Tạo protein endolysin tái tổ hợp từ thực khuẩn thể kháng aeromonas hydrophila quy mô phòng thí nghiệm

TR IăH CăQU CăGIAăTP HCM NG I H C BÁCH KHOA NGUY NăT NăL C T O PROTEIN ENDOLYSIN TÁI T T H P TH C KHU N TH KHÁNG AEROMONAS HYDROPHILA QUY MỌ PHọNG THệ NGHI M Chuyênăngành:ăCôngăngh ăSinhăh c Mãăs :ă8420201 LU NăV NăTH CăS TP H ăCHÍ MINH, tháng 07 n mă2022 Cơngătrìnhăđ căhồnăthànhăt i: Tr ng i h c Bách Khoa ậ HQG-HCM Cánăb ăh ngăd năkhoaăh că1:ăPGS.TS Lê Phi Nga (Ghiărõăh ,ătên,ăh căhàm,ăh căv ăvàăch ăký) Cánăb ăh ngăd năkhoaăh că2:ăPGS.TS Hoàng Anh Hoàng (Ghiărõăh ,ătên,ăh căhàm,ăh căv ăvàăch ăký) Cánăb ăch mănh năxétă1: TS Nguy n Th L Th y (Ghiărõăh ,ătên,ăh căhàm,ăh căv ăvàăch ăký) Cánăb ăch mănh năxétă2: TS Ph m Th Kim Trâm (Ghiărõăh ,ătên,ăh căhàm,ăh căv ăvàăch ăký) Lu năv năth căs ăđ căb oăv ăt iăTr ngă iăh căBáchăKhoa,ă HQG Tp HCM ngày 13 tháng 07 n mă2022 Thànhăph năH iăđ ngăđánhăgiáălu năv năth căs ăg m: (Ghiăărõăh ,ătên,ăh căhàm,ăh căv ăc aăH iăđ ngăch măb oăv ălu năv năth căs ) PGS.TS.ăNguy năThúyăH ngăậ Ch ăt ch PGS.TS.ăLêăTh ăTh yăTiên ậ Th ăký TS.ăNguy năTh ăL ăTh y ậ Ph năbi nă1 TS.ăPh măTh ăKim Trâm ậ Ph năbi nă2 PGS.TS Lê Phi Nga ậ U ăviên Xácănh năc aăCh ăt chăH iăđ ngăđánhăgiáăLVăvàăTr ngăKhoaăqu nălýă chuyênăngànhăsauăkhiălu năv n đ căs aăch aă(n uăcó) CH T CH H I NG PGS.TS.ăNguy năThúyăH ng TR NG KHOA TR IăH CăQU CăGIAăTP.HCM NG I H C BÁCH KHOA C NG HọA Xẩ H I CH NGH A VI T NAM c l p - T - H nh phúc NHI M V LU N V N TH C S H ătênăh căviên:ăăNguy năT năL c MSHV: 1970005 Ngày,ătháng,ăn măsinh:ă19/12/1996 N iăsinh:ăPhúăYên Chuyên ngành:ăCôngăngh ăSinhăh c Mãăs :ă8420201 I TểN TẨI: T oă proteină endolysină táiă t ă h pă t ă th că khu nă th ă khángă Aeromonas hydrophila quyămơăphịngăthíănghi m (Cloning, expression and purification of the recombinant bacteriophage-derived endolysin protein against Aeromonas hydrophila) II NHI M V VẨ N I DUNG: - T oă dòng,ă bi uă hi nă endolysină cell wall hydrolase táiă t ă h pă t ă th că khu nă th ă PVN02 trongăt ăbàoăbi uăhi năE coli BL21 (DE3) - Kh oăsátăho tătínhăkháng viăkhu năAeromonas hydrophila c aăendolysinătáiăt ăh p III NGẨY GIAO NHI M V : 14/02/2022 IV NGẨY HOẨN THẨNH NHI M V : 06/06/2022 V CÁN B H NG D N (Ghi rõ h c hƠm, h c v , h , tên): PGS.TS Lê Phi Nga PGS.TS Hoàng Anh Hoàng Tp HCM, ngày CÁN B H NG D N CH NHI M B (H ătênăvàăch ăký) tháng MỌN ẨO T O (H ătênăvàăch ăký) PGS.TS Lê Phi Nga TR NG KHOA (H ătênăvàăch ăký) n m 2022 i L IC M N Th i gian h c t p làm lu năv năt i B môn Công ngh Sinh h c, Khoa K thu t Hóa h c,ăTr ng i h c Bách Khoa ậ HQG TP H ChíăMinhăđãăđ l i nhi u k ni măđ p nh ng kinh nghi măquýăbáu.ă tôiăđã nh n đ hoànăthànhăđ tài này, c r t nhi u s giúpăđ t Th y Cô, anh ch , b n, em c giaăđình uătiên,ăemăxinăđ c g i l i c mă năvà lòng bi tă năchân thành nh tăđ n Cô PGS.TS Lê Phi Nga Th y PGS.TS Hồng Anh Hồng Th y Cơăđã đ nhăh c u, t n tìnhăh ng nghiên ng d n, s n lòng giúp đ ,ăđ ng viên h tr em r t nhi u đ em hoàn thành t tăđ tài c a Em xin c mă nă đ n Th y Cô gi ng d y Cao h c ngành Công ngh Sinh h c, Tr ngă i h c Bách Khoa ậ HQGăTP.ăH Chí Minh Quý Th yăCôăđã gi ng d y truy năđ t nh ng ki n th c, kinh nghi m quý báu làm n n t ng v ng ch căđ em có th hồn thành t t vi c h c c ngănh ăcơngăvi c c a Bên c nhăđó, tơi xin g i l i c mă n đ n t t c thành viên t i phịng thí nghi m 107B2 ln h tr , giúpăđ , t oăđi u ki n thu n l iăđ tơi hồn thành t tăđ tài Cu i c̀ng, xin g i l i c mă năđ n ba m vàăgiaăđình C mă năc nhàăđãăln bên c nh, ni măđ ng l c to l n, giúp conăv t qua m i khó kh năvàăcóăđ c ngày hơm Kính chúc q th y cô, anh ch , b n, em giaăđìnhăln d i s c kh e, h nh phúc g t hái đ c nhi u thành cơng cu c s ng! TP H Chí Minh, tháng 07 n m 2022 H c viên Nguy n T n L c ii TÓM T T LU N V N TH C S B nh xu t huy t cá tra vi khu n Aeromonas hydrophila gây ra, làm thi t h i l n v kinh t choăng i nuôi Các ch tăkhángăsinhăth ngăđ c s d ngăđ u tr b nh này, nhiên s kháng kháng sinh c a vi khu n A hydrophila nên r t c n thi tăđ nghiên c u tác nhân kháng khu n m iăđ thay th ch t kháng sinh Endolysin enzyme phân c t peptidoglycan c a thành t bào vi khu n đ t ng h p c giaiăđo n cu i trình chép c a phage tan, chúng ly gi i thành t bào vi khu n ch gi i phóng phage m i Trong nghiên c u này, endolysin cell wall hydrolase có ngu n g c t phage PVN02 xâm nhi m vi khu n A hydrophila đãă đ c t ng h p gene t o dịng thành cơng t bào E coli BL21 (DE3) Endolysin cell wall hydrolase PVN02 tái t h p d ng thô th hi n ho t tính kháng vi khu n A hydrophila v i làm gi m 1.83±0.17 log CFU/ml vi khu n sau 60 phút Ngoài ra, endolysin tái t h p có ho t tính kháng A hydrophila mà không c n s d ng ch t th m màng t bào vi khu n K t qu nghiên c u ti năđ cho nghiên c u endolysin tái t h p ti p theo ABSTRACT Hemorrhagic septicemia disease in striped catfish is caused by Aeromonas hydrophila bacteria that may lead to the seriously economic losses in fish production Antibiotics are commonly used to treat this disease, however, due to antibiotic resistance in A hydrophila, it is necessary to have an alternative antibacterial agent to antibiotics Endolysins are bacteriophage-encoded peptidoglycan hydrolases that are synthesized at the end of the lytic phage replication cycle, they lyse the host bacterial cell wall and release new bacteriophage virions In this study, an endolysin (cell wall hydrolase) derived from Aeromonas phage PVN02 was artificially synthesized and cloned successfully in E coli BL21 (DE3) cells The crude recombinant endolysin, cell wall hydrolase strongly exhibited antimicrobial activity against A hydrophila with a reduction of 1.83±0.17 log CFU/ml of A hydrophila after 60 minutes of incubation It should be emphasized that the antibacterial activity by the recombinant endolysin to A hydrophila bacteria did not require a pretreatment iii with an outer-membrane permeabilizer The result in this study is the premise for further recombinant endolysin studies iv L I CAM OAN Tơiăxinăcamăđoanăđâyălàăcơng trình nghiên c u c a tơi v i s h ng d n khoa h c c a Cơ PGS.TS Lê Phi Nga Th y PGS.TS Hồng Anh Hoàng Các n i dung, k t qu nghiên c u trung th căvàăch aăđ c cơng b cơng trình khác Các thơng tin tham kh o, trích d n lu năv năđ uăđ c ghi rõ thích ngu n g c rõ ràng ph n tài li u tham kh o Tơi xin hồn tồn ch u trách nhi m v camăđoanănày TP H Chí Minh, tháng 07 n m 2022 H c viên th c hi n Nguy n T n L c v M CL C L IC M N i TÓM T T LU N V N TH C S ii L I CAM OAN iv M C L C v DANH M C HÌNH NH viii DANH M C B NG BI U .x DANH M C CÁC CH CH NG M VI T T T xi U .1 1.1 Lý ch n đ tài 1.2 M c tiêu nghiên c u .3 1.3 it ng ph m vi nghiên c u 1.4 N i dung nghiên c u 1.5 ụ ngh a khoa h c th c ti n c a đ tài .3 CH NG T NG QUAN TÀI LI U 2.1 T ng quan v vi khu n Aeromonas hydrophila b nh xu t huy t cá tra 2.2 Th c khu n th li u pháp th c khu n th 2.2.1 Th c thu n th 2.2.2 Li u pháp th c khu n th 2.2.3 Aeromonas phage PVN02 2.3 T ng quan v endolysin 10 2.3.1 Gi i thi u endolysin phân lo i 10 2.3.2 C u trúc endolysin 11 vi 2.3.3 C ch ho t đ ng c a endolysin kháng vi khu n gây b nh Gram d ng 11 2.3.4 ng d ng c a endolysin kháng vi khu n Gram âm .12 2.3.5 S đ kháng endolysin 13 2.3.6 ng d ng c a endolysin 13 2.4 Tình hình nghiên c u th gi i vƠ n CH NG V T LI U VẨ PH c 16 NG PHÁP NGHIểN C U .20 3.1 Th i gian vƠ đ a m nghiên c u .20 3.2 V t li u nghiên c u .20 3.2.1 Ch ng vi sinh v t, plasmid 20 3.2.2 Môi tr ng, hóa ch t, v t li u 20 3.2.3 Thi t b , d ng c 21 3.3 Ph ng pháp nghiên c u .21 3.3.1 S đ nghiên c u 21 3.3.2 Phân tích trình t endolysin cell wall hydrolase 23 3.3.3 T i u hóa codon gene endolysin cell wall hydrolase 23 3.3.4 T o dòng gene endolysin cell wall hydrolase .24 3.3.5 Tách chi t plasmid gi i trình t .26 3.3.6 Bi u hi n endolysin tái t h p t bào E coli BL21 (DE3) 27 3.3.7 Thu h i endolysin tái t h p b ng c t Ni-NTA 28 3.3.8 Kh o sát ho t tính kháng vi khu n Aeromonas hydrophila c a d ch endolysin tái t h p thô 29 3.3.9 CH l p l i vƠ ph ng pháp x lý s li u .30 NG K T QU VÀ TH O LU N 31 4.1 K t qu phân tích trình t endolysin t i u hóa gene endolysin 31 vii 4.2 K t qu t o vector bi u hi n mang gene endolysin tái t h p 34 4.3 K t qu bi u hi n endolysin tái t h p t bào E coli BL21(DE3) 37 4.3.1 K t qu bi u hi n endolysin c m ng b ng IPTG 37 4.3.2 K t qu bi u hi n endolysin c m ng b ng lactose 38 4.4 K t qu thu h i endolysin tái t h p b ng c t Ni-NTA 39 4.5 K t qu kh o sát ho t tính kháng vi khu n Aeromonas hydrophila c a d ch endolysin tái t h p thô .40 CH NG K T LU N VÀ KI N NGH 44 5.1 K t lu n 44 5.2 Ki n ngh 44 TÀI LI U THAM KH O 45 47 [23] D Lebeaux, J Ghigo and C Beloin, "Biofilm-related infections: bridging the gap between clinical management and