót triệu chứng đa phần không đặc trưng sưng cổ, tắc nghẹn mũi, chảy máu cam, ù tai… (Sham et al., 1990; Chu et al., 2008) Bệnh phát giai đoạn cuối, làm ảnh hưởng đến khả điều trị bệnh khả sống sót bệnh nhân Do đó, việc tìm kiếm hay vài dấu chứng sinh học (biomarker) nhằm sử dụng chúng thị hỗ trợ sàng lọc, chẩn đoán sớm kể nghiên cứu thử nghiệm hình thức trị liệu ung thư nói chung NPC nói riêng cần thiết 1.1.1 Yếu tố nhiễm EBV ung thư vòm họng Trong năm gần nay, có nhiều cơng trình nghiên cứu công bố mối quan hệ EBV NPC khẳng định nhiễm EBV nguyên dẫn đến ung thư vòm họng; diện EBV dấu chứng sinh học, xuất sớm, mang tính tiên lượng bệnh NPC (Mutirangura et al, 1998; Lo and Huang, 2002; Wong et al, 2005; Cho, 2007; Chan and Wong, 2014; Chan, 2014; Yang et al, 2015) Tuy nhiên, EBV loại virus có tính phổ nhiễm rộng cộng đồng tìm thấy nhiễm 90% người trưởng thành, có tính chất mạn tính nhiễm Lao Duc Thuan et al Journal of Science Ho Chi Minh City Open University, 7(2), (51-58) 57 References Ai, J., Xie, Z., Liu, C., Huang, Z & Xu, J (2012) Analysis of EBNA-1 and LMP-1 variants in diseases associated with EBV infection in Chinese children Virology Journal, 9, 13 Bochkarev A, J.A Barwell, R.A Pfuetzner, et al., Crystal structure of the DNA-binding domain of the Epstein-Barr virus origin-binding protein, EBNA1, bound to DNA Cell, 84(5), 791-800 Ceccarelli, D F J & Frappier, L (2000) Functional Analyses of the EBNA1 Origin DNA Binding Protein of Epstein-Barr Virus J Virol, 74(11), 4939-4948 da Costa, V G., Marques-Silva, A C & Moreli, M L (2015) The Epstein-Barr virus latent membrane protein-1 (LMP1) 30-bp deletion and XhoI-polymorphism in nasopharyngeal carcinoma: a meta-analysis of observational studies Syst Rev, 13, 46 Farrell, P J (2015) Epstein-Barr Virus Strain Variation Curr Top Microbiol Immunol, 390(Pt 1), 45-69 Feng, F T., Cui, Q., Liu, W S., Guo, Y M., Feng, Q S., Chen, L Z., … Zeng, Y X (2015) A single nucleotide polymorphism in the Epstein-Barr virus genome is strongly associated with a high risk of nasopharyngeal carcinoma Chin J Cancer, 34, 61 Frappier, L (2012) Role of EBNA1 in NPC tumourigenesis Semin Cancer Biol, 22, 154-161 Frappier, L (2015) EBNA1 Curr Top Microbiol Immunol, 391, 3-34 Gutiérrez, M I., Raj, A., Spangler, G., Sharma, A., Hussain, A., Judde, J G., … Bhatia, K (1997) Sequence variations in EBNA-1 may dictate restriction of tissue distribution of Epstein-Barr virus in normal and tumour cells J Gen Virol, 78 (Pt 7), 1663-1670 Kwok, H., Tong, A H., Lin, C H., Lok, S., Farrell, P J., Kwong, D L & Chiang, A K (2012) Genomic sequencing and comparative analysis of Epstein-Barr virus genome isolated from primary nasopharyngeal carcinoma biopsy PLoS One, 7(5), e36939 Le, T H., Vu, T T., Hoang, T M C., Le, T H & Nguyen, D P (2010) Subtyping P-Ala, P-Thr and V-val bay analysis of EBNA-1 from Epstein-Barr isolated in Vietnam.TCNCYH, 70(5), 8-13 (In Vietnamese) Leight, E R & Sugden, B (2000) EBNA-1: a protein pivotal to latent infection by Epstein-Barr virus Rev Med Virol, 10(2), 83-100 Licitra, L., Bernier, J., Cvitkovic, E., Grandi, C., Spinazzé, S., Bruzzi, P., … Molinari, R (2003) Cancer of the nasopharynx Crit Rev Oncol Hematol, 45(2), 199-213 Mai, S J., Ooka, T., Li, D J., Zeng, M S., Jiang, R C., Yu, X J., … Zeng, Y X (2007) Functional advantage of NPC-related V-val subtype of