rapamycin thu được từ chủng WT/rapG trong môi trường MD1 bổ sung glycerol thu được cao gấp 6,5 lần so với chủng WT và cao hơn 1,5 lần so với nuôi chủng WT/rapG trong môi trường bổ sung axit shikimic.
3.3.3. Ảnh hưởng của hàm lượng axit shikimic đến khả năng sinh rapamycin rapamycin
Glycerol và axit shikimic có ảnh hưởng tích cực đến khả năng sinh rapamycin. Khi bổ sung glycerol trong môi trường, lượng rapamycin thu được cao hơn so với bổ sung axit shikimic do glycerol tác động đến giai đoạn đầu tổng hợp các chất sơ cấp và các chất thứ cấp được tổng hợp sau. Do đó, chúng tôi nhận định rằng glycerol là thành phần không thể thiếu trong môi trường để thu lượng rapamycin lớn, axit shikimic là thành phần tác động giai đoạn sau và giá thành rẻ hơn rất nhiều so với glycerol. Do đó, chúng tôi lựa chọn thay đổi lượng axit shikimic trong môi trường MD1 bổ sung glycerol 15 g/L từ 5,0-10,0-15,0 g/L bột hồi chứa lượng axit shikimic tương ứng là 0,4 – 0,8 – 1,2 g/L để đánh giá ảnh hưởng của hàm lượng acid shikimic tới khả năng sinh rapamycin [18]. Kết quả cho thấy, chủng xạ khuẩn WT/rapG trong môi trường MD1 bổ sung glycerol 15 g/L và axit shikimic với hàm lượng khác nhau đều thu được lượng rapamycin cực đại (± 200 mg/L). Kết quả này do gen điều hòa dương rapG là một nhân tố giúp tăng cường chuyển hóa trong chu trình sinh tổng hợp rapamycin đạt đến độ bão hòa. Do đó, sự có mặt của axit shikimic không thể giúp tăng lượng rapamycin của chủng xạ khuẩn WT/rapG. Đối với chủng xạ khuẩn WT, sự có mặt của glycerol và axit shikimic trong môi trường làm tăng lượng rapamycin thu được so với môi trường gốc, môi trường chỉ bổ sung glycerol hoặc axit shikimic. Tuy nhiên thay đổi lượng axit shikimic trong môi trường không làm ảnh hưởng nhiều tới lượng rapamycin thu được.
Hình 3.15. Biểu đồ thể hiện lượng rapamycin thu được trong môi trường bổ sung lượng axit shikimic khác nhau
Cuối cùng, chúng tôi kết luận rằng: hàm lượng axit shikimic trong môi trường nuôi có ảnh hưởng tích cực đến quá trình sinh tổng hợp rapamycin của chủng xạ khuẩn hoang dại và không tác động đến chủng xạ khuẩn chuyển gen WT/rapG. Glycerol có tác động tích cực đến cả hai chủng xạ khuẩn. Trong môi trường MD1 không có axit shikimic và glycerol, các chủng xạ khuẩn cho lượng rapamycin thấp hơn hẳn so với môi trường có bổ sung. Với lượng glycerol 15 g/L, bột hồi 15 g/L (tương đương 1,2 g/L axit shikimic) trong môi trường MD1, chủng xạ khuẩn WT/rapG cho lượng rapamycin cực đại. Do vậy, chúng tôi kết luận rằng đây là môi trường tối ưu cho chủng xạ khuẩn WT/rapG.
KẾT LUẬN
1. Đã tạo được chủng xạ khuẩn chuyển gen Streptomyces rapamycinicus
WT/rapG mang hai bản sao của gen điều hòa dương rapG, có khả năng sinh tổng hợp rapamycin cao gấp 6,5 lần chủng hoang dại trong môi trường MD1 bổ sung glycerol 15 g/L.
2. Môi trường tối ưu cho sinh tổng hợp rapamycin của hai chủng xạ khuẩn
Streptomyces rapamycinicus WT/rapG và WT là môi trường MD1 có bổ sung 15
KIẾN NGHỊ
1. Tiếp tục nghiên cứu sản xuất rapamycin sử dụng chủng WT/rapG và môi trường tối ưu MD1 bổ sung glycerol và axit shikimic trong quy mô công nghiệp. 2. Có thể áp dụng phương pháp chuyển gen trong các nghiên cứu tiếp theo với
TÀI LIỆU THAM KHẢO
1. Ballou L. M., Lin R. Z. (2008), "Rapamycin and mTOR kinase inhibitors",
Journal of Chemistry Biology, 1, pp. 27-36.