fundamental aspects of recalcitrance toward antibiotics," Microbiol Mol Biol Rev, vol 78, no 3, pp 510-543, 2014 [24] W Cai and C Arias, "Biofilm formation on aquaculture substrates by selected bacterial fish pathogens," J Aquat Anim Health, vol 29, no 2, pp 95-104, 2017 [25] C Hall and T Mah, "Molecular mechanisms of biofilm-based antibiotic resistance and tolerance in pathogenic bacteria," FEMS Microbiol Rev, vol 41, no 3, pp 276-301, 2017 [26] J Liu, S Gao, Y Dong, C Lu and Y Liu, " Isolation and characterization of bacteriophages against virulent Aeromonas hydrophila," BMC Microbiol, vol 20, p 141, 2020 [27] M Henry and L Debarbieux, "Tools from viruses: bacteriophage successes and beyond," Virology, vol 434, no 2, pp 151-161, 2012 [28] J Doss, K Culbertson, D Hahn, J Camacho and N Barekzi, "A Review of Phage Therapy against Bacterial Pathogens of Aquatic and Terrestrial Organisms," Viruses 2017, 9, 50, vol 9, no 3, p 50, 2017 [29] J R Penadés, J Chen, N Quiles-Puchalt, N Carpena and R P Novick, "Bacteriophage-mediated spread of bacterial virulence genes," Current Opinion in Microbiology, vol 23, pp 171-178, 2015 [30] P García, L Rodríguez, A Rodríguez and B Martínez, "Food biopreservation: promising strategies using bacteriocins, bacteriophages and endolysins," Trends in Food Science & Technology, vol 21, no 8, pp 373-382, 2010 [31] G P Salmond and P C Fineran, "A century of the phage: past, present and future," Nature Reviews Microbiology, vol 13, pp 777-786, 2015 [32] I U Haq, W N Chaudhry, M N Akhtar, S Andleeb and I Qadri, "Bacteriophages and their implications on future biotechnology: a review," Virology Journal, vol 9, no 9, pp 1-8, 2012 [33] X Wittebole, S D Roock and S M Opal, "A historical overview of bacteriophage therapy as an alternative to antibiotics for the treatment of bacterial pathogens," Virulence, vol 5, no 1, pp 226-235, 2014 [34] A Sulakvelidze, Z Alavidze and J G M Jr., "Bacteriophage Therapy," Antimicrob Agents Chemother, vol 45, no 3, pp 649-659, 2001 [35] S Parasion, M Kwiatek, R Gryko, L Mizak and A Malm, "Bacteriophages as an alternative strategy for fighting biofilm development," Polish Journal of Microbiology, vol 63, no 2, pp 137-145, 2014 [36] M Schmelcher and M J Loessner, "Application of bacteriophages for detection of foodborne pathogens," Bacteriophage, vol 4, no 1, p e28137, 2014 48 [37] T Nakai, "Application of bacteriophages for control of infectious diseases in aquaculture," in Bacteriophages in the control of food- and waterborne pathogens, 1st ed., P M Sabour and M W Griffiths, Ed Washington DC: American Society for Microbiology Press, 2010, pp 257-272 [38] J Oliveira, F Castilho, A Cunha and M Pereira, "Bacteriophage therapy as a bacterial control strategy in aquaculture," Aquaculture International , vol 20, pp 879-910, 2012 [39] D R Roach and D M Donovan, "Antimicrobial bacteriophage-derived proteins and therapeutic applications," Bacteriophage, vol 5, no 3, p e1062590, 2015 [40] K H Schleifer and O Kandler, "Peptidoglycan types of bacterial cell walls and their taxonomic implications," Bacteriology reviews, vol 36, no 4, pp 407477, 1972 [41] J Ajuebor, O McAuliffe, J O'Mahony, R Ross, C Hill and A Coffey, " Bacteriophage endolysins and their applications," Science progress, vol 99, no 2, pp 183-199, 2016 [42] H Oliveira, L D R Melo, S B Santos, F L Nóbrega, E C Ferreira, N Cerca, J Azeredo and L D Kluskens, "Molecular Aspects and Comparative Genomics of Bacteriophage Endolysins," Journal of Virology, vol 87, pp 4558-4570, 2013 [43] H Oliveira, J Azeredo, R Lavigne and L D Kluskens, "Bacteriophage endolysins as a response to emerging foodborne pathogens," Trends in Food Science & Technology, vol 28, pp 103-115, 2012 [44] Y Briers, M Schmelcher, M J Loessner, J Hendrix, Y Engelborghs, G Volckaert and R Lavigne, "The high-affinity peptidoglycan binding domain of Pseudomonas phage endolysin KZ144," Biochemical and Biophysical Research Communications, vol 383, pp 187-191, 2009 [45] Y Chang, "Bacteriophage-derived endolysin applied as potent biocontrol agents to enhance food safety," Microorganisms, vol 8, no 724, pp 1-11, 2020 [46] I N Wang, D L Smith and R Young, "Holins: the protein clocks of bacteriophage infections," Annual review of microbiology, vol 54, pp 799-825, 2000 [47] B Son, J Yun, J A Lim, H Shin, S Heu and S Ryu, "Characterization of LysB4, an endolysin from the Bacillus cereus-infecting bacteriophage B4," BMC microbiology, vol 12, no 33, pp 1-9, 2012 [48] J Bai, E Yang, P.