Epstein-Barr virus nuclear antigen compared with prototype in epithelial cell line Oncol Rep, 17(1), 141-146 McDermott, A L., Dutt, S N & Watkinson, J C (2001) The aetiology of nasopharyngeal carcinoma Clin Otolaryngol Allied Sci, 26(2), 82-92 Neves, M., Marinho-Dias, J., Ribeiro, J & Sousa H (2017) Epstein-Barr virus strains and variations: Geographic or disease-specific variants? J Med Virol, 89(3), 373-387 Pathmanathan, R., Prasad, U., Sadler, R., Flynn, K & Raab-Traub, N (1995) Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma N Engl J Med, 333, 693698 Sandvej, K., Zhou, X G & Hamilton-Dutoit, S (2000) EBNA-1 sequence variation in Danish and Chinese EBVassociated tumours: evidence for geographical polymorphism but not for tumour-specific subtype restriction J Pathol, 191(2), 127-131 Sham, J S., Wei, W I., Zong, Y S., Choy, D., Guo, Y Q., Luo, Y.,… Ng, M H (1990) Detection of subclinical nasopharyngeal carcinoma by fibreoptic endoscopy and multiple biopsy Lancet, 335, 371-374 58 Lao Duc Thuan et al Journal of Science Ho Chi Minh City Open University, 7(2), (51-58) Snudden, D K., Smith, P R., Lai, D., Ng, M H & Griffin, B E (1995) Alterations in the structure of the EBV nuclear antigen, EBNA1, in epithelial cell tumours Oncogene, 10(8), 1545-1552 Wang, W Y., Chien, Y C., Jan, J S., Chueh, C M & Lin, J C (2002) Consistent sequence variation of EpsteinBarr virus nuclear antigen in primary tumor and peripheral blood cells of patients with nasopharyngeal carcinoma Clin Cancer Res, 8(8), 2586-2590 Wang, X., Liu, X., Jia, Y., Chao, Y., Xing, X., Wang, Y & Luo, B (2010) Widespread sequence variation in the Epstein-Barr virus latent membrane protein 2A gene among northern Chinese isolates J Gen Virol, 91(Pt 10), 2564-2573 Wang, Y., Liu, X., Xing, X., Cui, Y., Zhao, C & Luo, B (2010) Variations of Epstein-Barr virus nuclear antigen gene in gastric carcinomas and nasopharyngeal carcinomas from Northern China Virus Res, 147(2), 258-264 Zhang, X S., Wang, H H., Hu, L F., Li, A., Zhang, R H., Mai, H Q., … Zeng, Y X (2004) V-val subtype of Epstein-Barr virus nuclear antigen preferentially exists in biopsies of nasopharyngeal carcinoma Cancer Lett, 211(1), 11-8 Ngo Dong Kha et al Journal of Science Ho Chi Minh City Open University, 8(1), 51-57 51 THE INITIAL STUDY OF EBNA-2 POLYMORPHISMS IN NASOPHARYNGEAL CARCINOMA IN VIETNAM NGO DONG KHA University of Science, Vietnam National University Ho Chi Minh City HUYNH THỊ MONG TUYEN, LAM HONG NGOC, THIEU HONG HUE LE QUANG ANH TUAN, LAO DUC THUAN, LE HUYEN AI THUY Ho Chi Minh City Open University, Vietnam – thuy.lha@ou.edu.vn (Received: February 06, 2018; Revised: March 14, 2018; Accepted: April 16, 2018) ABSTRACT Epstein-Barr virus (EBV) infection is the main cause of Nasopharyngeal Carcinoma (NPC) EBNA-2, one of the most important genes participating in the formation of NPC, also helps EBV evade an attack on the immune system EBNA-2 has variants including E2-A, E2-B, E2-C and E-2D, of which E2-A and E2-C are the characterized variants for NPC This study aimed to evaluate the variations of EBNA-2 in NPC biopsy samples of Vietnamese patients This initial study used 10 biopsy samples, which were positively confirmed to NPC, collected from Cho Ray Hospital Nested PCR – nucleotide sequencing was applied to analyze the variants of EBNA-2 The results showed that out of 10 