0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+1 sequence ... myc myc myc N6 (CCG414 fi TAA, Pro25 fi stop in core ORF) Deletion of core nts 342–514 ATG core+1 85 with optimal context GCCCCTCTATGG fi CCGCCACCATGG ATG core+1 85 with optimal context GCCCCTCTATGG...
  • 18
  • 365
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis" docx

... HALT -C trial and 12 HCV-HIV co-infected patients receiving or not receiving HAART Results Clinical characteristics of the HALT -C and HCV-HIV coinfected patients are depicted in Tables and For ... performed according to manufacturer's specifications http://www.virologyj.com/content/2/1/41 Clonal Frequency Analysis (CFA) For each cloned HVR1 PCR product, 20 colonies were picked directly into ... Geysen HM, Christopherson C, Hall JE, Mason TJ, Saracco G, Bonino F, Crawford K, Marion CD, Crawford KA, et al.: Evidence for immune selection of hepatitis C virus (HCV) putative envelope glycoprotein...
  • 11
  • 453
  • 0
Sexually transmitted infections and other reproductive tract infections in rural vietnam

Sexually transmitted infections and other reproductive tract infections in rural vietnam

... Mogren I, Stålsby Lundborg C Perceptions and attitudes in relation to reproductive tract infections including sexually transmitted infections in rural Vietnam: A qualitative study Health Policy ... (STI) and other reproductive tract infections (RTI) constitute a huge health and economic burden in low-income countries The infections may result in severe sequelae, particularly in women, and ... Mogren I Reproductive tract infections including sexually transmitted infections: a population-based study of women of reproductive age in a rural district of Vietnam Sex Transm Infect 2008;84(2):126-32...
  • 91
  • 1,099
  • 0
báo cáo khoa học:

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... Univariate analysis of categorical factors associated with HIV and hepatitis C virus (HCV) infections among injection drug users in Vinnitsya, Ukraine (Unadjusted odds ratios with 95% confidence ... that can establish a first link between the IDU and Table 3: Univariate analysis of continuous factors associated with HIV and hepatitis C virus (HCV) infections among injection drug users in ... risk variables, years of using opiate drugs (> years) increased the risk of HCV Recent Table 1: Prevalence of HIV and hepatitis C virus (HCV) infections among injection drug users in Vinnitsya,...
  • 9
  • 331
  • 0
Báo cáo y học:

Báo cáo y học: "Molecular epidemiology of hepatitis E virus infections in Shanghai, China" ppt

... square brackets that define the HEV subtypes Each branch is labeled with the host of the HEV isolate, GenBank accession number and the year the strain was isolated Reference sequences are labeled ... excluded Genotype HEV strains were geographically limited to Shanghai and neighboring provinces, and seven sequences were classified into subtype 3b No human genotype HEV sequences were among those ... swine HEV have so far been documented in China Since genotype and the newly identified subtype 4i have been limited geographically exclusively to Shanghai and its neighboring provinces, the municipality,...
  • 10
  • 364
  • 0
Báo cáo y học:

Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx

... (40-50 years) people Third highest active HCV infection was 2.13% observed in age group 31-40 years People including in age group 21-30 years revealed 1.82% active HCV infection High prevalence of ... have no active HCV infection The absence of HCV infection in this age group may be due to their least exposure to some of the high risk factors causing HCV such as exposure to barbers etc The highest ... District Mansehra, Pakistan The active infection is 3.5% as described in first bar The second bar indicates that 7% percent of the people of District Mansehra carry anti- HCV antibodies in their...
  • 5
  • 268
  • 0
Báo cáo y học:

Báo cáo y học: "Molecular epidemiology of Hepatitis C virus genotypes in Khyber Pakhtoonkhaw of Pakistan" pptx

... genotypespecific PCR assay Figure-2 shows a typical agarose gel showing different HCV genotype-specific bands (HCV1a & HCV-3a) Pattern of HCV genotypes in the study population The distribution of HCV genotypes ... Mass vaccination in the recent past in which un-sterilized syringes were used might have enhanced the infection rate in this country [23] This type of practice is still common in the countryside ... II system is a PCR system by which amplification and detection were accomplished concurrently with TaqMan technology (Applied Biosystems, Foster City, Calif) using fluorescent probes to detect...
  • 7
  • 368
  • 0
Báo cáo y học:

Báo cáo y học: " Hepatitis C virus infection in Brazilian long-distance truck drivers" pptx

