the x and y components of this car which moves a certain distance is determined by the cosine and sine of its angle theta
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... effects of a combination of key residues Further analysis of these and other mutant SODs is currently underway ACKNOWLEDGEMENTS We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses ... Hiraoka, B .Y. , Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and destruction of conserved Trp159 of Fesuperoxide dismutase from Porphyromonas gingivalis by hydrogen peroxide ... S., Tamagawa, H., Iwakura, K., Tsunasawa, S & Tsunemitsu, A (1990) Characterization of superoxide dismutases purified from either anaerobically maintained or aerated Bacteroides gingivalis J Bacteriol...
- 12
- 740
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... thorax and abdomen (data not shown) Discussion The precise qualitative and quantitative regulation of eukaryotic gene transcription is an extremely complex process A large body of experimental ... critical for the activation of the a- F1-ATPase promoter Computer analysis revealed the presence of two DNA sequence motifs in this region potentially recognized by the GAGA factor (GAF) and the alcohol ... complexes For this reason, ATP synthase and in particular the a- F1-ATPase and b-F1-ATPase catalytic subunits have been often used as markers for mitochondrial biogenesis [6,31,44,45] The Drosophila...
- 11
- 532
- 0
Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx
... CCAGGGTTTGGA; Tax-R, 5′-ACCAGTCGCCTTGTACACAGTCTC; HBZ-S1-F, 5′- TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5′-GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5′-ACCAACTGGGACGACATGGAGAAA; ACTBR, 5′-TAGCACAGCCTGGATAGCAACGTA ... spliced and polyadenylated Retrovirology 2006, 3:15 59 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, Miyanishi T, Yamada Y, Kamihira ... 5′-ACTTGATTAGGCAGACGCGTGAGA; DKK1-331F, 5′-ACTTGTGTGCACAGTCAGCGAGTA; DKK1-331R, 5′-TTAATAAATGCAGGCGGCAGCAGG; DKK1 + 33F, 5′-AAATCCCATCCCGGCTTTGTTGTC; DKK1 + 33R, 5′-TCTCAGAAGGACTCAAGAGGGAGA Polakowski...
- 16
- 460
- 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... stage and the overall availability of transcription factors Gly We made a comparative analysis of two tRNA1 gene copies, which belonged to the highly and poorly transcribed groups The lower stability ... downregulated or completely shut off By contrast, when there is demand for large excesses of a particular type of tRNA, as in the PSG, and sufficient quantities of transcription factors are available, ... and 100·) of the unlabelled fragment (Fig 2D, right, lanes and 4), but not by the fragment from which the TATATAA sequences were mutated to GATATCA, at the same concentrations (lanes and 6) These...
- 15
- 484
- 0
Báo cáo y học: "Assisted assembly: how to improve a de novo genome assembly by using related species" pptx
... fact that 'holes' in the assembly - that is, Table Comparison between initial, assisted, and theoretical 2× canine assemblies Canis familiaris - 2× assembly Initial draft Assisted Theoretical ... initial 2× draft and 97.9% in the 2× assisted assembly 2× mammalian assemblies A major application for the assisted assembly algorithm is the 2× mammalian genomes sequenced for annotation of the ... References Validation: assembly proximity test This section defines what a 'valid' pair of k-mers is, for the proximity validation test We start by fixing a target assembly (for example, one of the 2×...
- 9
- 338
- 0
Báo cáo Y học: Determinants of the inhibition of a Taiwan habu venom metalloproteinase by its endogenous inhibitors revealed by X-ray crystallography and synthetic inhibitor analogues pdf
... Tschesche, H (1994) The X- ray crystal structure of the catalytic domain of human neutrophil collagenase inhibited by a substrate analogue reveals the essentials for catalysis and specificity EMBO J 13, ... (magenta) after the binding of a hydroxamate and a barbiturate inhibitor, respectively [22,46] All these diagrams are in the same scale, produced using GRASP synthesized by linking the P)1 and P)2 ... chemical synthesis of inhibitor analogues We thank Dr Yuch-Cheng Jean of the Synchrotron Radiation Research Center (Hsinchu, Taiwan) and Dr Hideaki Moriyama of the SPring-8 (Hyogo, Japan) for assistance...
- 10
- 475
- 0
Báo cáo y học: " Asthma and genes encoding components of the vitamin D pathway" potx
... 110(5):743-751 Nakao F, Ihara K, Ahmed S, Sasaki Y, Kusuhara K, Takabayashi A, Nishima S, Hara T: Lack of association between CD28/CTLA-4 gene polymorphisms and atopic asthma in the Japanese population Exp ... genotyping in the SLSJ study, integration of datasets and was primary author of the manuscript ML performed statistical analyses in SLSJ, SAGE, CAPPS, and BHS AHP carried out statistical analyses ... ratio matrix is calculated and visually represented The y- axis shows the odds ratio on a log2 scale, which makes the odds ratio above and below on the same visual scale The IL10 genotypes are illustrated...
- 21
- 373
- 0
Báo cáo y học: "Preliminary study into the components of the fear-avoidance model of LBP: change after an initial chiropractic visit and influence on outcome." pps
... Self-efficacy towards an activity is an appraisal of actual physical ability, the additional pain anticipated in performing the task and the individual’s belief in their ability to tolerate this extra ... inevitably negative about back pain, and in a secondary analysis of the data from the BEAM UK [28] study (comparing manipulation, exercise and GP care) Underwood et al [29] reported that patients ... were calculated (Table 5) The result of this analysis suggests that no significant correlation exits between change in pain and changes in either catastrophising or fear-avoidance beliefs This supports...
- 9
- 381
- 0
Báo cáo y học: "Summary The claudin multigene family encodes tetraspan membrane proteins that are crucial structural and functional components of tight junctions, which have important roles in regulating para cellular" pdf
... extracellular loop (EL2) of about 24 residues, and a carboxy-terminal cytoplasmic tail (Figure 2) The size of the carboxy-terminal tail is more variable in length; it is typically between 21 and ... carboxy-terminal tail is the target of various posttranslational modifications, such as serine/threonine and tyrosine phosphorylation [16] and palmitoylation [17], that can significantly alter claudin localization ... on the basis of hydropathy plots, to have four transmembrane helices with their amino- and carboxyterminal tails extending into the cytoplasm [1,8] (Figure 2) The typical claudin protein contains...
- 7
- 348
- 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... head surgery17 In our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are ... et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts Cerebrospinal Fluid Research 2010; 7: 6-13 20 Helland CA, Aarhus M, Knappskog ... poorly understood One explanation is that later fission of MZ makes them particularly prone to this process13 The cleavage of a single fertilized ovum usually occurs between the 3rd and 8th days of...
- 4
- 652
- 0
Báo cáo y học: "Application of Small Angle X-ray Scattering (SAXS) for Differentiation between Normal and Cancerous Breast Tissue"
... contains varying amounts of collagen, extra cellular mucin and elastic tissue [9] This tissue replaces fat as the tumour invades it Thus, carcinoma is typically characterized by the lack of isolated ... pockets of fat within its mass and this is demonstrated in these results by the lack of any adipose peak in the carcinoma diffraction profile The peak positions for the adipose and fibrocystic changes ... dilate, untwist, and unfold to produce a solitary locule that then enlarges as a cyst Understandably, fibrosis is often reported by pathologists in an attempt to explain clinical palpability or...
- 4
- 448
- 0
COMPONENTS OF REPRODUCTIVE ISOLATION BETWEEN THE MONKEYFLOWERS MIMULUS LEWISII AND M. CARDINALIS (PHRYMACEAE) potx
... sympatric populations of Asclepias exaltata and A syriaca (Asclepiadaceae) Am J Bot 83: 1580–1584 Burke, J M., S E Carney, and M L Arnold 1998 Hybrid fitness in the Louisiana irises: analysis of ... bands and by quantifying longdistance pollen and seed dispersal The nonrandom distribution of M lewisii and M cardinalis suggests either that the species are isolated by intrinsic aspects of their ... Hiesey et al (1971) demonstrated physiological and life-history adaptation of M cardinalis and M lewisii to the elevations at which they normally occur These species are distinguished by a number...
- 15
- 662
- 0
Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx
... deprivationinduced PC12 cell death and DNA fragmentation Survival assays (MTT-based assay) and DNA fragmentation ELISAs were performed as described in Materials and methods, and the data are presented ... from the calculation of kd/ka, where ka is the association rate and kd is the dissociation rate Relative Kd is equal to Kd of IGF-I/Kd of IGF analogue Dashes indicate data inappropriate for assessing ... tightly with overall receptor af®nity but rather with the dissociation rate or occupancy time of receptor [31,32] In the present study, the analysis of association and dissociation rates of the...