-S Chang and S Ryu, "Preparation and characterization of endolysin-containing liposomes and evaluation of their antimicrobial activities against gram-negative bacteria," Enzyme and Microbial Technology, vol 128, pp 40-48, 2019 49 [49] Y Briers and R Lavigne, "Breaking barriers: expansion of the use of endolysins as novel antibacterials against Gram-negative bacteria," Future microbiology, vol 10, no 3, pp 377-390, 2015 [50] Y Briers, M Walmagh, V Puyenbroeck, A Cornelissen, W Cenens, A Aertsen, H Oliveira, J Azeredo, G Verween, J Pirnay, S Miller, G Volckaert and R Lavigne, "Engineered Endolysin-Basedă “Artilysins”ă Toă Combată Multidrug-Resistant Gram-Negative Pathogens," mBio, vol 5, no 4, pp e01379-14, 2014 [51] J Lim, H Shin, S Heu and S Ryu, "Exogenous lytic activity of SPN9CC endolysin against gram-negative bacteria," Journal of Microbiology and Biotechnology, vol 24, no 6, pp 803-811, 2014 [52] A Martins, "Mechanisms of resistance in bacteria: An evolutionary approach," The Open Microbiology Journal, vol 7, no 1, pp 53-58, 2013 [53] J Loeffler, D Nelson and V A Fischetti, "Rapid killing of Streptococcus pneumoniae with a bacteriophage cell wall hydrolase," Science, vol 294, no 5549, p 2170-2172, 2001 [54] L Rodríguez-Rubio, B Martínez, A Rodríguez, D M Donovan, F Gưtz and P García, "The phage lytic proteins from the Staphylococcus aureus bacteriophage vB_SauS-phiIPLA88 display multiple active catalytic domains and not trigger staphylococcal resistance," PLoS One, vol 8, no 5, pp 1-7, 2013 [55] R Schuch, D Nelson and V A Fischetti, "A bacteriolytic agent that detects and kills Bacillus anthracis," Nature, vol 418, no 6900, pp 884-889, 2002 [56] V A Fischetti, "Bacteriophage lysins as effective antibacterials," Current Opinion in Microbiology, vol 11, no 5, pp 393-400, 2008 [57] P García, B Martínez, L Rodríguez and A Rodríguez, "Synergy between the phage endolysin LysH5 and nisin to kill Staphylococcus aureus in pasteurized milk," International Journal of Food Microbiology, vol 141, no 3, pp 151155, 2010 [58] Y Chang, M Kim and S Ryu, "Characterization of a novel endolysin LysSA11 and its utility as a potent biocontrol agent against Staphylococcus aureus on food and utensils," Food Microbiology, vol 68, pp 112-120, 2017 [59] H Zhang, H Bao, C Billington, J Hudson and R Wang, "Isolation and lytic activity of the Listeria bacteriophage endolysin LysZ5 against Listeria monocytogenes in soya milk," Food Microbiology, vol 31, pp 133-136, 2012 [60] D Nelson, L Loomis and V A Fischetti, "Prevention and elimination of upper respiratory colonization of mice by group A streptococci by using a bacteriophage lytic enzyme," Proceedings of the National Academy of Sciences of the United States of America, vol 98, no 7, pp 4107-4112, 2001 50 [61] P K Singh, D M Donovan and A Kumar, "Intravitreal injection of the chimeric phage endolysin Ply187 protects mice from Staphylococcus aureus endophthalmitis," Antimicrobial Agents and Chemotherapy, vol 58, no 8, pp 4621-4629, 2014 [62] W Zhang, Z Mi, X Yin, H Fan, X An, Z Zhang, J Chen and Y Tong, "Characterization of Enterococcus faecalis phage IME-EF1 and its endolysin," PLoS One, vol 8, no 11, p e80435, 2013 [63] M Pastagia, C Euler, P Chahales, J Fuentes-Duculan, J G Krueger and V A Fischetti, "A novel chimeric lysin shows superiority to mupirocin for skin decolonization of methicillin-resistant and -sensitive Staphylococcus aureus strains," Antimicrobial agents and chemotherapy, vol 55, no 2, pp 738-744, 2011 [64] J M Doehn, K Fischer, K Reppe, B Gutbier, T Tschernig, A C Hocke, V A Fischetti, J Löffler, N Suttorp, S Hippenstiel and M Witzenrath, "Delivery of the endolysin Cpl-1 by inhalation rescues mice with fatal pneumococcal pneumonia," Journal of Antimicrobial Chemotherapy, vol 68, no 9, pp 21112117, 2013 [65] M Harhala, D Nelson, P Miernikiewicz, R Heselpoth, B Brzezicka, J Majewska, S Linden, X Shang, A Szymczak, D Lecion, K Marek-Bukowiec, M.ă Kờak,ă B.ă Wojciechowicz,ă K.ă Lahutta,ă A.ă Koniecznyă andă K.