... genotypes/subtypes, and the factors associated with HCV infection in long-distance truck drivers in Brazil A cross-sectional study was carried out in a population of long-distance truck drivers in ... 81 truck drivers who reported illicit drug use, the majority had used non-injecting drugs, including the anti-HCV-positive individuals The risk of HCV infection associated with non-injecting ... immunodeficiency virus, hepatitis B, C and D in Bangladesh’s trucking industry: prevalence and risk factors Int J Epidemiol 2001, 30:878-884 Jindal N, Arora U, Singh K: Prevalence of human immunodeficiency...
  • 6
  • 381
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf

... 5’TCCAGGCTCCCCCTCGAGCTTGTACA GCTCGTCCAT-3’) In the third step, the recombinant 531 bp DNA fragment (F3) containing last amino acids of EGFP-N1 and 177 amino acids of NS 5A (nt 75478077) was amplified ... doi:10.1186/1743-422X-7-36 Cite this article as: Hazari et al.: Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective JakStat pathway Virology Journal 2010 ... activity of IFN -a to inhibit replication of full-length HCV 2a clone was prevented in R -Huh-7 clone with defective Jak-Stat pathway Antiviral activity of IFN -a is impaired against HCV 2a subgenomic clone...
  • 16
  • 391
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

... Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light on HCVcc infectivity, 200-μl aliquots of HCVcc stock (2.5 × 104 FFU/ml) were placed in 48-well ... tested concentration, is highly effective in eliminating the infectivity of both extracellular and intracellular HCVcc particles Discussion In this study, a detailed analysis was conducted on the stability ... HCVcc in human serum Log 10 FFU/ml 0 30 60 90 120 Seconds Figure Inactivation of the HCVcc by UVC light irradiation Aliquots (200 μl) of an HCVcc stock (A) or normal human serum containing HCVcc...
  • 12
  • 411
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Occurrence of Hepatitis C Virus infection in type 2 diabetic patients attending Plateau state specialist hospital Jos Nigeria" doc

... liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32( 10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti M: Alterations of glucose ... The prevalence rate of 11% recorded in this study is in agreement with the work of [5] who also recorded 11.5% against 2. 5% when prevalence of HCV infection was checked among diabetic patients and ... significant value, example (table 2) Subjects The subjects included in this research project were 300 known type diabetic patients attending the hospital for check-ups Study Location The study was carried...
  • 5
  • 463
  • 0
Báo cáo y học:

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... http://www.comparative-hepatology.com/content/5/1/4 body), splenomegaly, ascitis, edema, cirrhosis, grade and stage of liver biopsy, and child score and status (inactive, chronic, cirrhotic and active) of ... molecular epidemiology of HCV by the introduction of subtype 1a and 3a from USA and Southeast Asia into their young drug addicts [44] Our results are in accordance with the predominance of genotype ... SM, Kafaee J, Yektaparast B, Hajarizadeh B, Doroudi T: The efficacy of blood donor screening in reducing the incidence of hepatitis C virus infection among thalassemic patients in Iran Transfusion...
  • 6
  • 337
  • 0
Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

... factor for < /b> both disease transmission Screening < /b> test for < /b> HBsAg and anti-HCV in blood < /b> donors is in place in South East Asia including Cambodia and Vietnam whereas anti-HBc screening < /b> in blood < /b> donors ... Anti-HBs Antibodies to Hepatitis < /b> B surface antigen Anti-HCV Antibodies to Hepatitis < /b> C BCP Basal Core Promoter cccDNA Covalently Closed Circular DNA CHC Chronic hepatitis < /b> C CMIA Chemiluminescent Microparticle ... H, et al Screening < /b> test accuracy among potential blood < /b> donors of HBsAg, anti-HBc and anti-HCV to detect hepatitis < /b> B and C virus infection in rural Cambodia and Vietnam The Southeast Asian Journal...
  • 64
  • 464
  • 0

Xem thêm

Từ khóa: recommendations for prevention and control of hepatitis c virus hcv infection andrecommendations for prevention and control of hepatitis c virus infectionrecommendations for prevention and control of hepatitis c virusfor owners b and c content has a steeper slope than service and this is true for all newspapers owned by the companies since v b is not significantly different from 0 for content or service for eithercoronaviruses gbf1 arf1 had also been shown to be important for other plus strand rna viruses such as enterovirus 240 247 248 249 and hepatitis c virus hcv 250 we tested the effect of gbf and arf1 knockdown on dengue virus infectioprogress toward prevention and control of hepatitis c virus infectionBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM