Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx
Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx
... 8 and 280 by IFA and 25 and 263 by ELISA. The specificity relative to IFA was 87.7% and sensitivitywas 93.57% (the agreement rate was 93.4%). Cross-r eac-tion was analyzed by testing the reactivity ... induction of IPTG; Lane 3,Supernatant of cell lysate after sonication and centrifugation; Lane 4,Pellet of cell lysate after sonication and centrifugation, There was a clear band of 29 kDa (arrow) after ... that the assay was repeatable and yielded a low and acceptable variation.Evaluation of assay specificity and sensitivityThe PCV2 GST -ORF2- E ELISA results were obtainedfrom 288 serum samples....
- 7
- 420
- 0
Báo cáo y học: "Development and validation of the self-administered Fibromyalgia Assessment Status: a disease-specific composite measure for evaluating treatment effect" pptx
... of the study, and the acqui-sition, analysis and interpretation of the data, and participatedin drafting the manuscript. PSP contributed to the conception of the study, and acquisition, analysis ... similarin terms of age (mean age 56.1 ± 11.4 years, range 34 to 87),education level and marital status. The arithmetic mean (stand-ard deviation) of FAS was 6.34 (1.61) and the 95% CI of themean ... non-ran-domised primary care sample. It can be assumed that the moti-vation of patients who volunteer to take part in a study isdifferent from that of a random population, and they may havea...
- 12
- 423
- 0
Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps
... specific PCR assay has a sensitivity of 95.8% and 88.9% by sample and subject,respectively, and specificity was 87.8% and 58.8% by sample and subject, respectively. The lowsensitivity is due to ... for example) are associatedwith human malignancy including as much as 95% of cer-vical cancers and up to 35% of oral malignancies. The lowrisk HPV types, for example HPV-6 and -11, are the ... interests.Authors' contributionsNRH: Developed and ran the HPV-32 specific PCR assay,did all statistical analysis, and prepared the manu-script.NH: Extracted the clinical samples and tested...
- 7
- 424
- 0
Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps
... herbal medicine [1] as well as an antioxidant and anti-inflammatory agent [2]. Sancheti and colleagueshave reported its glycosidase and cholinesterase inhibi-tion properties as an anti-diabetic ... Sn-S62 -a CGACAGTAAACATAAAAACCG 1 1*Sn-S62-b CTGTTACCATTGGCTCTTTACCCAPS 60-67 CP-S62-f TCGTGCGGGTCATAGTACCCCGAGACAAGAGGCCAAAA 2 0.25, 0.3(Afl III)CP-S62-r TGTAATACGAAAGTTTAAGTCTCTTTTCTTAGTC 0.2, ... CTCTTGAGCAATCCAAATGTTTTGTTATCASR-S343-R1 CATAAATCACTTTATAACATAACGAGCTCGTATT 1 1.03SR-S343-R2 CGCGACAGAGGGGTTTTCTTTCTATTA 1 0.95SR-S343-R3 AGACGCCTCACTTTGATAGACATGAGTTTA 1 0.89SNP 50-60 Sn-S62-a...
- 9
- 352
- 0
Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc
... of a standard that should permit the gen-eration of larger, functionally accurate datasets using AIS08-based injury standards, as existing AIS98 datacanbemappedtoAIS08andusedindeterminingAIS08-rel ... Palmer et al.: Development and validation of a complementary map to enhance the existing 1998 to 2008 AbbreviatedInjury Scale map. Scandinavian Journal of Trauma, Resuscitation and Emergency ... AIS08equivalents using the enhanced map (that is, boththe dictionary and complementary maps); and • EMap08+F - AIS98 data mapped fo rwards toAIS08 equivalents using the enhanced map as a default,...
- 13
- 688
- 0
báo cáo hóa học: " Development and validation of the Treatment Related Impact Measure of Weight (TRIM-Weight)" pdf
... (10.9%)ETHNICITY:- White/Caucasian 168 (83.2%)- Black/African American 14 (6.9%)- Latino/Hispanic/Mexican American 10 (5.0%)- Native American/Alaskan Native 1 (0.5%)- Asian American/Pacific Islander ... interpretation and manuscript preparation. DMB was themain contributor to the data analysis and interpretation and contributed tothe manuscript preparation. All authors read and approved the finalmanuscript.Received: ... self-appearance and bodyimage; decreased mirror avoidanc e; and improvementsin emotional reaction, psychological stress, anxiety and depression [36-39].The validation study was conducted via...
- 11
- 660
- 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
... JRdesigned and managed the valuation survey, conductedanalysis and reported on the valuation exercise. *DM ranthe analysis to identify items for the valuation exercise,analysed the validation data and ... writ-ing of the manuscript. JB designed and managed the valu-ation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript. Allauthors read and approved ... good', 'Good','Fair', and 'Poor'). Items that significantly predicted thisvariable were candidates for inclusion in the utility exer-cise.Health and Quality of Life...
- 8
- 590
- 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot
... Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano S,Arakawa S, Hamami G, Matsumoto O, Kamidono S: Assessment of health-related quality of life in renal transplant and hemodi-alysis ... Berland2 and Roland Sambuc1Address: 1Department of Public Health, EA 3279, University of Aix-Marseille II, France and 2Department of Nephrology and Kidney Transplantation, Hospital Conception, ... Ortega F, Baltar JM, Díaz-Corte C, Navascués RA, NavesM, Ure a A, Bad a X, Alvarez-Ude F, Alvarez-Grande J: Healthrelated quality of life (HRQOL) of kidney transplantedpatients : variables that...
- 12
- 520
- 0
báo cáo hóa học: " Development and validation of the insulin treatment appraisal scale (ITAS) in patients with type 2 diabetes" docx
... 12:385-401.15. Awata S, Bech P, Yoshida S, Hirai M, Suzuki S, Yamashita M, Ohara A, Hinokio Y, Matsuoka H, Oka Y: Reliability and validity of the Jap-anese version of the World Health Organization-Five ... respond-ents are displayed in Table 1. Mean age in the total samplewas 59 ± 11 years, 54% were female, mean HbA1c was 6.8± 1.8 and participants had a mean diabetes duration of 5± 1 years. Furthermore, ... data collected and participated in thedesign of the validation study and the development of thestatistical plan. FP carried out the statistical analyses. Allauthors participated in the data...
- 7
- 602
- 0
báo cáo hóa học: " Development and validation of the WEll-being and Satisfaction of CAREgivers of Children with Diabetes Questionnaire (WE-CARE)" potx
... design and coordination of the study. XL contrib-uted statistical analysis and helped to draft the manu-script. RA and LA participated in the design and coordination of the study, analyzed and ... software was used forthe assessment of factor analysis and for clinical and known-groups validity. Multitrait Analysis Program-Revised software [17] was used for the assessment of otherpsychometric ... Copeland K, Plotnick L, Kaufman F, Laf-fel L, Deeb L, Grey M, Anderson B, Holzmeister LA, Clark N: Care of children and adolescents with type 1 diabetes: a statement of the American Diabetes Association....
- 9
- 478
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP