(LUẬN văn THẠC sĩ) isolation, selection and identification of aspergillus oryzae producing high salt tolerant neutral protease

VIETNAM NATIONAL UNIVERSITY OF AGRICULTURE VU THI LAN ISOLATION, SELECTION AND IDENTIFICATION OF ASPERGILLUS ORYZAE PRODUCING HIGH SALT TOLERANT NEUTRAL PROTEASE Major: Food technology Code: 24.18.05.54 Supervisor: Dr Nguyen Hoang Anh AGRICULTURAL UNIVERSITY PRESS - 2017 download by : skknchat@gmail.com DECLARATION I hereby declare that the thesis entitled “Isolation, selection and identification of Aspergillus oryzae producing high salt tolerant neutral protease” is the result of the research work carried out by me under the guidance of Dr Nguyen Hoang Anh in the Central Laboratory of Food Science and Technology, the faculty of Food Science and Technology, Vietnam National University of Agriculture I certify that the work presented in this thesis has not been submitted to any other universities Any help received in preparing this thesis and all sources used have been specifically acknowledged Hanoi, May 10th, 2017 Master candidate Vu Thi Lan i download by : skknchat@gmail.com ACKNOWLEDGEMENT I would like to express my deep gratitude and appreciation to my supervisor, Dr Nguyen Hoang Anh, Vice Dean as well as Head of Central Laboratory of the faculty of Food Science and Technology whose encouragement and guidance supported me to this thesis His patience, motivation, enthusiasm, and immense knowledge helped me during the time of my research and thesis writing I am grateful to Research and Teaching Higher Education Academy-Committee on Development Cooperation (ARES-CDD) for generous financial support for the course work and research work I sincerely thank all the teachers in the Department of Food Safety and Quality management, Faculty of Food Science and Technology, who gave me many valuable suggestions and ideas for my thesis Finally, I would like to acknowledge my family and friends for their love and encouragement during the completion of the thesis Hanoi, May 10th, 2017 Master candidate Vu Thi Lan ii download by : skknchat@gmail.com TABLE OF CONTENT Declaration i Acknowledgement ii Table Of Content iii List Of Abbreviations v List Of Tables vi List Of Figures vii PART I INTRODUCTION 1.1 Introduction 1.2 Objectives of study PART II LITERATURE REVIEW 2.1 Enzyme protease 2.1.1 2.1.2 2.1.3 2.1.4 2.2 2.2.1 2.2.2 2.2.3 Enzyme protease Classification of proteases Application of proteases in industries Sources of proteases Aspergillus group General characteristics of Aspergillus oryzae 10 Use of Aspergillus oryzae 13 Enzyme production of A oryzae 14 PART III MATERIAL AND METHOD 16 3.1 Material 16 3.1.1 3.1.2 3.1.3 Sample collection 16 Reference fungi 18 Fungal media and buffers 18 3.2 3.2.1 Methods 20 Isolation of Aspergillus oryzae from natural substrates 20 3.2.2 3.2.3 Primary identification of Aspergillus oryzae 21 Determination of protease activity by well diffusion and enzymatic assay 21 Effect of pH on activity and stability of protease 23 3.2.3 iii download by : skknchat@gmail.com 3.2.4 3.2.5 Effect of NaCl concentrations on activity and stability of protease 23 Identification of Aspergillus oryzae by molecular biological method 23 PART IV RESULTS AND DISCUSSION 25 4.1 Isolation and primary identification of Aspergillus oryzae 25 4.1.1 Isolation of Aspergillus oryzae from the natural sources 25 4.1.2 4.2 Primary identification of the isolated fungal isolates 27 Determination of protease activity produced from isolated A oryzae 29 4.2.1 Determination of protease activity produced from the isolates……… 30 Growth rate of the fungi on the different media 32 4.2.2 4.3 Effect of Sodium chloride (NaCl) on protease activity and stability 33 4.3.1 4.3.2 4.4 4.4.1 4.4.2 4.5 4.5.1 4.5.2 Effect of NaCl on protease activity 33 Effect of salt on protease stability 35 Effect of pH on the protease activity and stability 36 Effect of pH on the protease activity 36 Effect of pH on the protease stability 37 Identification of the fungi by molecular biological method 38 DNA extraction and PCR 38 BLAST search 39 PART V CONCLUSION AND RECOMMENDATION 41 5.1 Conclusion 41 5.2 Recommendation 41 REFERENCES 42 iv download by : skknchat@gmail.com LIST OF ABBREVIATIONS Acronym Abbreviations A.flavus Aspergillus flavus A oryzae Aspergillus oryzae A sojae Aspergillus sojae A nomius A parasiticus Aspergillus nomius Aspergillus parasiticus ITS Internal Transcribed Spacer PCR Polymerase Chain Reaction BLAST Basic Local Alignment Search Tool bp Base pair v download by : skknchat@gmail.com LIST OF TABLES Table 2.1 Characteristics of types of proteases Table 3.1 Characteristics of the collected samples 16 Table 3.2 The enzymatic assay procedure of protease 22 Table 4.1 Natural sources of Aspergillus oryzae and isolation results 25 Table 4.2 Morphological characteristics of four isolates on PDA 28 Table 4.3 Diameter of clear