2. Basavaraj M. V., Shivayageeswar E. N. (2011), "Production and optimisation of tetracycline by various strains of Streptomyces under solid state fermentation using pineapple peel as a novel substrate", Recent Research in
Science and Technology, 3(2), pp. 01-08.
3. Bérdy J. (2005), "Bioactive microbial metabolites: a personal view", The
Journal of Antibiotics, 58, pp. 1-26.
4. Bhatti A. A., Haq S., Bhat R. A. (2017), "Actinomycetes benefaction role in soil and plant health", Microbial Pathogenesis, 111, pp. 458-467.
5. Blagosklonny M. (2019), "Fasting and rapamycin: diabetes versus benevolent glucose intolerance", Cell Death and Disease, 10(607), pp. 1-10.
6. Chen M., Chang S. (2018), "Ahmpatinin iBu, a new HIV-1 protease inhibitor from Streptomyces sp. CPCC 202950", Royal Society of Chemistry, 8(10), pp. 5138-5144.
7. Chen X. S., Ren X. D. (2012), "Culture medium containing glucose and glycerol as a mixed carbon source improves epsilon-poly-L-lysine production by Streptomyces sp. M-Z18", Bioprocess and Biosystems Engineering, 35(3), pp. 469-475.
8. Chen X., Wei P. (2009), "Generation of high-yield rapamycin-producing strains through protoplasts-related techniques", Applied Microbiology and
Biotechnology, 83(3), pp. 507-12.
9. Chen Y., Liu R. (2017), "Enduspeptides A-F, six new cyclic depsipeptides from a coal mine derived Streptomyces sp.", Tetrahedron, 73(5), pp. 527-531. 10. Cheng Y. R., Hauck L., Demain A. L. (1995), "Phosphate, ammonium, magnesium and iron nutrion of Streptomyces hygroscopicus with respect to
rapamycin biosynthesis", Journal of Industrial Microbiology, 14(5), pp. 424- 427.
11. Dutta S., Basak B. (2014), "Kinetics of rapamycin production by Streptomyces
hygroscopicus MTCC 4003", 3 Biotech, 4(5), pp. 523-531.
12. Dutta S., Basak, B. (2017), "Approaches towards the enhanced production of rapamycin by Streptomyces hygroscopicus MTCC 4003 through mutagenesis and optimization of process parameters by Taguchi orthogonal array methodology", World Journal of Microbiology Biotechnology, 33(5), pp. 1- 13.
13. Emerson R. P., Silva I. R. (2012), "Antibiotics produced by Streptomyces", The Brazilian Journal of Infectious diseases, 16(5), pp. 466-471.
14. Fang A., Demain A. (1995), "Exogenous shikimic acid stimulates rapamycin biosynthesis in Streptomyces hygroscopicus ", Folia Microbiologica, 40(6), pp. 607-610.
15. Geng H., Liu H., Liu J. (2017), "Insights into the metabolic mechanism of rapamycin overproduction in the shikimate-resistant Streptomyces hygroscopicus strain UV-II using comparative metabolomics", World Journal of Microbiology and Biotechnology, 33(6), pp. 1-13.
16. Gregory M. A., Hong H. (2006), "Rapamycin biosynthesis: Elucidation of gene product function", Organic and Biomolecular Chemistry, 4(19), pp. 3565-3568.
17. Harrison D. E. (2009), "Rapamycin fed late in life extends lifespan in genetically heterogeneous mice", Nature, 460(7253), pp. 392-395.
18. Hiroki O., Naota T. (2009), "Rapid separation of shikimic acid from Chinese star anise (Illicium verum Hook. f.) with hot water extraction", Separation and
Purification Technology, 69(1), pp. 102-108.
19. Hozzein W. N., Li W. J. (2004), "Nocardiopsis alkaliphila sp. nov., a novel alkaliphilic actinomycete isolated from desert soil in Egypt", International
20. J. Gatto G. (2006), "Biosynthesis of pipecolic acid by RapL, a lysine cyclodeaminase encoded in the rapamycin gene cluster", Journal of the
American Chemical Society, 128(11), pp. 3838-3847.
21. Jakubiec K., Rajnisz A. (2018), "Secondary metabolites of Actinomycetes and their antibacterial, antifungal and antiviral properties", Polish Journal of
Microbiology, 67(3), pp. 259-272.
22. Jung W. S., Yoo Y. J. (2011), "A combined approach of classical mutagenesis and rational metabolic engineering improves rapamycin biosynthesis and provides insights into methylmalonyl-CoA precursor supply pathway in
Streptomyces hygroscopicus ATCC 29253", Applied Microbiology and
Biotechnology, 91(5), pp. 1389-1397.
23. Kar A. (2008), "Pharmaceutical Microbiology", New Age International, pp. 89 – 101.
24. Kim Wan S., Sean D. (2003), "Nutritional studies on the growth of the rapamycin-producing Streptomyces hygroscopicus", Journal of Microbiology
and Biotechnology, 13(4), pp. 560-563.
25. Kim Y. H., Park B. S. (2014), "Production of rapamycin in Streptomyces
hygroscopicus from glycerol-based media optimized by systemic methodology", Journal of Microbiology and Biotechnology, 24(10), pp. 1319- 1326.
26. Kojima I., Cheng Y. (1995), "Carbon source nutrition of rapamycin biosynthesis in Streptomyces hygroscopicus", Journal of Industrial Microbiology, 14(6), pp. 436-439.
27. Kramer M., Bongaerts J. (2003), "Metabolic engineering for microbial production of shikimic acid", Metabolic Engineering, 5(4), pp. 277-283. 28. Kurniawan Y. N., Kitani, S. (2016), "Regulation of production of the blue
pigment indigoidine by the pseudo gamma-butyrolactone receptor FarR2 in
Streptomyces lavendulae FRI-5", Journal of Bioscience and Bioengineering,
29. Kuscer E., Coates N. (2007), "Roles of rapH and rapG in positive regulation of rapamycin biosynthesis in Streptomyces hygroscopicus", Journal of Bacteriology, 189(13), pp. 4756-4763.
30. Lake E., K. Gunter A. B., Su M. (1998), "Mutational biosynthesis of novel rapamycins by a strain of Streptomyces hygroscopicus NRRL 5491 disrupted in rapL encoding a putative lysine cyclodeaminase", Journal of Bacteriology, 180(4), pp. 809-814.
31. Li J. K., Blenis J. (2014), "Rapamycin: one drug, many effects", Cell
Metabolism, 19(3), pp. 373-379.
32. Mansour F. A., Aldesuquy H. S. (1994), "Studies on plant growth regulators and enzyme production by some bacteria", Quatar University Science Journal, 14(2), pp. 281-288.
33. Mariya L., Giulia P. (2017), "Penicillin's discovery and antibiotic resistance: Lessons for the future", Yale Journal of Biology and Medicine, 90, pp. 135- 145.
34. Mason M. G., Ball A. S. (2001), "Extracellular heme peroxidases in actinomycetes: a case of mistaken identity", Applied and Environmental
Microbiology, 67(10), pp. 4512-4519.
35. Mitra P., Chakrabartty P. (2005), "An extracellular protease with depilation activity from Streptomyces nogalator", Journal of Scientific & Industrial Research, 64, pp. 978-983.
36. MS Lee, Kojima I., Demain A. (1997), "Effect of nitrogen source on biosynthesis of rapamycin by Streptomyces hygroscopicus", Journal of Industrial Microbiology & Biotechnology, 19, pp. 83-86.
37. Mukhta S., Zaheer A. (2017), "Actinomycetes: A source of industrially important enzymes", Journal of Proteomics & Bioinformatics, 10(12), pp. 316-319.
38. Nicholl D. S. T. (2008), An Introduction to Genetic Engineering, Cambridge University Press, UK.
39. Oh D., Poulsen M., Currie C., Clardy J. (2011), "Sceliphrolactam, a polyene macrocyclic lactam from a wasp-associated Streptomyces sp.", Organic
Letters, 13(4), pp. 752-755.
40. Olano C., et al. (2008), "Improving production of bioactive secondary metabolites in actinomycetes by metabolic engineering", Metabolic
Engineering, 10(5), pp. 281-292.
41. Paiva N. L., Demain A. L., Roberts M. F. (1991), "Incorporation of acetate, propionate and methionine into rapamycin by Streptomyces hygroscopicus",
Journal of Natural Products, 54, pp. 167-177.
42. Park S. R., et al. (2010), "Biosynthesis of rapamycin and its regulation: past achievements and recent progress", Journal of Antibiotic (Tokyo), 63(8), pp. 434-441.
43. Patrick C., Susan L. (2001), "Amphotericin biosynthesis in Streptomyces
nodosus : deductions from analysis of polyketide synthase and late genes", Chemistry and Biology, 8(7), pp. 713-723.
44. Raja A., Prabakarana P. (2011), "Actinomycetes and drug - an overview",
American Journal of Drug Discovery and Development, 1(2), pp. 75-84.
45. Raveh A., Delekta, P. C. (2013), "Discovery of potent broad spectrum antivirals derived from marine actinobacteria", PLoS One, 8(12).