samples, accounting for 80%, were positive to EBNA-2 Additionally, only two variants, E-2A and E-2C were detected in our study, in which, E2-A subtype was identified as the predominant subtype These findings would provide initial data about potential contribution of EBNA-2 polymorphisms to etiology of NPC in Vietnamese population Keywords: E-2A; E-2C; EBNA-2; Nasopharyngeal carcinoma; SNPs Introduction Nasopharyngeal carcinoma (NPC) is a human malignant disease derived from epithelial cells There is a striking, geographic and ethnic distribution of this disease which is common in Southern China, Southern Asia (Pathmanathan et al., 1995; McDermott et., 2001; da Costa et al., 2015; Dai et al., 2016) According to Globocan, NPC is considered one of the five most common cancers in men in Vietnam in 2012, of which the number of infected cases is 3,301 (ASR = 7.7/100,000 cases) and of mortality cases is 1,931 (ASR = 4.8/100,000 cases) Besides, there were 1,630 infected cases (ASR = 3.4/100,000 cases) and 954 mortality cases (ASR = 2/100,000 cases) in women Previous studies showed that major etiological factors proposed for NPC pathogenesis have been significant to the EBV infection (Lo et al., 2004; Tsao et al., 2014; Yang et al., 2005) EBV, also known as human herpes virus 4, a member of Herpesviridae family, has been proven to be significantly associated to many human cancers such as burkitt's lymphoma, gastric carcinoma, nasopharyngeal carcinoma, and so on (Lo et al., 2004; Tsao et al., 2014) Understanding the role of EBV latent genes is essential for identifying the mechanism underlying EBV-induced cell transformation and immune evasion (Ko, 2015) Among them, EBNA-2 has been shown to be essential for the infection of EBV and existed in the cellular Numerous studies have long been trying to identify NPC-specific EBV subtypes based on the sequence variation of EBNA-2 to display a characteristic geographical prevalence and distribution The EBNA-2 polymorphism was classified into four subtypes including E2-A, E2-B, E2-C and E2D To the best of our knowledge, there has been no research on the classification of 52 Ngo Dong Kha et al Journal of Science Ho Chi Minh City Open University, 8(1), 51-57 EBNA-2 subtype in Vietnamese population This study, therefore, aims to analyze NPC biopsy samples collected from Vietnamese NPC patients for the first time to examine whether there is a remarkable association between certain EBNA-2 subtypes and NPC from distinct geographical location Materials and method 2.1 Ethics statement Institutional Ethics Board approval was obtained from the Medical Ethics Committee of the Cho Ray Hospital, Ho Chi Minh City, Vietnam The permit from Ethical committee was under decision number 516/BVCRHDDD, Cho Ray Hospital, Ho Chi Minh City, Vietnam All the samples used in this study were agreed by Cho Ray Hospital and obtained from all participants in this clinical trial 2.2 Sample collection 10 NPC tumor biopsies were collected with informed consent from NPC patients at Cho Ray hospital All samples were submitted to histopathological department and then, proved histologically to have NPC by hematoxylin and eosin examination Total genomic DNA extraction was isolated from biopsy samples by using Phenol/chloroform method The samples were lysed in lysis buffer (10 mM Tris-HCl pH = 8, 10 mM EDTA, 150 mM