zones of protease produced from isolates 30 Table 4.4 Diameter (mm) of colony on PDA and CYA 32 vi download by : skknchat@gmail.com LIST OF FIGURES Figure 2.1 Crystal structure of protease from Aspergillus oryzae Figure 2.2 Aspergillus oryzae morphology 11 Figure 2.3 Conidial head of A oryzae 12 Figure 2.4 Conidial head of A flavus 12 Figure 3.1 The hyphae on the surface of soybeans (Hung Yen) and rices (Nam Dinh) 16 Figure 3.2 Aspergillus oryzae from Institute of Microbiology and Biotechnology 18 Figure 4.1 Morphological characterization of strain TB1 29 Figure 4.2 Aspergillus oryzae in 4-day PD broth culture 30 Figure 4.3 The clear distinct zones of proteases on the casein agar plates flooded with BCG reagent after day incubation 31 Figure 4.4 The growth rate of fungus TB1 on CYA and PDA after days and days 33 Figure 4.5 Effect of NaCl concentrations on protease activity of two isolates TB1 and G2 34 Figure 4.6 The NaCl tolerance of the protease from TB1and G2 at 16% NaCl 35 Figure 4.7 Effect of pH on protease activity from TB1 and G2 37 Figure 4.8 The pH stability of protease produced from A.oryzae TB1 and G2 38 vii download by : skknchat@gmail.com THESIS ABSTRACT Master candidate: Vu Thi Lan Thesis title: Isolation, selection and identification of Aspergilus oryzae producing high salt tolerance neutral protease Major: Food technology Code: 24180554 Education organization: Vietnam National University of Agriculture (VNUA) This study was to isolate, select and identify Aspergillus oryzae producing high salt tolerant neutral protease Four isolates (TB1, TB2, G2 and M1) in 12 isolates were primarily assumed to be A oryzae by morphological characterization TB1 and G2 revealed the highest protease activity with 49.26 u/l and 29.10 u/l, respectively The protease was labile in the sodium chloride solution alternated from 0% to 20% The protease activity of TB1 and G2 behaved high salt tolerance in 16% NaCl and retained 49.2% and 34.8%, respectively, of initial activity after hours The optimum pH for activity of the extracellular protease of both isolates TB1 and G2 were shown to be 7.0 The protease was more stable in the neutral condition than in acid or alkaline environments After incubation at 37oC for 12 hours at pH 7.0, the enzyme activity left were detected only 37% for TB1 and 41% for G2 TB1 was determined to be Aspergillus oryzae by the molecular method Key words: Aspergillus oryzae (A.oryzae), protease, salt tolerance viii download by : skknchat@gmail.com PART I INTRODUCTION 1.1 INTRODUCTION Proteases are multifunctional enzymes and represent a fundamental group of enzymes due to diversity of their physiological roles and biotechnological applications (Silva et al., 2011) These enzymes are extremely important in the pharmaceutical, medical, food, and biotechnology industries, accounting for nearly 60% of the whole enzyme market (Ramakrishna, Rajasekhar et al., 2010) It has been estimated that microbial proteases represent approximately 40% of the total worldwide enzyme sales (Rao et al., 1998) Proteases are ubiquitous but to get high salt tolerant neutral proteases is still receiving considerable attention Proteases can be classified into three types based on their optimum functional pH Neutral protease is more important for food industry because it can hydrolyze the proteins of the raw materials thoroughly and reduce the bitterness It is mainly used in the industry of food fermentation, brewing and feed additives etc In addition, some kinds of food are unique due to its high concentration of sodium chloride The higher sodium chloride content provided a lower degree of protein degradation The salt stable proteases are used in fermented food production, antifouling coating preparation and waste treatment, especially at marine habitat (Gao et al., 2016) The protease activity and stability decreased sharply when the materials is mixed with sodium chloride at high concentration, which is used for inhibiting spoilage bacteria, selectively retaining the slow growth of osmotolerant yeast and lactic acid bacteria as well as prolonging the preservation time Consequently, a protease which could tolerate high concentration of sodium chloride is important in order to improve food quality, to shorten the time for the maturation process and to improve the efficiency of raw material utilization (Wang et al., 2013) Since proteases are physiologically necessary for living organisms, being found in a wide diversity of sources such as plants, animals, but commercial proteases are produced exclusively from microorganisms Fungi of the genera Aspergillus, Penicillium and Rhizopus are especially useful for producing proteases, as several species of these genera are generally regarded as safe, of which, Aspergillus oryzae (A.oryzae) is mentioned (Chutmanop, Chuichulcherm et al 2008) This fungus is also a potential source of proteases due to their high download by : skknchat@gmail.com 700bp~ Figure 4.9 Gel electrophoresis of the total DNA extracted from the fungal biomass Figure 4.10 Amplification profile of two fungi TB1 and G2, showing 700bp fragment Lane M, DNA ladder (100bp DNA ladder, New England Biolabs) 4.5.2 BLAST search The ITS sequence of the isolates TB1 and G2 was searched for the homologous sequences in the database using the BLAST program The BLAST searches evidenced that the isolate TB1 was most closely related to an Aspergillus oryzae originated from a wide range of sources throughout the worlds with the query coverage of 97-98% and the max nucleotide identities 99% (table 4.5) and unfortunately, G2 was Aspergillus flavus Few samples of the most closely isolates were isolated in Korea and China Table 4.5 Blast search using complete ITS sequence of the fungi No GenBank fungi Aspergillus oryzae ,strain AS-A9 Aspergillus oryzae, strain QRF399 Aspergillus oryzae, strain BS-A2 Aspergillus oryzae, strain GS-A3 Aspergillus oryzae, strain SJ-A4 Host, country Nuruk, Korea Galapogas finches, China Nuruk, Korea Nuruk, Korea Nuruk, Korea Accession Query cover (%) Identity (%) HQ285528.1 97 99 KP278179.1 98 99 HQ285529.1 97 99 HQ285557.1 97 99 HQ285576.1 97 99 39 download by : skknchat@gmail.com Based on analysis of the ITS sequence, we conclude that the fungus TB1 was Aspergillus oryzae, whereas G2 was Aspergillus flavus As mentioned in the Literature review part, Aspergillus oryzae has a world-wide distribution and is regarded to be safe in many industries (Chancharoonpong, Hsieh et al., 2012) 40 download by : skknchat@gmail.com PART V CONCLUSION AND RECOMMENDATION 5.1 CONCLUSION o Four strains TB1, TB2, G2, M1 were assumed to be Aspergillus oryzae by morphological identification o TB1 and G2 revealed the larger clear zones and higher protease activity than TB2 and M1 o TB1 and G2 showed the decrease of protease activity from 0% to 20% of NaCl concentration The salt tolerance of protease from two strains TB1 and G2 was conducted by incubation with 16% NaCl for hours o pH 7.0 was the optimal condition for protease activity of both TB1 and G2 The pH stability was conducted during 12 hours with a decrease of residual activity less than 50% compared to the initial point t = o TB1 was identified to be Aspergilus oryzae by the ITS sequencing, whereas G2 was Aspergillus flavus 5.2 RECOMMENDATION Due to the limited experiment time, we have some recommendations for the further study as follows: o Determining some effects on protease such as temperature, metal ions o Identifying and characterizing the pH and salt effect on protease of the isolate TB2 which is being considered potentially to be Aspergillus oryzae 41 download by : skknchat@gmail.com REFERENCES Abdelal A T., Kennedy Emily H., Ahearn Donald G (1977) "Purification and characterization of a neutral protease from Saccharomycopsis lipolytica" Journal of bacteriology130(3) pp 1125-1129 Abbott S.P (2002) "Molds and other fungi in indoor environments: Summary of biology, known health effects and references" Disponible en el sitio web< http://www precisionenv com/PDFS/Indoor-Molds1 pdf> Abrunhosa L., Santos L., Venancio A., (2006) "Degradation of ochratoxin A by proteases and by a crude enzyme of Aspergillus niger Food Biotechnology 20(3) pp 231-242 Amanullah, A., Justen, P., Davies, A., Paul, G.C., Nienow, A.W., Thomas C.R., (2000) "Agitation induced mycelial fragmentation of Aspergillus oryzae and Penicillium chrysogenum" Biochemical Engineering Journal, pp.109-114 Barrett R., Berry M., Chan T., Demmel J., Donato J., Dongarra J., Eijkhout V., Pozo R., Romine R., Van der Vorst H (1994) "Templates for the solution of linear systems: building blocks for iterative methods" SIAM Baweja M et al (2016) An Alkaline Protease fromBacillus pumilus MP 27: Functional Analysis of Its Binding Model toward Its Applications As Detergent Additive Frontiers in Microbiology; pp 1195 Bennett, Joan W (2010) "An overview of the genus Aspergillus" Caiser Academic Press, Portland Bernstein, J A., Bernstein, D I., Stauder, T., Lummus, Z., and Bernstein, I L., (1999) A cross-sectional survey of sensitization to Aspergillus oryzae derived lactase in pharmaceutical workers Journal of Allergy Clinical Immunology, 103(6) pp 1153-1157 Chancharoonpong Chuenjit, Hsieh, Pao-Chuan, Sheu Shyang-Chwen (2012) "Enzyme production and growth of Aspergillus oryzae S on soybean koji fermentation." APCBEE Procedia2 pp 57-61 10 Chang P.K., Ehrlich K.C., Hua S.S.T (2006) "Cladal relatedness among Aspergillus oryzae isolates and Aspergillus flavus and L morphotype isolates" International Juornal of Food Microbiology, 108 pp.172-177 11 Chutmanop Jarun, Chuichulcherm Sinsupha, Chisti Yusuf, Srinophakun Penjit (2008) "Protease production by Aspergillus oryzae in solid state fermentation using agroindustrial substrates." Journal of Chemical