ă D browska,ă "Safety Studies of Pneumococcal Endolysins Cpl-1 and Pal," Viruses, vol 10, no 11, p 638, 2018 [66] P Sanchez-Vizuete, B Orgaz, S Aymerich, D Le Coq and R Briandet, "Pathogens protection against the action of disinfectants in multispecies biofilms," Frontiers in Microbiology, vol 6, p 705, 2015 [67] M Otto, "Staphylococcal biofilms," Current topics in microbiology and immunology, vol 322, pp 207-228, 2008 [68] P Sass and G Bierbaum, "Lytic activity of recombinant bacteriophage phi11 and phi12 endolysins on whole cells and biofilms of Staphylococcus aureus," Applied and Environmental Microbiology, vol 73, no 1, pp 347-352, 2007 [69] D Gutiérrez, P Ruas-Madiedo, B Martínez, A Rodríguez and P García, "Effective removal of staphylococcal biofilms by the endolysin LysH5," PloS One, vol 9, no 9, p e107307, 2014 [70] S Y Jun, G M Jung, S J Yoon, M D Oh, Y J Choi, W J Lee, J C Kong, J G Seol and S H Kang, "Antibacterial properties of a pre-formulated recombinant phage endolysin, SAL-1," International Journal of Antimicrobial Agents, vol 41, no 2, pp 156-161, 2013 [71] S B Linden, H Zhang, R D Heselpoth, Y Shen, M Schmelcher, F Eichenseher and D C Nelson, "Biochemical and biophysical characterization 51 of PlyGRCS, a bacteriophage endolysin active against methicillin-resistant Staphylococcus aureus," Applied Microbiology and Biotechnology, vol 99, no 2, pp 741-752, 2015 [72] M Schmelcher, D M Donovan and M J Loessner, "Bacteriophage endolysins as novel antimicrobials," Future Microbiology, vol 7, no 10, pp 1147-1171, 2012 [73] J W Kretzer, R Lehmann, M Schmelcher, M Banz, K P Kim, C Korn and M J Loessner, "Use of high-affinity cell wall-binding domains of bacteriophage endolysins for immobilization and separation of bacterial cells," Applied and Environmental Microbiology, vol 73, no 6, pp 1992-2000, 2007 [74] M Kong, J Sim, T Kang, H H Nguyen, H K Park, B H Chung and S Ryu, "A novel and highly specific phage endolysin cell wall binding domain for detection of Bacillus cereus," European Biophysics Journal, vol 44, no 6, pp 437-446, 2015 [75] L Zermeño Cervantes, R Makarov, C Lomelí Ortega, S Martínez Díaz and C Cardona Félix, "Recombinant LysVPMS1 as an endolysin with broad lytic activity against Vibrio parahaemolyticus strains associated to acute hepatopancreatic necrosis disease.," Aquaculture Research, vol 43, pp 17231726, 2018 [76] N Lu, Y Sun, Q Wang, Y Qiu, Z Chen, Y Wen, S Wang and Y Song, "Cloning and characterization of endolysin and holin from Streptomyces avermitilis bacteriophage phiSASD1 as potential novel antibiotic candidates," International Journal of Biological Macromolecules, vol 147, pp 980-989, 2020 [77] H T H Nguy n, T H Khu tă,ăK.ă ăTr n , H T Lê, T T L Ph m and T T ng, "T o dòng bi u hi n enzyme endolysin tái t h p Escherichia coli t Staphylococcal bacteriophage," T p chí Khoa h c Cơng ngh Nơng nghi p Vi t Nam, vol 11, no 96, pp 37-41, 2018 [78] Y Yuan, X Li, L Wang, G Li, C Cong, R Li, H Cui, B Murtaza and Y Xu, "The endolysin of the Acinetobacter baumannii phage vB_AbaP_D2 shows broad antibacterial activity," Microbial biotechnology, vol 14, no 2, pp 403418, 2021 [79] J Lim, N Lee, H Chun and H Chang, "Characterization of a novel endolysin from bacteriophage infecting Vibrio parahaemolyticus, vB_VpaP_KF2.," Applied Biological Chemistry, vol 63, no 40, pp 1-5, 2020 [80] Y Larpin, F Oechslin, P Moreillon, G Resch, J Entenza and S Mancini, "In vitro characterization of PlyE146, a novel phage lysin that targets Gramnegative bacteria," PLoS One, vol 13, no 2, p e0192507, 2018 52 [81] D.ăT.ăT.ăB̀i,ăD.ă ăNguy n,ăK.ăD.ă inhă,ăT.ăH.ăNguy n, H M Nguy n and Q V.ă ng, "Nghiên c u bi u hi n th nghi m ho t tính kháng khu n c a lysin tái t h p t phage Staphylococcus aureus," T p chí Cơng ngh Sinh h c, vol 16, no 2, pp 345-351, 2018 [82] L Kelley, S Mezulis, C Yates, M Wass and M Sternberg, "The Phyre2 web portal for protein modeling, prediction and analysis," Nature Protocols, vol 10, pp 845-858, 2015 [83] F Blattner, G Plunkett, C Bloch, N Perna, V Burland, M Riley, J ColladoVides, J Glasner, C Rode, G Mayhew, J Gregor, N Davis, H Kirkpatrick, M Goeden, D Rose, B Mau and Y Shao, " The complete genome sequence of Escherichia coli K-12," Science, vol 277, no 5331, pp 1453-1462, 1997 [84] P Puigbò, I G Bravo and S Garcia-Vallve, "CAIcal: a combined set of tools to assess codon usage adaptation," Biology Direct, vol 3, no 8, pp 1-8, 2008 [85] S Schlegel, A Hjelm, T Baumgarten, D Vikstrom and J de Gier, "Bacterial based membrane protein production," Biochim Biophys Acta, vol 1843, no 8, pp 1739-1749, 2014 [86] Z.