46. Schwecke T., Aparicio J. F., Molnar I. (1995), "The biosynthetic gene cluster for the polyketide immunosuppressant rapamycin", Biochemistry, 92(1), pp. 7839-7843.
47. Selman A., W. Albert S. (1945), "Streptomycin - origin, nature and properties", Journal of the American Pharmaceutical Association, 34(11), pp. 273-291.
48. Umesh L., Nishtha K. S., Archana R. T. (2014), "Optimization of nutrient components for rapamycin production by Streptomycetes hygroscopicus under submerged fermentation using Plackett Burman design carried by response
surface methodology", International Journal Of Scientific Research And
Education, 2(8), pp. 1619-1631.
49. Xiang Z., Jin L. (2013), "Precursor engineering and cell physiological regulation for high level rapamycin production by Streptomyces hygroscopicus", Annals of Microbiology, 63(4), pp. 1371-1378.
50. Yang J., Yang Z., Yin Y. (2016), "Three novel polyene macrolides isolated from cultures of Streptomyces lavenduligriseus", The Journal of Antibiotics, 69, pp. 62-65.
51. Yen H., Chen L. (2013), "The enhancement of rapamycin production using
Streptomyces hygroscopicus through a simple pH-shifted control", Journal of the Taiwan Institute of Chemical Engineers, 44(5), pp. 743-747.
52. Young J. Y., Jae-yeon H. (2015), "Characterization of negative regulatory genes for the biosynthesis of rapamycin in Streptomyces rapamycinicus and its
application for improved production", Journal of Industrial Microbiology and
Biotechnology, 42(1), pp125-135.
53. Zhao S., et al. (2013), "Comparative metabolic profiling-based improvement of rapamycin production by Streptomyces hygroscopicus", Applied Microbiology and Biotechnology, 97(12), pp. 5329-5341.
PHỤ LỤC
1. Trình tự gen rapG được gắn với plasmid pSET152, gen rapG bắt đầu từ đoạn trình tự ACCAACGGCGCTGGA đến đoạn trình tự CTGACCGACAGCTGA TGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGG CGCCATTGGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGC GGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAG GCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAA ACGACGGCCAGTGCCAAGCTTGGGCTGCAGGTCGACTCTAGAACCAACG GCGCTGGAGCGGAGGCCGACGGATCGCGCGGGGCGTTCTCCGTGGACTC CACCGTCCCGGGCGCGGCACCACAAGGATTCTTCCAGGCCTTCCAGCGC GGGTGGGACGCGGAGCTCGGCGACGGCTTGCCGCTGCGGAGCTTCAACC GGGATGTGACCGGTGACTTCCGGGTCAGGAGCCGCGCCGCCAAGGTCCG CGACCTGGCGTTCACCGATCTCCACAGCATGTCGGCCATCCGGACCGCA CACGCGCTGGGCGGTGTGGAGGACCGGGTACGGATGTACGTCGTGAAA CGCGGCGCATGGACGTTGGCAGGTTCGCGCGATCGGGACCGGCACACC GTGGCGGCCGGGCAGTTCCTCCTCCGGCACGTCGGGCAGCCGTGGCGCT TCGAGGCGGCGCCGCACACGACGGTGAAGATCCTTCTGCTGCCTCCCGG GCCGCTCACCCCACTGCTGGGAAACCGGGCCGTCACCGGGCCCGCGGAT TCGGCCGAGGTACGCCTGCTGGTGGCCCACGCGAATATGGTGTACGAGA CCATGACCGGCCTGGGCCCGGCCGGTGTGCAAGCCGCCCACAGCACCCT GCTCGAACTGGCCCAGTCGGTGGCGAGGCGTCGGTTCGACGATGTGGAG CCCCGGCTGGCGCCCGCGCTCGCCGGGGCCGCGAAGGACCTCGCGGAC AGCCACCTCACCGACCCCGAGCTCTCCCCCACGATGCTGGCGCGTGAAC TCAACGTCTCCTTACGCACCTTGCAGCGGGCGTTCACCGTGGCGGGAGA GTCGTTGATCGCCTACATCCGTCACCGGCGGCTGGAAGAGGCCCGCCGC GCTCTCATCGCCTCGGCCGGCAGGCTGAGCGTCTCGGAACTCGCCGCCC ACTGGCAGTTCGCCGACAGCAGCCACTTCATCCGGGTCTTCAAGAAGAC CTACGGCCAGACGCCCACCGAGTACGCCCGCTCAACCGGGCTGACCGAC AGCTGACCTCTAGAGGATCCGCGGCCGCGCGCGATATCGAATCGTAA