Technology and Biotechnology 83(7): 1012-1018 42 download by : skknchat@gmail.com 12 de Castro, Ruann Janser Soares and Sato Helia Harumi (2014) "Protease from Aspergillus oryzae: biochemical characterization and application as a potential biocatalyst for production of protein hydrolysates with antioxidant activities." Journal of Food Processing 2014 13 Doyle, Jeff J (1987) " A rapid DNA isolation procedure for small quantities of fresh leaf tissue" Phytochem bull 19 pp 11-15 14 Fayyad A (2008) "Isolation of Aspergillus oryzae and New Aroma Production", the Islamic University-Gaza 15 Fernandes, L Fernandes, Lia Zimmermann, Narjara Leite, Clarice Loguercio (2010) "Enzyme screening of dikaryotic cultures from lignocellulolitic Basidiomycetes (fungi) collected in southern Brazil doi: 10.5007/2178-4574.2008 v37p07." INSULA Revista de Botânica37: 07 16 Gao R., Shi T., Liu X., Zhao M., Cui H., Yuan L., (2016) "Purification and characterisation of a salt stable protease from the halophilic archaeon Halogranum rubrum" Journal of the Science of Food and Agriculture 17 Gill I et al., (1996) "Biologically active peptides and enzymatic approaches to their production" Enzyme and Microbial Technol; 18 pp.162-183 18 Gogus, N., Tari, C., Oncu, S., Unluturk, S., Tokatli, F., (2006) "Relationship between morphology, rheology and polygalacturonase production by Aspergillus sojae ATCC 20235 in submerged cultures" Biochemical Engineering Journal, 32 pp 171-178 19 Gopakumar K., (1997) Chapter 5: Fermented fishery products In: Tropical fishery products Science Publishers, Inc USA 20 Gunawardhane MHW, Sooriyamoorthy SS, Silva KFST, Illeperuma CK (2004) "Isolation and identification of indigenous aspergillus oryzae for saccharification of rice starch" 21 Gupta R, Beg QK and Chauhan B Applied Microbiol Biotechnology, 2002b; 60 pp 381- 395 22 Hoang Anh Nguyen, Thu-Ha Nguyen, Clemens K Peterbauer, Peterbauer Clemens K, Mathiesen Geir, Haltrich Dietmar (2012) " Chitinase from Bacillus licheniformis DSM13: expression in Lactobacillus plantarum WCFS1 and biochemical characterisation" Protein expression and purification 81 (2) pp 166-174 23 Hoang Anh Nguyen, Thu-Ha Nguyen, Tien-Thanh Nguyen, Křen Vladimír, Eijsink Vincent GH, Haltrich, Dietmar, Peterbauer Clemens K (2012) " Heterologous expression and characterization of an N-acetyl-β-D-hexosaminidase from Lactococcus lactis ssp lactis IL1403" Journal of agricultural and food chemistry 60(12) pp 3275 -3281 43 download by : skknchat@gmail.com 24 Hocking, A D., (2006) "Aspergillus and related teleomorphs Food Science" Australia, Woodhead Publishing Ltd 25 Jaouadi N.Z et al (2013) "Biochemical and molecular characterization of a serine keratinase from Brevibacillus brevis US575 with promising keratin-biodegradation and hide-dehairing activities" PloS one; 8:e76722 26 Jernejc K and Cimerman A., (2001) "Morphological characteristics, extracellular and intracellular protein and enzyme oatterns of five Aspergillus species" Food Technol.Biotechnol., 39 pp.333-340 27 Kamitori S., Ohtaki A., Ino H and Takeuchi M (2003) "Crystal structure of Aspergillus oryzae aspartic proteinase and its complex with an inhibitor pepstatin at 1.9 A Resolution Journal of Molecular Biology 326 pp.1503 -1511 28 Kasai K., Nakamura Y., White R (1990) "Amplification of a variable number of tandem repeats (VNTR) locus (pMCT118) by the polymerase chain reaction (PCR) and its application to forensic science" Journal of Forensic Science35 (5) pp 1196 -1200 29 Kumar D and Bhalla T.C (2005) "Microbial proteases in peptide synthesis: approaches and applications" Appl Microbiol Biotechnol; 68 pp 726-736 30 Kumar D et al (2008) Microbial proteases and application as laundry detergent additive Res J Microbiol; pp 661-672 31 Lario, Luciana Daniela Chaud, Luciana das Graỗas Almeida, Marớa Converti, Attilio Sette, Lara Durães Pessoa, Adalberto (2015) "Production, purification, and characterization of an extracellular acid protease from the marine Antarctic yeast Rhodotorula mucilaginosa L7" Fungal biology 119 (11) pp 1129 -1136 32 Mackie I.M., Hardy R., Hobbs G (1971) "Fermented fish products" FAO Fisheries report no.100, Food and Agriculture Organization of the United Nations, Rome 33 Magnani Marciane, Fernandes Thiago, Prete Cássio Egidio Cavenaghi, Homechim Martin, Ono Elisabete Yurie Sataque, Vilas-Boas Laurival Antonio, Sartori Daniele, Furlaneto Márcia Cristin, Fungaro Maria Helena Pelegrinelli (2005) " Molecular identification of Aspergillus spp isolated from coffee beans" Scientia Agricola 62(1) pp 45-49 34 Mansour, E H., Khalil, A H., (1998) "Reduction of raffinose oligosaccharides in chickpea (Cicer arietinum) flour by crude extracellular fungal D-galactosidase" Journal of the Science of Food and Agriculture,78(2) pp 175-181 35 Morita, H., Hatamoto, O., Masuda, T., Sato, T., Takeuchi, M., (2007) "Function analysis of steA homolog in