ăZhang,ăG.ă Kuipers,ă Ł.ăNiemiec,ăT.ăBaumgarten,ăD.ăJ.ăSlotboom,ă J.ă W.ădeă Gier and A Hjelm, "High-level production of membrane proteins in E coli BL21(DE3) by omitting the inducer IPTG," Microb Cell Fact, vol 14, no 142, pp 1-11, 2015 [87] D M Donovan and J Foster-Frey, "LambdaSa2 prophage endolysin requires Cpl-7-binding domains and amidase-5 domain for antimicrobial lysis of streptococci," FEMS microbiology letters, vol 287, no 1, pp 22-33, 2008 [88] F Khan, V Gondil, C Li, M Jiang, J Li, J Yu, H Wei and H A Yang, "Novel Acinetobacter baumannii Bacteriophage Endolysin LysAB54 With High Antibacterial Activity Against Multiple Gram-Negative Microbes," Frontiers in Cellular and Infection Microbiology, vol 11, p 70, 2021 [89] Genscript, "Genscript," [Online] Available: https://www.genscript.com/tools/codon-frequency-table [Accessed 07 04 2021] [90] H Fu, Y Liang, X Zhong, Z Pan, L Huang, H Zhang, Y Xu, W Zhou and Z Liu, "Codon optimization with deep learning to enhance protein expression," Scientific Reports, vol 10, no 1, p 17617, 2020 [91] Genscript, "Genscript," [Online] Available: https://www.genscript.com/tools/rare-codon-analysis [Accessed 07 04 2021] [92] J Hausjell, R Kutscha, J D Gesson, D Reinisch and O Spadiut, "The Effects of Lactose Induction on a Plasmid-Free E coli T7 Expression System," Bioengineering, vol 7, no 1, p 8, 2020 53 [93] R S Donovan, C W Robinson and B R Glick, "Review: optimizing inducer and culture conditions for expression of foreign proteins under the control of the lac promoter," Journal of industrial microbiology, vol 16, no 3, pp 145154, 1996 [94] Y Taguchi and H Schätzl, "Small-scale Triton X-114 Extraction of Hydrophobic Proteins," Bio-protocol, vol 4, no 11, p e1139, 2014 [95] S Kim, J Jin, Y Choi and J Kim, "LysSAP26, a New Recombinant Phage Endolysin with a Broad Spectrum Antibacterial Activity," Viruses, vol 12, no 11, p 1340, 2020 [96] S Kim, D W Lee, J S Jin and J Kim, "Antimicrobial activity of LysSS, a novel phage endolysin, against Acinetobacter baumannii and Pseudomonas aeruginosa," Journal of Global Antimicrobial Resistance, vol 22, pp 32-39, 2020 [97] C Ghose and C W Euler, "Gram-Negative Bacterial Lysins," Antibiotics, vol 9, no 2, p 74, 2020 [98] K Kim, M M Islam, D Kim, S H Yun, J Kim, J C Lee and M Shin, "CharacterizationăofăaăNovelăPhageă Ab1656-2 and Its Endolysin with Higher Antimicrobial Activity against Multidrug-Resistant Acinetobacter baumannii," Viruses, vol 13, no 9, pp 1-11, 2021 PH L C Hóa ch t, mơi tr STT ng Tên hóa ch t, mơi tr ng Thành ph n Trong 1L có: Mơiătr ng TSB (Himedia) (Soyabean Casein Digest Medium -Tryptone Soya Broth) Tryptone 17g Soya peptone 3g Sodium chloride 5g Dextrose (Glucose) 2.5g Dipotassium hydrogen phosphate 2.5g pH 7.3±0.2 Trong 1L có: Môiătr ng LB (Himedia) (Luria Bertani Broth, Miller) Tryptone 10g Yeast extract 5g Sodium chloride 10g pH 7.5±0.2 m Tris-HCl m ly gi i t bào mr a m elution (r a gi i) 20mM Tris-HCl, pH 8.0 20mM Tris-HCl, 150mM NaCl, 10mM imidazole, glycerol 10%, pH 8.0 20mM Tris-HCl, 150mM NaCl, 20mM imidazole, glycerol 10%, pH 8.0 20mM Tris-HCl, 150mM NaCl, 250mM imidazole, glycerol 10%, pH 8.0 SurecastTM Acryamide (40%): 2ml SurecastTM Resolving buffer: 2ml Running gel 10% N c c t: 3.9ml 10% SurecastTM APS: 80µL Thêm 8µL TEMED Stacking gel 4% SurecastTM Acryamide (40%): 0.3ml SurecastTM Stacking buffer: 0.75ml N c c t: 1.92ml 10% SurecastTM APS: 30µL Thêm 3µL TEMED Coomassie brilliant blue: 0.25g Methanol: 400ml Dung d ch nhu m Acetic acid: 70ml nh m c 1L b ngăn cc t Methanol: 400ml Dung d ch r a nhu m 10 Acetic acid: 70ml nh m c 1L b ngăn cc t Tris-HCl: 15,1g Glycine: 72g 5X Tank buffer 11 (Tris-HCl 0,125M; Glycine SDS: 5g 0,96M; SDS 0,5%; pH8,3) pH 8.3 nh m c 1L b ng n cc t Glycerol: 4ml Tris-HCl 1M (pH 6.8): 2.4ml SDS: 0.8g 2X Treatment buffer 12 Bromophenol blue: 4mg Beta mercaptoethanol: 0.5ml N c c t 3.1ml S li u k t qu đo OD600nm theo dõi trình c m ng bi u hi n endolysin b ng IPTG Th iăgiană (phút) L nă1 IPTG iă ch ng L nă2 IPTG 10 20 30 60 90 120 150 180 210 240 0.611 0.602 0.574 0.559 0.483 0.441 0.416 0.385 0.381 0.399 0.458 0.632 0.751 