- 8
- 482
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... AACEVAPD1 AACEVAPD3 AACEVAPD2 AACEVAPD5 AACEVAPD4 AACEVAPD6 Vma3p Vma11p Vma16p 100 97 80 80 80 80 50 50 32 100 94 93 93 54 51 28 AACEVAPD5 AACEVAPD2 AACEVAPD3 AACEVAPD1 Table Alignments of the ... preparation of recombinants in yeast expression vector In the case of AACEVAPD1, and 6, TAA is used as an Acetabularia-specific codon usage (translated as Gln) Conversion of TAA to CAA was performed by ... transformant Western blot analysis was carried out to examine the assembly of V-ATPase complex in the vacuolar-membraneenriched fraction of the respective transformant The antibody against the...
- 8
- 391
- 0
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf
... by evaluation of association and dissociation phases (I) and equilibrium binding data (II) as described in Materials and methods kon (MÆs))1 Gla Gla–EGFN Gla–EGFN,C Factor X Factor Xa DEGR-factor ... the fragment has a conformation that is commensurate with membrane-binding The on-rates for Gla–EGFN and Gla–EGFNC are about a factor of five higher than for the Gla-domain This can presumably ... binding isotherms The concentration dependence of factor X binding is shown in Fig It is apparent that the adsorption is rapid and that Fig Equilibrium isotherms of factor X and its Gla-containing...
- 6
- 401
- 0
Báo cáo khoa học: Interaction of the E2 and E3 components of the pyruvate dehydrogenase multienzyme complex of Bacillus stearothermophilus ppt
... govern the assembly of cubic and dodecahedral cores of pyruvate dehydrogenase complexes Proc Natl Acad Sci USA 96, 1240–1245 17 Takenaka A, Kizawa K, Hata T, Sato S, Misaka E-J, Tamura C & Sasida Y ... representing the PSBD of the dihydrosuccinyltransferase chain of the 2-oxoglutarate dehydrogenase complex of E coli [12] and of the dihydroacetyltransferase chain of the PDH complex of B stearothermophilus ... Assembly of pyruvate dehydrogenase complex metabolite in the synthesis of fatty acids, cholesterol, steroids in eukaryotes and N-acetyl-derived carbohydrates The structural and mechanistic...
- 10
- 558
- 0
Báo cáo Y học: Tag-mediated isolation of yeast mitochondrial ribosome and mass spectrometric identification of its new components ppt
... (Novagen) Strains and media Yeast strain Ray 3A- a (a type haploid of RAY 3A- D leu2/ leu2, his3/his3, ura3/ura3, trp1/trp1) was used to isolate mitoribosome An MRP4 disruptant was constructed by transforming ... be an easy task because the number of yeast mrps as well as that of E coli ribosomal proteins may still increase [23] and the phylogenetic identity is not always clear due to the lack of data ... Cross-genomic analysis of the translational systems of various organisms J Ind Microbiol Biotechnol 27, 163–169 39 Matsushita, Y. , Kitakawa, M & Isono, K (1989) Cloning and analysis of the nuclear genes...
- 12
- 383
- 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt
... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... leu2D0 lys2D0 ura3D0 oxa1D::KanMX4 BY4 742 Mata his3D1 leu2D0 lys2D0 ura3D0 oxa1D::KanMX4 psd1D::His3MX6 BY4 7 4X Mata his3D1 leu2D0 met15D0 ura3D0 oxa1D::KanMX4 psd2D::KanMX4 BY4 741 Mata his3D1 leu2D0...
- 11
- 354
- 0
báo cáo hóa học: " Measuring the ICF components of impairment, activity limitation and participation restriction: an item analysis using classical test theory and item response theory" potx
... In an item analysis, the candidate items are completed by participants from the target population and analysed statistically This analysis can suggest items that may not be appropriate for the ... and IRT analysis are initially reported by construct and then the reliability and validity of final measures are explored together A) IMPAIRMENT Classical test theory approach The mean item difficulties ... the study, the analysis and the drafting and revision of the manuscript MJ participated in the conception and design of the study and the drafting and revision of the manuscript PD and DD contributed...
- 20
- 557
- 0
Báo cáo hóa học: " The stability of functional equation min{f(x + y), f (x - y)} = |f(x) - f(y)|" docx
... f(z) The continuity of f assures the existence of x ’, z’’ Î [x , z’], x ’
- 6
- 285
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008