Aspergillus oryzae" Fungal Genetics and Biology, 44(5) pp 330-338 44 download by : skknchat@gmail.com 36 Mueda, Rose T (2015) "Physico-chemical and color characteristics of saltfermented fish sauce from anchovy Stolephorus commersonii" AACL Bioflux 8(4) pp 565-752 37 Nevalainen, Helena, Kautto, Liisa, Te’o, Junior (2014) "Methods for isolation and cultivation of filamentous fungi" Environmental Microbiology: Methods and Protocols 38 Pardo M.F et al (2000) "Purification of balansain I, an endopeptidase from unripe fruits of Bromelia balansae Mez (Bromeliaceae)" J Agric Food Chem; 48 pp 3795–800 39 Ramakrishna V., Rajasekhar S., and Reddy L S., (2010) “Identification and purification of metalloprotease from dry grass pea (Lathyrus sativus L.) seeds,” Applied Biochemistry and Biotechnology, 160(1) pp 63–71 40 Rao M.B et al (1998) Molecular and biotechnological aspects of microbial proteases Microbiol Mol Biol Rev; 62 pp 597-635 41 Rodarte M.P., Dias D.R., Vilela D.M., Schwan R.F., (2011) " Proteolytic activities of bacteria, yeasts and filamentous fungi isolated from coffee fruit (Coffea arabica L.) Acta Scientiarum Agronomy 33(3) pp 457-464 42 Saba I et al.( 2012) "Purification and characterization of a cold active alkaline protease from Stenotrophomonas sp., isolated from Kashmir, India" World J Microbiol Biotechnol; 28 pp 1071-1079 43 Samie N., Reddy P RM, Ashouri M (2012) "Novel extracellular hyper acidophil and thermostable α‐amylase from Micrococcus sp NS 211." Starch‐Stärke 64(2) pp 136-144 44 Sakurai, Yonekichi, Misawa, Shaw, Shiota, Hideo (1985) " Growth and respiratory activity of Aspergillus oryzae grown on solid state medium" Agricultural and biological chemistry 49 (3) pp 745-750 45 Sandhya C., Sumantha A., Szakacs G., Pandey, A (2005) "Comparative evaluation of neutral protease production by Aspergillus oryzae in submerged and solid-state fermentation" Process biochemistry 40(8) pp 2689-2694 46 Shankar, S.K., Mulimani, V.H., (2007) "D-Galactosidase production by Aspergillus oryzae in solid-state fermentation" Bioresource Technology, 98 pp 958-961 47 Silva T.A., Knob A., Tremacoldi C R., Brochetto-Braga M R., and Carmona E C., (2011) “Purification and some properties of an extracellular acid protease from Aspergillus clavatus,” World Journal of Microbiology and Biotechnology, vol 27, no 11, pp 2491–2497 45 download by : skknchat@gmail.com 48 Singh R et al., Microbial enzymes: industrial progress in 21st century Biotech 2016; 6: 174 49 Sooriyamoorthy S.S., Silva K.F.S.T., Gunawardhane M.H.W., Illeperuma C.K (2004) "Isolation and identification of indigenous Aspergillus oryzae for saccharification of rice starch" Tropical Agricultural Research 16: 121 -127 50 Su N.W., Wang M.L., Kwok K.F., Lee M.H., (2005) " Effects of temperature and sodium chloride concentration on the activities of proteases and amylases in soy sauce koji" Journal of agricultural and food chemistry 53(5):1521-1525 51 Ray B and Bhunia A (2007) Fundamental food microbiology, CRC press 52 Raper, K.B and Fennell D.I (1997) "Aspergillus oryzae Final Risk Assessment" https://www.epa.gov/sites/production/files/2015-09/documents/fra007.pdf 53 Vijayaraghavan, Ponnuswamy Vincent, Samuel Gnana Prakash (2013) "A simple method for the detection of protease activity on agar plates using bromocresolgreen dye" Journal of Biochemical Technology (3): 628-630 54 Vishwanatha, K (2009) Acid protease from Aspergillus oryzae: Structure-stability and enhancement of the activity by physical, chemical and molecular biological approaches, University of Mysore 55 Wang D, Zheng ZY, Feng J, Zhan XB, Zhang LM, Wu JR, Lin CC (2013) "A high salt tolerant neutral protease from Aspergillus Oryzae: Purification, characterization and kinetic properties" Applied biochemistry and microbiology 49 (4): 378 - 385 56 Wang B., Wu W., and Liu X (2007) "Purification and characterization of a neutral serine protease with nematicidal Mycopathologia 163(3): 169–176 activity from Hirsutella rhossiliensis" 57 White T J., Bruns T., Lee S., Taylor J., (1990) "Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics" PCR protocols: a guide to methods and applications 18(1): 315 - 322 58 Wicklow, D T., (1984) "Conidium Germination Rate in Wild and Domesticated Yellow-Green aspergilli" Applied and Environmental Microbiology, 47(2): 299-300 59 Yamada, O., nanan, S., Akao, T., Tominaga, M., Hisayuki, W., Satoh,T., Enel, H., and Akita, O., (2003) "dffA Gene from Aspergilhs oryzae Encodes L- Ornithine N5-Oxygenase and Is Indispensable for Deferriferrichrysin Biosynthesis" Journal of Bioscience and Bioengineering, 95(1): 82-88 60 Zambare V et al (2011) "A novel extracellular protease from Pseudomonas aeruginosa MCM B-327: enzyme production and its partial characterization" New Biotechnol; 28: 173-181 46 download by : skknchat@gmail.com 61 Zhang, M., Zhao, C., Du, L.X., Lu, F.P., and Gao, C (2008) "Expression, purification, and characterization of a thermophilic neutral protease from Bacillus stearothermophilus in Bacillus subtilis" 51(1): 52–59 62 Zhang, S and J Lv (2014) "Purification and properties of heat-stable extracellular protease from Pseudomonads fluorescens BJ-10." Journal of food science and technology51(6): 1185-1190 63 Abdelal A T., Kennedy Emily H, Ahearn Donald G (1977) "Purification and characterization of a neutral protease from Saccharomycopsis lipolytica." Journal of bacteriology130(3): 1125-1129 64 Abbott S.P (2002) "Molds and other fungi in indoor environments: Summary of biology, known health effects and references" Disponible en el sitio web< http://www precisionenv com/PDFS/Indoor-Molds1 pdf> 65 Abrunhosa L., Santos L., Venancio A., (2006) "Degradation of ochratoxin A by proteases and by a crude enzyme of Aspergillus niger Food Biotechnology 20(3):231-242 66 Amanullah, A., Justen, P., Davies, A., Paul, G.C., Nienow, A.W., Thomas C.R., (2000) "Agitation induced mycelial fragmentation of Aspergillus oryzae and Penicillium chrysogenum" Biochemical Engineering Journal, 5:109-114 67 Barrett R., Berry M., Chan T., Demmel J., Donato J., Dongarra J., Eijkhout V., Pozo R., Romine R., Van der Vorst H (1994) "Templates for the solution of linear systems: building blocks for iterative methods" SIAM 68 Baweja M et al (2016) An Alkaline Protease fromBacillus pumilus MP 27: Functional Analysis of Its Binding Model toward Its Applications As Detergent Additive Frontiers in Microbiology; 7: 1195 69 Bennett, Joan W (2010) "An overview of the genus Aspergillus" Caiser Academic Press, Portland 70 Bernstein, J A., Bernstein, D I., Stauder, T., Lummus, Z., and Bernstein, I L., (1999) A cross-sectional survey of sensitization to Aspergillus oryzae derived lactase in pharmaceutical workers Journal of Allergy Clinical Immunology, 103(6): 1153-1157 71 Chancharoonpong Chuenjit, Hsieh, Pao-Chuan, Sheu Shyang-Chwen (2012) "Enzyme production and growth of Aspergillus oryzae S on soybean koji fermentation." APCBEE Procedia2: 57-61 72 Chang P.K., Ehrlich K.C., Hua S.S.T (2006) "Cladal relatedness among Aspergillus oryzae isolates and Aspergillus flavus and L morphotype isolates" International Juornal of Food Microbiology, 108:172-177 47 download by : skknchat@gmail.com 73 Chutmanop Jarun, Chuichulcherm Sinsupha, Chisti Yusuf, Srinophakun Penjit (2008) "Protease production by Aspergillus oryzae in solid‐state fermentation using agroindustrial substrates." Journal of Chemical Technology and Biotechnology83(7): 1012-1018 74 de Castro, Ruann Janser Soares and Sato Helia Harumi (2014) "Protease from Aspergillus oryzae: biochemical characterization and application as a potential biocatalyst for production of protein hydrolysates with antioxidant activities." Journal of Food Processing2014 75 Doyle, Jeff J (1987) "A rapid DNA isolation procedure for small quantities of fresh leaf tissue" Phytochem bull 19: 11-15 76 Fayyad A (2008) "Isolation of Aspergillus oryzae and New Aroma Production", the Islamic University-Gaza 77 Fernandes, L Fernandes, Lia Zimmermann, Narjara Leite, Clarice Loguercio (2010) "Enzyme screening of dikaryotic cultures from lignocellulolitic Basidiomycetes (fungi) collected in southern Brazil doi: 10.5007/2178-4574.2008 v37p07." INSULA Revista de Botânica37: 07 78 Gao R., Shi T., Liu X., Zhao M., Cui H., Yuan L., (2016) "Purification and characterisation of a salt stable protease from the halophilic archaeon Halogranum rubrum" Journal of the Science of Food and Agriculture 79 Gill I et al (1996) "Biologically active peptides and enzymatic approaches to their production" Enzyme and Microbial Technol; 18:162-183 80 Gogus, N., Tari, C., Oncu, S., Unluturk, S., Tokatli, F., (2006) "Relationship between morphology, rheology and polygalacturonase production by Aspergillus sojae ATCC 20235 in submerged cultures" Biochemical Engineering Journal, 32: 171-178 81 Gopakumar K., (1997) Chapter 5: Fermented fishery products In: Tropical fishery products Science Publishers, Inc USA 82 Gunawardhane MHW, Sooriyamoorthy SS, Silva KFST, Illeperuma CK (2004) " Isolation and identification of indigenous aspergillus oryzae for saccharification of rice starch" 83 Gupta R, Beg QK and Chauhan B Applied Microbiol Biotechnology, 2002b; 60: 381- 395 84 Hoang Anh Nguyen, Thu-Ha Nguyen, Clemens K Peterbauer, Peterbauer Clemens K, Mathiesen Geir, Haltrich Dietmar (2012) " Chitinase from Bacillus licheniformis DSM13: expression in Lactobacillus plantarum WCFS1 and biochemical characterisation" Protein expression and purification 81 (2): 166-174 48 download by : skknchat@gmail.com 85 Hoang Anh Nguyen, Thu-Ha Nguyen, Tien-Thanh Nguyen, Křen Vladimír, Eijsink Vincent GH, Haltrich, Dietmar, Peterbauer Clemens K (2012) " Heterologous expression and characterization of an N-acetyl-β-D-hexosaminidase from Lactococcus lactis ssp lactis IL1403" Journal