NaCl, 2% SDS) containing Proteinase K (0.1 mg/ml) Then, total genomic DNA extraction was isolated and purified by using standard phenol-chloroform and ethanol precipitation The quality and purity of DNA extraction were measured by the evaluation of A260/A280 proportion Then, the DNA solution was store at EDTA 0.5M, 20oC for PCR assay 2.3 Nested – Polymerase Chain Reaction assay (Nested – PCR) Nested – PCR and direct sequencing were used to detect the sequence of EBNA-2 The primers of stage (outer primer) and stage (internal primer) were shown in Table Total volume reaction is 15 μl containing μl DNA isolation (for stage 1) or μl PCR product of stage (for stage 2), 0.75 unit iTaq DNA polymerase, 0.5 μl each primer, 7.5 μl MyTaqTM Mix and water up to 15 μl Thermal cycling was set up at 95oC for minutes, followed by 35 cycles of denaturation at 95oC for 30 seconds, annealing at the 55oC for 30 seconds, extension at 72oC for 30 seconds, and a final extension at 72oC for 10 Finally, The PCR products were expressed by electrophoresis on 2% agarose gel and DNA was dyed with ethidium bromide Table The primer sequences used in this study Region Stage EBNA2-A (163-294) EBNA2-C (357-486) Primer Sequence (3’ – 5’) E2A-OF GCTATGCGAATGCTTTGG E2A-OR GAGTCTTAGAGGGTTGCG E2A-IF CTATGCGAATGCTTTGGA E2A-IR TTGTTGGTCGTTGATGAC E2C-OF AGAACCACGGTCCCCGACTGTA E2C-OR TGCTGAGAGCAAGGCACCAATT E2C-IF ACGGTCCCCGACTGTATTTTAT E2C-IR TTTTGGCAAGCCTTCCTT Ref (Wang et al., 2012) Ngo Dong Kha et al Journal of Science Ho Chi Minh City Open University, 8(1), 51-57 Results and Discussion 3.1 Sequence variation data of EBNA-2 in NPC biopsy samples In this study, nested-PCR was used to amplify the target sequence As a result, out of 10 samples, accounting for 80%, were 53 positive to EBNA-2, which yielded a PCR product of 551 bps-band and 788 bps-band as shown in Figure The amplification of EBNA-2 fragments, including EBNA-2A and EBNA-2C, was determined by Sanger sequencing as shown in Figure Figure Agarose gel electrophoresis of the PCR products of representative NPC biopsy samples N: negative control Ladder: 100 bps Figure Sequence determination of EBNA-2A of representative NPC biopsy samples by Sanger sequencing Table Variant positions of EBNA-2 Sub types E2-A Amino Acid 151 160 163 165 185 195 200217 201 Self-association domain WT ATT Ile CCT Pro AGG Arg GTC Val CAA Gln ATG Met 51 nucleotide 18 a.a ACC Thr T79 G Met C + GTVal A + -GArg -CThr * T + T80 G Met C + GTVal A + -GArg * Del * T86 G Met C + GTVal A + -GArg -CThr * T + 54 Ngo Dong Kha et al Journal of Science Ho Chi Minh City Open University, 8(1), 51-57 Sub types Amino Acid 160 163 165 185 195 200217 201 Self-association domain WT ATT Ile CCT Pro AGG Arg GTC Val CAA Gln ATG Met 51 nucleotide 18 a.a ACC Thr T90 G Met * GTVal A + -GArg * Del * T91 G Met C + GTVal A + -GArg -CThr * T + T97 G Met * GTVal A + -GArg -CThr Del * T93 * * -TMet A + * * * * T94 * * -TMet A + * * * * 237 241 E2-C Sub types 151 Amino Acid 245 246 279 280 357 358 NLS WT GAA Glu - CCA Pro CGC Arg CCG Pro ACT Thr CAA Lys GGG Gly T79 * CTC Leu -AGln T Ser A + -AAsn * * T80 -CAla * -AGln T Ser A + -AAsn * * T86 * CTC Leu -AGln T Ser A + -AAsn * * T90 -CAla * -AGln T Ser A + -AAsn * * T91 * CTC Leu -AGln T Ser A + -AAsn * * T97 -CAla * -AGln T Ser A + -AAsn * * T93 * * * * * * Del Del T94 * * * * * * Del Del E2A E2-C Ngo Dong Kha et al Journal of Science Ho Chi Minh City Open University, 8(1), 51-57 Sub types Amino Acid 370 383 417 NLS 470 476 486 490 TAD domain 496 55 509 - WT CCT Pro CCT Pro ACG Thr TCA Ser GAG Glu ATC Ile CCC Pro ACC Thr AAC Asn T79 A + * A + T + -GGly -CThr A-Thr * G-Asp T80 A + * A + T + -GGly -CThr A-Thr * G-Asp T86 A + * A + T + -GGly -CThr A-Thr * G-Asp T90 A + A + A + T + -GGly -CThr A-Thr * G-Asp T91 A + * A + T + -GGly -CThr A-Thr * G-Asp T97 A + A + A + T + -GGly -CThr A-Thr * G-Asp T93 A + * * * * * * -AAsn * T94 A + * * * * * * -AAsn * E2-A E2-C Note: (-) a position with the same nucleotide as Wild type sequence; (*) a position with the same amino acid as Wild type sequence; (+) a position with the same amino acid as Wild type on silent mutations, and (Del) a position with deleted amino acid EBNA-2 is one of the first latent proteins detected after an EBV infection and primarily upregulates the expression of viral and cellular genes As the functions of EBNA-2, it interacts with other transcription factors associated in the Notch signaling pathway (Henkel et al., 1995; Hsieh et al., 1996) The variants of EBNA-2 has evidently involved in the NPC carcinoma tumorigenesis According to previous studies on EBNA-2 gene polymorphisms in gastric carcinoma and NPCs, the variant of E-2A was significantly detected only in NPC and more important in the pathogenesis of NPC (Wang et al., 2012) As for the EBNA-2 protein structure, the three important domains for transcription regulation function of EBNA-2 including self- association domain (122–232 aa), transactivation domain (TAD; 431–487 aa) and nuclear localization signals (NLS; 244–378 aa, and 466–483 aa) (Cohen et al., 1991) were sequenced and analyzed in this study In detail, experimental samples of E2-A variants were divided into two distinct groups with group having the characteristic of the mutation loss of 51 bp at 49103 and group containing the three-nucleotide CTC insertion mutation at 49136 The DNA pattern of E-2A group subtype carried 11 amino acid changes at residue 151 (ATT:Ile  ATG:Met), 163 (AGG:Arg  GTG:Val), 186 (CAA:Gln  CGA:Arg), 237 (GAA:Glu  GCA:Ala), 245 (CCA:Pro  CAA:Gln), 246 (CGC:Arg  56 Ngo Dong Kha et al Journal of Science Ho Chi Minh City Open University, 8(1), 51-57 CGT:Ser), 280 (ACT: Thr  AAT: Asn), 476 (GAG:Glu  GGG:Gly), 486 (ATC:Ile  ACC:Thr), 490 (CCC:Pro  ACC:Thr), 509 (AAC:Asn  GAC:Asp) and one deletion at 200-217 (Del), represented by T80 sequence The second pastern of group 2, which was represented by T69, carried 11 amino acid changes at residue 151 (ATT:Ile  ATG:Met), 163 (ACG:Arg  GTG:Val), 185 (CAA:Gln  CGA:Arg), 195 (ATG:Met  ACG:Thr), 245 (CCA:Pro  CAA:Gln), 246 (CGC:Arg  CGT:Ser), 280 (ACT:Thr  AAT: Asn), 476 (GAG:Glu  GGG:Gly), 468 (ATC:Ile  ACC:Thr), 490 (CCC:Pro  ACC:Thr), 509 (AAC:Asn  GAC:Asp) and one insertion in 241 (CTC: Leu) In this study, the variants E2A was identified as the predominant subtype in our samples, which was also characterized as the frequent subtype in other Asian regions such as Hong Kong (KwoK et al., 2014) and southern China (Wu et al., 2015) Conclusion In conclusion, this study described the subtypes of EBNA-2 polymorphisms in Vietnamese NPC biopsy samples, including E-2A and E-2C Of the EBNA-2 subtypes, E-2A was the most prevalent EBNA-2 subtype in Vietnamese patients, in