0.843 0.916 1.122 1.210 1.302 1.350 1.379 1.450 1.515 0.635 0.621 0.595 0.566 0.498 0.457 0.404 0.351 0.342 0.386 0.421 iă ch ng L nă3 IPTG iă ch ng 0.62 0.743 0.871 0.904 1.119 1.251 1.347 1.41 1.457 1.494 1.590 0.615 0.608 0.554 0.543 0.475 0.402 0.362 0.320 0.313 0.321 0.359 0.594 0.692 0.779 0.882 1.102 1.190 1.292 1.440 1.482 1.558 1.622 30 60 90 120 150 180 210 240 X lý s li u Th i gian (Phút) 10 20 IPTG 0.620± 0.610± 0.574± 0.556± 0.485± 0.433± 0.394± 0.352± 0.345± 0.369± 0.413± 0.013 0.010 0.021 0.012 0.012 0.028 0.028 0.033 0.034 0.042 0.050 i ch ng 0.615 0.729± 0.831± 0.901± 1.114± 1.217± 1.314± 1.400± 1.439± 1.501± 1.576± ±0.019 0.032 0.047 0.017 0.011 0.031 0.029 0.046 0.054 0.054 0.055 S li u k t qu đo OD600nm theo dõi trình c m ng bi u hi n endolysin b ng lactose Th iăgiană (phút) L nă1 0.5mM 1mM 2mM 5mM iă ch ng L nă2 0.5mM 1mM 2mM 5mM iă ch ng L nă3 0.5mM 1mM 2mM 5mM iă ch ng 15 30 60 90 120 150 180 210 240 0.687 0.623 0.602 0.786 0.787 0.717 0.715 0.833 0.926 0.870 0.864 0.946 1.080 1.024 1.054 1.020 1.096 1.108 1.080 1.004 1.164 1.154 1.140 1.000 1.156 1.106 1.108 0.972 1.128 1.082 1.062 0.960 1.096 1.038 1.052 0.922 1.080 1.046 1.028 0.896 0.694 0.822 0.960 1.100 1.192 1.266 1.360 1.396 1.500 1.558 0.625 0.633 0.671 0.645 0.761 0.752 0.794 0.758 0.808 0.816 0.856 0.86 1.008 1.013 1.028 1.031 1.145 1.148 1.187 1.154 1.229 1.238 1.247 1.188 1.267 1.275 1.24 1.148 1.289 1.28 1.236 1.096 1.27 1.266 1.232 1.094 1.291 1.285 1.246 1.074 0.654 0.816 0.832 1.042 1.234 1.317 1.41 1.513 1.589 1.712 0.658 0.631 0.644 0.674 0.741 0.780 0.733 0.770 0.897 0.923 0.890 0.898 1.051 1.074 1.041 1.057 1.115 1.110 1.087 1.059 1.201 1.174 1.158 1.031 1.169 1.148 1.132 1.020 1.155 1.140 1.124 0.984 1.121 1.100 1.108 0.964 1.102 1.067 1.058 0.935 0.685 0.810 0.961 1.095 1.187 1.305 1.384 1.447 1.574 1.686 X lý s li u Th iăgian (phút) 0.5mM 1mM 2mM 5mM iă ch ng 15 30 60 90 120 150 180 210 240 0.657± 0.031 0.629± 0.005 0.639± 0.035 0.702± 0.074 0.678± 0.021 0.763± 0.023 0.750± 0.032 0.747± 0.041 0.787± 0.040 0.816± 0.006 0.877± 0.061 0.870± 0.054 0.870± 0.018 0.901± 0.043 0.918± 0.074 1.046± 0.036 1.037± 0.033 1.041± 0.013 1.036± 0.019 1.079± 0.032 1.119± 0.025 1.122± 0.023 1.118± 0.060 1.072± 0.076 1.204± 0.026 1.198± 0.033 1.189± 0.044 1.182± 0.057 1.073± 0.101 1.296± 0.027 1.197± 0.061 1.176± 0.088 1.160± 0.070 1.047± 0.091 1.385± 0.025 1.191± 0.086 1.167± 0.102 1.141± 0.088 1.013± 0.073 1.452± 0.059 1.162± 0.094 1.135± 0.118 1.131± 0.092 0.993± 0.090 1.554± 0.048 1.158± 0.116 1.133± 0.132 1.111± 0.118 0.968± 0.094 1.652± 0.082 S li u k t qu th ho t tính ly gi i vi khu n A hydrophila c a d ch endolysin tái t h p năv CFU/ml Th iăgiană(phút) L nă1 10 20 30 60 Endolysin Buffer L nă2 5.2*10^7 3.2*10^7 2.2*10^7 3.1*10^6 6.0*10^5 5.0*10^5 7.4*10^7 9.7*10^7 1.0*10^8 1.1*10^8 1.0*10^8 8.6*10^7 Endolysin Buffer L nă3 7.1*10^7 5.1*10^7 2.8*10^7 1.2*10^7 6.4*10^6 1.1*10^6 1.4*10^8 1.3*10^8 1.4*10^8 1.4*10^8 1.3*10^8 1.5*10^8 Endolysin Buffer 4.2*10^7 3.0*10^7 2.5*10^7 1.1*10^7 1.4*10^6 9*10^5 9.8*10^7 1.1*10^8 1.0*10^8 1.2*10^8 1.1*10^8 1.2*10^8 Log CFU/ml vi khu n A hydrophila Th iăgiană(phút) L nă1 Endolysin Buffer L nă2 Endolysin Buffer L nă3 Endolysin Buffer X lý s li u 10 20 30 60 7.716 7.869 7.505 7.987 7.342 8.000 6.491 8.041 5.778 8.000 5.699 7.934 7.851 8.146 7.708 8.114 7.447 8.146 7.079 8.146 6.806 8.114 6.041 8.176 7.623 7.991 7.477 8.041 7.380 8.000 7.041 8.079 6.146 8.041 5.954 8.079 Log CFU/ml vi khu n A hydrophila Th iăgiană (phút) 10 20 30 60 Endolysin 7.730±0.115 7.563±0.126 7.390±0.053 6.870±0.329 6.243±0.521 5.898±0.178 Buffer 8.002±0.139 8.047±0.064 8.049±0.084 8.089±0.053 8.052±0.058 8.063±0.122 Tính s log CFU/ml vi khu n A hydrophila gi m Nghi măth căendolysin phút (log CFU/ml) 60 phút (log CFU/ml) S ălogăCFU/mlăgi m Trungăbìnhăs ălogăCFU/mlăgi m ±SD L nă1 7.716 5.699 2.017 nghi m th c endolysin L nă2 7.851 6.041 1.810 1.832 0.175 L nă3 7.623 5.954 1.669 Hình nh th ho t tính ly gi i vi khu n A hydrophila c a endolysin tái t h p thô b ng ph ng pháp đ m khu n l c phút phút 20 phút 30 phút 10 phút 60 phút Hình 5.1 Khu n l c vi khu n m cătrênăđ aă nghi m th c s d ng endolysin tái t h p thô (x105 CFU/ml) phút phút 10 phút 20 phút 30 phút 60 phút Hình 5.2 Khu n l c vi khu n m cătrênăđ aă nghi m th căđ i ch ng s d ngăđ m Tris-HCl (x106 CFU/ml) K t qu thô gi i trình t 6.1 K t qu gi i trình t sau t ng h p gene endolysin cell wall hydrolase 5'-CACCGGTTCGTCCGACGTTGTAAACGACGGCCAGTGAATTCGAGCTC GGTACCCGGATCCATGCAAAACATCATCAAAATCTTAGTAATTTTACTGA CTCTGAGCAGCTTTTCTTGCAAAGCAAGCGCGAACTTTGGCCCTATTAAT GACAACACCCTGGCCTATGTGCAGGCAGGCTACTACGAGGCCCGCGATG GTGGCCGCCTGGCGATGAAACTGGTGATGTCTGCCACCTATAACCGTGTT GTGGATGGTCGTTGGCCGCGTAGCGCGAAACGTGTGGTTTGGCAGAGCG GTCAGTATGCATGGACCGGTGGCCAGCGTCATCGTGCAAGCCTGTATCCG AAAGCAACCGCCCCGGCAGATCGCGCGGCGCTGGCGGAAGCCGTTTCTC TGGCGCGCTCTCTGCGTGCGGGCGATTGGGAACCGTCTATTAGCGCGAAC CATTTTCTGAGTCCGGGTGCGCTGAGTGGTCCGTTTCCGCGTTGGGCGCG TTGTACCGCCGCGCTGGCGGCCGAAGGTCGTTGTGTGAGTTATAAAGGTC AGAAAGTGCGTAGCCCGGATTTTACCTATAACGGCACCTGGTTCTATACC CTGTAAAAGCTTGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT GGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATA-3' Vùng highlight : Vùng trình t gene endolysin cell wall hydrolase 6.2 K t qu gi i trình t plasmid pET28a(+) mang gene endolysin cell wall hydrolase  K t qu gi i trình t thô chi u xuôi (Forward) 5'-TACATATGAACGGGAAGGGAGGATTTCCCYTCARAAATATTKTGTTT AACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATYATCATCATCAT CACRGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACT GGTGGACAGCAAATGGGTCGCGGATCCATGCAAAACATCATCAAAATC TTAGTAATTTTACTGACTCTGAGCAGCTTTTCTTGCAAAGCAAGCGCGA ACTTTGGCCCTATTAATGACAACACCCTGGCCTATGTGCAGGCAGGCTA CTACGAGGCCCGCGATGGTGGCCGCCTGGCGATGAAACTGGTGATGTCT GCCACCTATAACCGTGTTGTGGATGGTCGTTGGCCGCGTAGCGCGAAAC GTGTGGTTTGGCAGAGCGGTCAGTATGCATGGACCGGTGGCCAGCGTCA TCGTGCAAGCCTGTATCCRAAAGCAACCGCCCCGGCAGATCGCGCGGC GCTGGCGGAAGCCGTTTCTCTGGCGCGCTCTCTGCGTGCGGGCGATTGG GAACCGTCTATTAGCGCGAACCATTTTCTGAGTCCGGGTGCGCTGAGTG GTCCGTTTCCGCGTTGGGCGCGTTGTACCGCCGCGCTGGCGGCCGAAGG TCGTTGTGTGAGTTATAAAGGTCAGAAAGTGCGTAGCCCGGATTTTACC TATAACGGCACCTGGTTCTATACCCTGTAAAAAGCTTGCGGCCGCACTC GAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGA AAGGAAGCTGAGTTGGGCTGCTGCCACCGCTGAGCAATAACTAGCATA ACCCCCTTGGGGGCCTTCTAAACGGGTCTTGAGGGGTTTTTTTTGCTGAA AGGAGGAACTATATTCCGGAATTGGTCGGAAATTGGGGAACGGCCGGC CCCCCTGKGTATGATR-3' Vùng highlight : Vùng trình t gene endolysin cell wall hydrolase  K t qu gi i trình t thơ chi uăng c (Reverse) 5'-CSCAMWMMCCWTTYCTTTWCKYRRGSTTTTGTTASCAGCCGGATCTCA RTGGTGGTGGTGGTGGTGCTCGAGTGCGSYYKCAAGCTTTTACAGGGTAT AGAACCAGGTGCCGTTATAGGTAAAATCCGGGCTACGCACTTTCTGACCT TTATAACTCACACAACGACCTTCGGCCGCCAGCGCGGCGGTACAACGCG CCCAACGCGGAAACGGACCACTCAGCGCACCCGGACTCAGAAAATGGTT CGCGCTAATAGACGGTTCCCAATCGCCCGCACGCAGAGAGCGCGCCAGA GAAACGGCTTCCGCCAGCGCCGCGCGATCTGCCGGGGCGGTTGCTTTCGG ATACAGGCTTGCACGATGACGCTGGCCACCGGTCCATGCATACTGACCGC TCTGCCAAACCACACGTTTCGCGCTACGCGGCCAACGACCATCCACAACA CGGTTATAGGTGGCAGACATCACCAGTTTCATCGCCAGGCGGCCACCATC GCGGGCCTCGTAGTAGCCTGCCTGCACATAGGCCAGGGTGTTGTCATTAA TAGGGCCAAAGTTCGCGCTTGCTTTGCAAGAAAAGCTGCTCAGAGTCAGT AAAATTACTAAGATTTTGATGATGTTTTGCATGGATCCGCGACCCATTTG CTGTCCACCAGTCATGCTAGCCATATGGCTGCCGCGCGGCACCAGGCCGC TGCTGTGATGATGATGATGATGGCTGCTGCCCATGGTATATCTCCTTCTTA AAAGTTMAACMAAATTATYTCTAGAGGGGAAATTGTTATCCGCTCACAA TTCCCCCTATAGTGAGTCGTAATTAATTTTYSCCGAGAAATCGAAGAAYC TCGAATWCCTCSTTGMYGCCCCGRGAMCGCCATCCGTTGGACCGGCACT CAACCGGGCTGTCYGTACAAGAGTTGCCGGCTGGKCYATGTGAAGCGAC KWCACCTCAGC-3' Vùng highlight : Vùng trình t gene endolysin cell wall hydrolase PH N LÝ L CH TRÍCH NGANG H tên: Nguy n T n L c Ngày,ătháng,ăn măsinh:ă19/12/1996 a ch liên l c: 312/52ăQuangăTrung,ăPh N iăsinh:ăPhúăYên ng 10, Qu n Gị V p, TP H Chí Minh Q trình đƠo t o: T thángă10ăn mă2014ăđ n tháng 08 n mă2018:ă Sinh h c,ătr ngă i h c quy ngành Cơng ngh i h c M TP H Chí Minh T thángă08ăn mă2019ăđ n nay: H c viên Cao h c ngành Công ngh Sinh h c,ătr i h c Bách khoa - ng i h c Qu c gia TP H Chí Minh Q trình cơng tác: T thángă08ăn mă2018ăđ n 06ăn mă2022: công tác t i Công ty C ph n CTCBIO Vi t Nam ... đ hi n th v ch protein 29 3.3.8 Kh o sát ho t tính kháng vi khu n Aeromonas hydrophila c a d ch endolysin tái t h p thô Ho t tính kháng vi khu n A hydrophila c a d ch endolysin tái t h p thô... hi n endolysin tái t h p t bào E coli BL21 (DE3) 27 3.3.7 Thu h i endolysin tái t h p b ng c t Ni-NTA 28 3.3.8 Kh o sát ho t tính kháng vi khu n Aeromonas hydrophila c a d ch endolysin tái. .. pET-28a(+)-gene endolysin gene endolysin Bi u hi n endolysin D ch t bào bi u hi n Thu nh n phá t bào D ch endolysin tái t h p thô Ki m tra endolysin tái t h p thô b ng SDS-PAGE Kh o sát ho t tính kháng Aeromonas