of agricultural and food chemistry 60(12): 3275 -3281 86 Hocking, A D., (2006) "Aspergillus and related teleomorphs Food Science" Australia, Woodhead Publishing Ltd 87 Jaouadi N.Z et al (2013) "Biochemical and molecular characterization of a serine keratinase from Brevibacillus brevis US575 with promising keratin-biodegradation and hide-dehairing activities" PloS one; 8:e76722 88 Jernejc K and Cimerman A., (2001) "Morphological characteristics, extracellular and intracellular protein and enzyme oatterns of five Aspergillus species" Food Technol.Biotechnol., 39:333-340 89 Kamitori S., Ohtaki A., Ino H and Takeuchi M (2003) "Crystal structure of Aspergillus oryzae aspartic proteinase and its complex with an inhibitor pepstatin at 1.9 A Resolution Journal of Molecular Biology 326:1503 -1511 90 Kasai K., Nakamura Y., White R (1990) "Amplification of a variable number of tandem repeats (VNTR) locus (pMCT118) by the polymerase chain reaction (PCR) and its application to forensic science" Journal of Forensic Science35 (5): 1196 1200 91 Kumar D and Bhalla T.C (2005) "Microbial proteases in peptide synthesis: approaches and applications" Appl Microbiol Biotechnol; 68: 726-736 92 Kumar D et al (2008) Microbial proteases and application as laundry detergent additive Res J Microbiol; 3: 661-672 93 Lario, Luciana Daniela Chaud, Luciana das Graỗas Almeida, Marớa Converti, Attilio Sette, Lara Durães Pessoa, Adalberto (2015) "Production, purification, and characterization of an extracellular acid protease from the marine Antarctic yeast Rhodotorula mucilaginosa L7" Fungal biology 119 (11): 1129 -1136 94 Mackie I.M., Hardy R., Hobbs G (1971) "Fermented fish products" FAO Fisheries report no.100, Food and Agriculture Organization of the United Nations, Rome 95 Magnani Marciane, Fernandes Thiago, Prete Cássio Egidio Cavenaghi, Homechim Martin, Ono Elisabete Yurie Sataque, Vilas-Boas Laurival Antonio, Sartori Daniele, Furlaneto Márcia Cristin, Fungaro Maria Helena Pelegrinelli (2005) " Molecular identification of Aspergillus spp isolated from coffee beans" Scientia Agricola 62(1):45-49 49 download by : skknchat@gmail.com 96 Mansour, E H., Khalil, A H., (1998) "Reduction of raffinose oligosaccharides in chickpea (Cicer arietinum) flour by crude extracellular fungal D-galactosidase" Journal of the Science of Food and Agriculture,78(2): 175-181 97 Morita, H., Hatamoto, O., Masuda, T., Sato, T., Takeuchi, M., (2007) "Function analysis of steA homolog in Aspergillus oryzae" Fungal Genetics and Biology, 44(5): 330-338 98 Mueda, Rose T (2015) "Physico-chemical and color characteristics of saltfermented fish sauce from anchovy Stolephorus commersonii" AACL Bioflux 8(4):565-752 99 Nevalainen, Helena, Kautto, Liisa, Te’o, Junior (2014) "Methods for isolation and cultivation of filamentous fungi" Environmental Microbiology: Methods and Protocols 100 Pardo M.F et al (2000) "Purification of balansain I, an endopeptidase from unripe fruits of Bromelia balansae Mez (Bromeliaceae)" J Agric Food Chem; 48 pp 3795–800 101 Ramakrishna V., Rajasekhar S., and Reddy L S., (2010) “Identification and purification of metalloprotease from dry grass pea (Lathyrus sativus L.) seeds,” Applied Biochemistry and Biotechnology, 160(1): 63–71 102 Rao M.B et al (1998) Molecular and biotechnological aspects of microbial proteases Microbiol Mol Biol Rev; 62: 597-635 103 Rodarte M.P., Dias D.R., Vilela D.M., Schwan R.F., (2011) " Proteolytic activities of bacteria, yeasts and filamentous fungi isolated from coffee fruit (Coffea arabica L.) Acta Scientiarum Agronomy 33(3): 457-464 104 Saba I et al.( 2012) "Purification and characterization of a cold active alkaline protease from Stenotrophomonas sp., isolated from Kashmir, India" World J Microbiol Biotechnol; 28: 1071-1079 105 Samie N., Reddy P RM, Ashouri M (2012) "Novel extracellular hyper acidophil and thermostable α‐amylase from Micrococcus sp NS 211." Starch‐Stärke 64(2): 136-144 106 Sakurai, Yonekichi, Misawa, Shaw, Shiota, Hideo (1985) " Growth and respiratory activity of Aspergillus oryzae grown on solid state medium" Agricultural and biological chemistry 49 (3): 745-750 107 Sandhya C., Sumantha A., Szakacs G., Pandey, A (2005) "Comparative evaluation of neutral protease production by Aspergillus oryzae in submerged and solid-state fermentation" Process biochemistry 40(8): 2689-2694 50 download by : skknchat@gmail.com 108 Shankar, S.K., Mulimani, V.H., (2007) "D-Galactosidase production by Aspergillus oryzae in solid-state fermentation" Bioresource Technology, 98 pp 958-961 109 Silva T.A., Knob A., Tremacoldi C R., Brochetto-Braga M R., and Carmona E C., (2011) “Purification and some properties of an extracellular acid protease from Aspergillus clavatus,” World Journal of Microbiology and Biotechnology, vol 27, no 11, pp 2491–2497 110 Singh R et al., Microbial enzymes: industrial progress in 21st century Biotech 2016; 6: 174 111 Sooriyamoorthy S.S., Silva K.F.S.T., Gunawardhane M.H.W., Illeperuma C.K (2004) " Isolation and identification of indigenous Aspergillus oryzae for saccharification of rice starch" Tropical Agricultural Research 16: 121 -127 112 Su N.W., Wang M.L., Kwok K.F., Lee M.H., (2005) " Effects of temperature and sodium chloride concentration on the activities of proteases and amylases in soy sauce koji" Journal of agricultural and food chemistry 53(5):1521-1525 113 Ray B and Bhunia A (2007) Fundamental food microbiology, CRC press 114 Raper, K.B and Fennell D.I.