which two different patterns were identified Considering the shortcomings of this work, our finding provided the initial data for the potential contribution of EBNA-2 polymorphisms to etiology of endemic NPC in Vietnamese population Larger number and direct comparison of various sample sources such as throat washing should be included in future research It will be very useful to indicate the sample type specificity of genotyping changes to apply in genetic screening of NPC in Vietnamese population Acknowledgements We wish to express our sincere thanks to the research project sponsored by Ho Chi Minh City Open University We are grateful to all recruited participants in this work and all staff members of Otorhinolaryngology in Cho Ray Hospital, Ho Chi Minh City for collecting the samples used in this study References Da Costa, V G., Marques-Silva, A C & Moreli, M L (2015) The Epstein-Barr virus latent membrane protein-1 (LMP1) 30-bp deletion and XhoI-polymorphism in nasopharyngeal carcinoma: a meta-analysis of observational studies Syst Rev 13, 46 Dai, W., Zheng, H., Cheung, A K & Lung, M L (2016) Genetic and epigenetic landscape of nasopharyngeal carcinoma Chin Clin Oncol, 5(2), 16-28 Henkel, T., Ling, P.D., Hayward, S.D., Peterson, M.G (1994) Mediation of Epstein-Barr virus EBNA2 transactivation by recombination signal binding protein J kappa Science, 265, 92–95 Hsieh, J.J., Henkel, T., Salmon, P., Robey, E., Peterson, M.G., Hayward, S.D (1996) Truncated mammalian Notch1 activates CBF1/RBPJk-repressed genes by a mechanism resembling that of Epstein-Barr virus EBNA2 Mol Cell Biol, 16, 952–959 Ko YH (2015) EBV and human cancer Exp Mol Med 47: e130 Kwok, H., Wu, C.W., Palser, A.L., Kellam, P., Sham, P.C., Kwong, D.L., Chiang, A.K (2014) Genomic diversity of Epstein-Barr virus genomes isolated from primary nasopharyngeal carcinoma biopsy samples J Virol, 88, 10662–10672 Ngo Dong Kha et al Journal of Science Ho Chi Minh City Open University, 8(1), 51-57 57 Lo, K.W., To, K.F., Huang, D.P (2004) Focus on nasopharyngeal carcinoma Cancer Cell, 5, 423–428 McDermott, A L., Dutt, S N & Watkinson, J C (2001) The aetiology of nasopharyngeal carcinoma Clin Otolaryngol Allied Sci, 26(2), 82-92 Pathmanathan, R., Prasad, U., Sadler, R., Flynn, K & Raab-Traub, N (1995) Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma N Engl J Med, 333, 693-698 Tsao, S.W., Yip, Y.L., Tsang, C.M., Pang, P.S., Lau, V.M., Zhang, G., Lo, K.W (2014) Etiological factors of nasopharyngeal carcinoma Oral Oncol, 50, 330–338 Wang, X., Wang, Y., Wu, G., Chao, Y., Sun, Z., and Luo, B (2012) Sequence analysis of Epstein-Barr virus EBNA-2 gene coding amino acid 148-487 in nasopharyngeal and gastric carcinomas Virol J, 9, 49 Wu, G., Liu, X., Liu, S., Shu, J., Sun, Z and Luo, B (2015) Epstein-Barr Virus EBNA-2 Polymorphic Patterns in Nasopharyngeal Carcinoma in Southern China Intervirology, 58, 386–392 Yang, X.R., Diehl, S., Pfeiffer, R., Chen, C.-J., Hsu, W.-L., Dosemeci, M., Cheng, Y.-J., Sun, B., Goldstein, A.M., Hildesheim, A., et al (2005) Evaluation of risk factors for nasopharyngeal carcinoma in high-risk nasopharyngeal carcinoma families in Taiwan Cancer Epidemiol Biomark Prev Publ Am Assoc Cancer Res Cosponsored Am Soc Prev Oncol, 14, 900 – 905 SẢN PHẨM ĐÀO TẠO 1- Tham gia đào tạo Tiến Sĩ – Công Nghệ Sinh Học 2- Tham gia đào tạo Thạc Sĩ