(1997) "Aspergillus oryzae Final Risk Assessment".https://www.epa.gov/sites/production/files/2015/09/documents/fra007 pdf 115 Vijayaraghavan, Ponnuswamy Vincent, Samuel Gnana Prakash (2013) "A simple method for the detection of protease activity on agar plates using bromocresolgreen dye" Journal of Biochemical Technology (3): 628-630 116 Vishwanatha, K (2009) Acid protease from Aspergillus oryzae: Structure-stability and enhancement of the activity by physical, chemical and molecular biological approaches, University of Mysore 117 Wang D, Zheng ZY, Feng J, Zhan XB, Zhang LM, Wu JR, Lin CC (2013) "A high salt tolerant neutral protease from Aspergillus Oryzae: Purification, characterization and kinetic properties" Applied biochemistry and microbiology 49 (4): 378 - 385 118 Wang B., Wu W., and Liu X (2007) "Purification and characterization of a neutral serine protease with nematicidal activity from Hirsutella rhossiliensis" Mycopathologia 163(3): 169–176 119 White T J., Bruns T., Lee S., Taylor J., (1990) "Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics" PCR protocols: a guide to methods and applications 18(1): 315 – 322 51 download by : skknchat@gmail.com 120 Wicklow, D T., (1984) "Conidium Germination Rate in Wild and Domesticated Yellow-Green aspergilli" Applied and Environmental Microbiology, 47(2): 299300 121 Yamada, O., nanan, S., Akao, T., Tominaga, M., Hisayuki, W., Satoh,T., Enel, H., and Akita, O., (2003) "dffA Gene from Aspergilhs oryzae Encodes L- Ornithine N5-Oxygenase and Is Indispensable for Deferriferrichrysin Biosynthesis" Journal of Bioscience and Bioengineering, 95(1): 82-88 122 Zambare V et al (2011) "A novel extracellular protease from Pseudomonas aeruginosa MCM B-327: enzyme production and its partial characterization" New Biotechnol; 28: 173-181 123 Zhang, M., Zhao, C., Du, L.X., Lu, F.P., and Gao, C (2008) "Expression, purification, and characterization of a thermophilic neutral protease from Bacillus stearothermophilus in Bacillus subtilis" 51(1): 52–59 124 Zhang, S and J Lv (2014) "Purification and properties of heat-stable extracellular protease from Pseudomonads fluorescens BJ-10." Journal of food science and technology51(6): 1185-1190 52 download by : skknchat@gmail.com ANNEX The standard curve of protease activity Tyrosin solution (ml) 0.05 Tyrosine µM Abs (660nm) 0.055 0.08 0.1 0.111 0.173 0.2 0.221 0.359 0.4 0.442 0.7 0.5 0.553 0.86 The ITS of two isolates TB1 and G2 >TB1-615 Nu- Aspergillus oryzae AATGATCGTTCGTAGGGGTGACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGC GAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTC ATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTG TCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGG ATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTG CAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGG GGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTC GTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCG AGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAAT CAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT CAATAAGCCGGAGGAAAATCATTA >G2-541 Nu-Aspergillus flavus CTAGCGAGCCCACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCC ATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAAC TCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACA ATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGA ATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCC GGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGT CGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATC CTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGC AAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGC ATATCAAAAA 53 download by : skknchat@gmail.com ... entitled ? ?Isolation, selection and identification of Aspergillus oryzae producing high salt tolerant neutral protease? ?? is the result of the research work carried out by me under the guidance of Dr... biochemistry and molecular biology is extremely necessary In this context, the study "Isolation, selection and identification of Aspergillus oryzae producing high salt tolerant neutral protease" ... ABSTRACT Master candidate: Vu Thi Lan Thesis title: Isolation, selection and identification of Aspergilus oryzae producing high salt tolerance neutral protease Major: Food technology Code: 24180554